ID: 1109190424

View in Genome Browser
Species Human (GRCh38)
Location 13:59316196-59316218
Sequence TTTAAACCTAATCTTGTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109190424_1109190427 11 Left 1109190424 13:59316196-59316218 CCATAGACAAGATTAGGTTTAAA No data
Right 1109190427 13:59316230-59316252 CAAAGTTCAGGATCATGCTTGGG No data
1109190424_1109190425 -1 Left 1109190424 13:59316196-59316218 CCATAGACAAGATTAGGTTTAAA No data
Right 1109190425 13:59316218-59316240 AGTTCAAAATATCAAAGTTCAGG No data
1109190424_1109190428 20 Left 1109190424 13:59316196-59316218 CCATAGACAAGATTAGGTTTAAA No data
Right 1109190428 13:59316239-59316261 GGATCATGCTTGGGTCAAGCTGG No data
1109190424_1109190426 10 Left 1109190424 13:59316196-59316218 CCATAGACAAGATTAGGTTTAAA No data
Right 1109190426 13:59316229-59316251 TCAAAGTTCAGGATCATGCTTGG No data
1109190424_1109190429 28 Left 1109190424 13:59316196-59316218 CCATAGACAAGATTAGGTTTAAA No data
Right 1109190429 13:59316247-59316269 CTTGGGTCAAGCTGGAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109190424 Original CRISPR TTTAAACCTAATCTTGTCTA TGG (reversed) Intergenic
No off target data available for this crispr