ID: 1109197842

View in Genome Browser
Species Human (GRCh38)
Location 13:59398340-59398362
Sequence CCTTTTTTCCAGAGGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109197842_1109197850 16 Left 1109197842 13:59398340-59398362 CCAGCCAGCCTCTGGAAAAAAGG No data
Right 1109197850 13:59398379-59398401 CCACTTTTGTGAGTGATGCTGGG No data
1109197842_1109197848 15 Left 1109197842 13:59398340-59398362 CCAGCCAGCCTCTGGAAAAAAGG No data
Right 1109197848 13:59398378-59398400 CCCACTTTTGTGAGTGATGCTGG No data
1109197842_1109197851 17 Left 1109197842 13:59398340-59398362 CCAGCCAGCCTCTGGAAAAAAGG No data
Right 1109197851 13:59398380-59398402 CACTTTTGTGAGTGATGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109197842 Original CRISPR CCTTTTTTCCAGAGGCTGGC TGG (reversed) Intergenic
No off target data available for this crispr