ID: 1109190428

View in Genome Browser
Species Human (GRCh38)
Location 13:59316239-59316261
Sequence GGATCATGCTTGGGTCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109190424_1109190428 20 Left 1109190424 13:59316196-59316218 CCATAGACAAGATTAGGTTTAAA No data
Right 1109190428 13:59316239-59316261 GGATCATGCTTGGGTCAAGCTGG No data
1109190422_1109190428 28 Left 1109190422 13:59316188-59316210 CCAAGAGGCCATAGACAAGATTA No data
Right 1109190428 13:59316239-59316261 GGATCATGCTTGGGTCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109190428 Original CRISPR GGATCATGCTTGGGTCAAGC TGG Intergenic
No off target data available for this crispr