ID: 1109194559

View in Genome Browser
Species Human (GRCh38)
Location 13:59363814-59363836
Sequence ACCACAGAAGTTCTCAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109194558_1109194559 6 Left 1109194558 13:59363785-59363807 CCTATTATTAACTGTCACATGTG No data
Right 1109194559 13:59363814-59363836 ACCACAGAAGTTCTCAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109194559 Original CRISPR ACCACAGAAGTTCTCAGAGA AGG Intergenic
No off target data available for this crispr