ID: 1109207015

View in Genome Browser
Species Human (GRCh38)
Location 13:59493691-59493713
Sequence TTGAATAACCACAAGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109207015_1109207017 -9 Left 1109207015 13:59493691-59493713 CCTTCATCCTTGTGGTTATTCAA No data
Right 1109207017 13:59493705-59493727 GTTATTCAAGTGAAAGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109207015 Original CRISPR TTGAATAACCACAAGGATGA AGG (reversed) Intergenic
No off target data available for this crispr