ID: 1109197980

View in Genome Browser
Species Human (GRCh38)
Location 13:59400145-59400167
Sequence CAAGATTACCATTGCCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109197978_1109197980 9 Left 1109197978 13:59400113-59400135 CCATAAGAATGAATGAAATAAAT No data
Right 1109197980 13:59400145-59400167 CAAGATTACCATTGCCATATTGG No data
1109197977_1109197980 27 Left 1109197977 13:59400095-59400117 CCAGAAAAGGGGATAAGTCCATA No data
Right 1109197980 13:59400145-59400167 CAAGATTACCATTGCCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109197980 Original CRISPR CAAGATTACCATTGCCATAT TGG Intergenic
No off target data available for this crispr