ID: 1109190422

View in Genome Browser
Species Human (GRCh38)
Location 13:59316188-59316210
Sequence TAATCTTGTCTATGGCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109190422_1109190428 28 Left 1109190422 13:59316188-59316210 CCAAGAGGCCATAGACAAGATTA No data
Right 1109190428 13:59316239-59316261 GGATCATGCTTGGGTCAAGCTGG No data
1109190422_1109190426 18 Left 1109190422 13:59316188-59316210 CCAAGAGGCCATAGACAAGATTA No data
Right 1109190426 13:59316229-59316251 TCAAAGTTCAGGATCATGCTTGG No data
1109190422_1109190427 19 Left 1109190422 13:59316188-59316210 CCAAGAGGCCATAGACAAGATTA No data
Right 1109190427 13:59316230-59316252 CAAAGTTCAGGATCATGCTTGGG No data
1109190422_1109190425 7 Left 1109190422 13:59316188-59316210 CCAAGAGGCCATAGACAAGATTA No data
Right 1109190425 13:59316218-59316240 AGTTCAAAATATCAAAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109190422 Original CRISPR TAATCTTGTCTATGGCCTCT TGG (reversed) Intergenic
No off target data available for this crispr