ID: 1109213650

View in Genome Browser
Species Human (GRCh38)
Location 13:59563465-59563487
Sequence GAGGGTGACCAGAGGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109213650_1109213659 1 Left 1109213650 13:59563465-59563487 CCCTCACTCCTCTGGTCACCCTC No data
Right 1109213659 13:59563489-59563511 CAATGGATCCCTGTGGTGCCAGG 0: 21
1: 67
2: 116
3: 137
4: 216
1109213650_1109213660 5 Left 1109213650 13:59563465-59563487 CCCTCACTCCTCTGGTCACCCTC No data
Right 1109213660 13:59563493-59563515 GGATCCCTGTGGTGCCAGGCAGG 0: 130
1: 140
2: 109
3: 79
4: 814
1109213650_1109213663 10 Left 1109213650 13:59563465-59563487 CCCTCACTCCTCTGGTCACCCTC No data
Right 1109213663 13:59563498-59563520 CCTGTGGTGCCAGGCAGGAATGG 0: 137
1: 146
2: 97
3: 112
4: 610
1109213650_1109213667 21 Left 1109213650 13:59563465-59563487 CCCTCACTCCTCTGGTCACCCTC No data
Right 1109213667 13:59563509-59563531 AGGCAGGAATGGCCTCCTTGGGG No data
1109213650_1109213666 20 Left 1109213650 13:59563465-59563487 CCCTCACTCCTCTGGTCACCCTC No data
Right 1109213666 13:59563508-59563530 CAGGCAGGAATGGCCTCCTTGGG No data
1109213650_1109213665 19 Left 1109213650 13:59563465-59563487 CCCTCACTCCTCTGGTCACCCTC No data
Right 1109213665 13:59563507-59563529 CCAGGCAGGAATGGCCTCCTTGG No data
1109213650_1109213654 -6 Left 1109213650 13:59563465-59563487 CCCTCACTCCTCTGGTCACCCTC No data
Right 1109213654 13:59563482-59563504 ACCCTCCCAATGGATCCCTGTGG 0: 18
1: 40
2: 102
3: 95
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109213650 Original CRISPR GAGGGTGACCAGAGGAGTGA GGG (reversed) Intergenic
No off target data available for this crispr