ID: 1109202439

View in Genome Browser
Species Human (GRCh38)
Location 13:59445936-59445958
Sequence ACTCATTTGAAGACTTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109202439_1109202443 5 Left 1109202439 13:59445936-59445958 CCATCCAAAGTCTTCAAATGAGT No data
Right 1109202443 13:59445964-59445986 TACCCTAACCCTGGTAGAGCAGG No data
1109202439_1109202442 -4 Left 1109202439 13:59445936-59445958 CCATCCAAAGTCTTCAAATGAGT No data
Right 1109202442 13:59445955-59445977 GAGTGGAAATACCCTAACCCTGG No data
1109202439_1109202448 26 Left 1109202439 13:59445936-59445958 CCATCCAAAGTCTTCAAATGAGT No data
Right 1109202448 13:59445985-59446007 GGCCTAATCAGTTGCTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109202439 Original CRISPR ACTCATTTGAAGACTTTGGA TGG (reversed) Intergenic
No off target data available for this crispr