ID: 1109170621

View in Genome Browser
Species Human (GRCh38)
Location 13:59092838-59092860
Sequence AAATTTGTACAGATGTATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109170618_1109170621 28 Left 1109170618 13:59092787-59092809 CCAAACTTTTTCTGCCATGCTAC No data
Right 1109170621 13:59092838-59092860 AAATTTGTACAGATGTATCTAGG No data
1109170619_1109170621 14 Left 1109170619 13:59092801-59092823 CCATGCTACTTTCATTACCTGCT No data
Right 1109170621 13:59092838-59092860 AAATTTGTACAGATGTATCTAGG No data
1109170620_1109170621 -3 Left 1109170620 13:59092818-59092840 CCTGCTTAGAGTACACTCTAAAA No data
Right 1109170621 13:59092838-59092860 AAATTTGTACAGATGTATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109170621 Original CRISPR AAATTTGTACAGATGTATCT AGG Intergenic
No off target data available for this crispr