ID: 1109208791

View in Genome Browser
Species Human (GRCh38)
Location 13:59511122-59511144
Sequence CAAGATCACCAGATTCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109208789_1109208791 4 Left 1109208789 13:59511095-59511117 CCATAGTTGTCTTTAACACAGAG No data
Right 1109208791 13:59511122-59511144 CAAGATCACCAGATTCACAGTGG No data
1109208788_1109208791 7 Left 1109208788 13:59511092-59511114 CCTCCATAGTTGTCTTTAACACA No data
Right 1109208791 13:59511122-59511144 CAAGATCACCAGATTCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109208791 Original CRISPR CAAGATCACCAGATTCACAG TGG Intergenic
No off target data available for this crispr