ID: 1109170365

View in Genome Browser
Species Human (GRCh38)
Location 13:59088721-59088743
Sequence CCAAGGCCTCCATTTTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109170365_1109170370 20 Left 1109170365 13:59088721-59088743 CCAGAAAAAAATGGAGGCCTTGG No data
Right 1109170370 13:59088764-59088786 TCAGTGTTCCAGAAATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109170365 Original CRISPR CCAAGGCCTCCATTTTTTTC TGG (reversed) Intergenic
No off target data available for this crispr