ID: 1109208373

View in Genome Browser
Species Human (GRCh38)
Location 13:59506488-59506510
Sequence AGGGCTGCTTCAGTTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109208373_1109208379 18 Left 1109208373 13:59506488-59506510 CCTGGCACAACTGAAGCAGCCCT No data
Right 1109208379 13:59506529-59506551 CTGCTCATGATGGAAACCAATGG No data
1109208373_1109208377 8 Left 1109208373 13:59506488-59506510 CCTGGCACAACTGAAGCAGCCCT No data
Right 1109208377 13:59506519-59506541 CAACAACTGCCTGCTCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109208373 Original CRISPR AGGGCTGCTTCAGTTGTGCC AGG (reversed) Intergenic
No off target data available for this crispr