ID: 1109213654

View in Genome Browser
Species Human (GRCh38)
Location 13:59563482-59563504
Sequence ACCCTCCCAATGGATCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 18, 1: 40, 2: 102, 3: 95, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109213650_1109213654 -6 Left 1109213650 13:59563465-59563487 CCCTCACTCCTCTGGTCACCCTC No data
Right 1109213654 13:59563482-59563504 ACCCTCCCAATGGATCCCTGTGG 0: 18
1: 40
2: 102
3: 95
4: 206
1109213647_1109213654 15 Left 1109213647 13:59563444-59563466 CCTTCTCCTTTGGATTTTTATCC No data
Right 1109213654 13:59563482-59563504 ACCCTCCCAATGGATCCCTGTGG 0: 18
1: 40
2: 102
3: 95
4: 206
1109213648_1109213654 9 Left 1109213648 13:59563450-59563472 CCTTTGGATTTTTATCCCTCACT No data
Right 1109213654 13:59563482-59563504 ACCCTCCCAATGGATCCCTGTGG 0: 18
1: 40
2: 102
3: 95
4: 206
1109213651_1109213654 -7 Left 1109213651 13:59563466-59563488 CCTCACTCCTCTGGTCACCCTCC No data
Right 1109213654 13:59563482-59563504 ACCCTCCCAATGGATCCCTGTGG 0: 18
1: 40
2: 102
3: 95
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109213654 Original CRISPR ACCCTCCCAATGGATCCCTG TGG Intergenic
900241892 1:1621205-1621227 GCCCTCCCCATGGGCCCCTGTGG - Intronic
902255640 1:15187116-15187138 ACACTCCCACTGGATAGCTGTGG - Intronic
903658344 1:24962434-24962456 ACCCTGCAAATGGGACCCTGGGG + Intronic
903874953 1:26467570-26467592 ACCCTCACAATGGAGCTGTGAGG - Intronic
903951294 1:26997482-26997504 ACCATCCCAGGGGATCCCTTGGG + Intronic
904756295 1:32770542-32770564 CCCCTCCCACTGCCTCCCTGGGG - Exonic
905103350 1:35545075-35545097 ACCCTCCCACTGGACTTCTGGGG - Intronic
905990838 1:42335540-42335562 ACCCTGCCCACGGATACCTGGGG + Intronic
906380548 1:45329601-45329623 ACCCTCCAAAAGGCTGCCTGAGG + Intronic
906525852 1:46492932-46492954 ACCCTCCCTAGGGCTGCCTGGGG - Intergenic
907349060 1:53811161-53811183 AACCTTCTGATGGATCCCTGTGG - Intronic
910077525 1:83298577-83298599 ACCCTCCTGATGGATCCCTATGG - Intergenic
910598589 1:89005953-89005975 GACCTCCCGATAGATCCCTGTGG + Intergenic
910739083 1:90495131-90495153 ACCCTCCTGATGGATCCCTGTGG + Intergenic
911678971 1:100692145-100692167 ACCCTCCCAATGAATCCGTGTGG + Intergenic
912616235 1:111102518-111102540 ACCCTCCTGATGGATTCCTGTGG + Intergenic
913151323 1:116046923-116046945 ACCCTCCCAAGGGATCCCTGTGG - Intronic
913439629 1:118884105-118884127 ACCCTCCCAATGGATGAGAGTGG - Exonic
914927082 1:151897978-151898000 ACCCTCCTGATGAATCCCTGTGG - Intronic
914967887 1:152277554-152277576 ACCCTCCCAATGGATCCTTGTGG - Intergenic
915660628 1:157402426-157402448 TCCTTCCCAGTGGTTCCCTGAGG - Intergenic
916263656 1:162868761-162868783 ACCCTCCTGATGGATCCCCATGG - Exonic
917057966 1:171004350-171004372 ACCCTCCTGATGGATCCCTGTGG + Intronic
917318906 1:173758762-173758784 ACCCTCCCAATGGATCCCTGTGG - Intronic
917898575 1:179517550-179517572 GCCCTCCCGAAGGATCCCTGTGG + Intronic
918158274 1:181872302-181872324 ACCCTCCTGAAGGATCCTTGTGG - Intergenic
919717114 1:200790319-200790341 CCCCTCCCACTGGAACCATGGGG + Intronic
919969974 1:202569555-202569577 AGCCTCCCATTGGGTGCCTGGGG + Intronic
922673484 1:227532837-227532859 ACCCTCCTGATGGATCCCTGTGG + Intergenic
923648136 1:235845375-235845397 ACCCTCCCAATGGATCCTTGTGG - Intronic
923808740 1:237288905-237288927 CCTCTCCCATTGGATCCCTGTGG + Intronic
923874602 1:238034299-238034321 ACCCTCCTGATGGATCCTTGTGG - Intergenic
924041503 1:239988617-239988639 CCCCTCACCATGTATCCCTGTGG - Intergenic
924302408 1:242652600-242652622 GCTCTCCCCATGGATCCCTGTGG + Intergenic
924321488 1:242855247-242855269 GCCCTCCCAAAGGATCCCTGTGG + Intergenic
1062921276 10:1281675-1281697 ATCCTCCCCATGCAGCCCTGCGG - Intronic
1063114484 10:3064224-3064246 CCCCTCCCAGTGGCTCCCCGTGG + Intergenic
1065471063 10:26081662-26081684 ACCCTACCATTGGATCCCTGTGG + Intronic
1066507164 10:36057329-36057351 AGCCACCCCAGGGATCCCTGAGG + Intergenic
1066684880 10:37971470-37971492 ACCCTCTCAAGGGATCTATGAGG - Intronic
1068480701 10:57585313-57585335 TCCCTCCCAGTGGATCCCTGTGG - Intergenic
1069150594 10:64954326-64954348 ATCCTCCTGATCGATCCCTGTGG + Intergenic
1069242803 10:66163311-66163333 ACCCTCCCAATGGATCTCTGTGG + Intronic
1069831811 10:71286414-71286436 ATCCTCGCGATGGATCCCTATGG + Intronic
1071484658 10:86091024-86091046 GCCATCCTGATGGATCCCTGTGG - Intronic
1074122995 10:110507075-110507097 ACACTACAAATGGATCCCTGTGG + Exonic
1074985895 10:118659145-118659167 ACCCTCCTGATGGATCCCTGTGG + Intergenic
1074986588 10:118664958-118664980 ACCCTCCCAGTGGCTCTGTGAGG - Intergenic
1075660707 10:124193663-124193685 ACCCTCCCGATGGATCCCTGTGG + Intergenic
1075982848 10:126756007-126756029 ACCCTCCTGATGGAACCCTGTGG + Intergenic
1078288504 11:9982964-9982986 ACCCTTCTGAGGGATCCCTGTGG - Intronic
1080324052 11:31049891-31049913 ACCCTCGCAATGGATCCCTGTGG - Intronic
1081195185 11:40152339-40152361 ACCCTCCCAGTGGATCCCCGTGG - Intronic
1082140557 11:48603661-48603683 ACCCTCCTGATGGATCCCGGTGG + Intergenic
1082567750 11:54700761-54700783 ACCCTCCTGATGGATCCCTGTGG + Intergenic
1083234387 11:61342455-61342477 AGCTTCCCCGTGGATCCCTGCGG - Exonic
1083628960 11:64086052-64086074 TCCCTCCCTATGGAGCCCTGGGG + Intronic
1084840484 11:71842579-71842601 ACCCTCCTGATGGATGCCTGTGG - Intergenic
1085747720 11:79129255-79129277 ACCCTCCCAATGGATCCCTCTGG - Intronic
1086178480 11:83920572-83920594 ACCCCCCCAATAGATACCTCAGG - Intronic
1086544537 11:87952138-87952160 ACCCTCCCGATGGATCCCTGTGG - Intergenic
1087619401 11:100525213-100525235 GCCCTCCTGATGGATCCTTGTGG - Intergenic
1088206338 11:107397053-107397075 ACCCTCCTGTTGGATCCCTGTGG - Intronic
1088239444 11:107758579-107758601 ACCCTCCCAAAGAATCCTTGTGG - Intergenic
1088388118 11:109282029-109282051 ACCCTCCTGATGGATCCCTGTGG + Intergenic
1089107303 11:116023672-116023694 ACCCTCCCGATGGATCCCTGTGG - Intergenic
1090481694 11:127074557-127074579 GCCCTCCCCATGTCTCCCTGAGG + Intergenic
1090757241 11:129803385-129803407 ACCCTCCCGATGGATTCCTGTGG - Intergenic
1091210605 11:133854908-133854930 ACTCTCCTGATGGATCCCTGTGG + Intergenic
1093172251 12:15874236-15874258 ACTCTTCCAGTGGATCCCTGTGG - Intronic
1093389510 12:18601928-18601950 ACCCCACTGATGGATCCCTGTGG - Intronic
1093488824 12:19681777-19681799 GCCCTCCCAAAGGATCCCTGTGG + Intronic
1093720497 12:22436989-22437011 ACCCTCCTGATGGATCCCTGCGG - Intronic
1093994876 12:25630703-25630725 GCCCTCCCAATGGATCCCTGTGG - Intronic
1094362032 12:29640668-29640690 TCTCTCCCATTGGATCCCTGTGG - Intronic
1094501274 12:31023156-31023178 ACCCTCCTGATGGATCCCTGTGG - Intergenic
1094801970 12:34047922-34047944 ACCCTCCCAAAGGATCCCTGTGG - Intergenic
1095115103 12:38343830-38343852 GCCCTCCTGAAGGATCCCTGTGG - Intergenic
1095248263 12:39946959-39946981 ACTCTCCTGATGGATCACTGTGG + Intronic
1095665100 12:44788550-44788572 ACCCTCCCAAAGGATCCCTGTGG - Intronic
1095732562 12:45521667-45521689 ATTCTCCTGATGGATCCCTGTGG - Intergenic
1095892696 12:47249659-47249681 ACCCTCTCAGTGGATCCCTGTGG - Intergenic
1096534314 12:52261400-52261422 AACCTCCCAGTGGGTCCCAGGGG + Intronic
1096956776 12:55534388-55534410 ACCCACCCAATGGATCCCTGTGG - Intergenic
1097124674 12:56764664-56764686 ACCCTCTCAATAAATCACTGAGG + Intronic
1097295402 12:57957774-57957796 GCCCTTGCAATGGATCTCTGTGG - Intergenic
1097317200 12:58184493-58184515 TCCCTCTCAGTGGCTCCCTGTGG + Intergenic
1097386062 12:58950862-58950884 ACCCTCCCGATGGATCCCTGTGG + Intergenic
1097760456 12:63459066-63459088 ACCCTTCCGATGGATCCCTGTGG - Intergenic
1098961005 12:76739591-76739613 GCCCTCCTGTTGGATCCCTGTGG + Intergenic
1099392965 12:82102835-82102857 ACACTACCGATGGATCCCTGTGG - Intergenic
1099473115 12:83074977-83074999 ACCCTCCTGATGGATCCCTGTGG + Intronic
1099777495 12:87151772-87151794 ACCCTCCTGATGGGTCCCTGTGG + Intergenic
1100275295 12:93066555-93066577 AGCATCCCAATGGATCGCTCAGG - Intergenic
1100291075 12:93215343-93215365 ACCCTCTGGATGGATCCCTGTGG + Intergenic
1101838187 12:108309759-108309781 CCCCTCCCTATTGTTCCCTGGGG + Intronic
1102209865 12:111118611-111118633 GCCCTCCCAATGGATCCAACTGG + Intronic
1102409484 12:112704794-112704816 ACACTGCTAATGGATTCCTGGGG + Intronic
1103761192 12:123251440-123251462 ACCCTCCCGATGGATCCCTGTGG + Intronic
1104504581 12:129319205-129319227 ACCCTCCCCATAGATCCTTGTGG + Intronic
1105255831 13:18743639-18743661 ATCCTCCCCAGGGACCCCTGTGG - Intergenic
1105908170 13:24834722-24834744 CCTCTCCCACTGAATCCCTGTGG - Intronic
1106938226 13:34747670-34747692 ACCATCCTGATAGATCCCTGTGG + Intergenic
1107666310 13:42694252-42694274 GCCCTCCCAATGGATCCCTGTGG + Intergenic
1107987520 13:45787942-45787964 ACTCTCCCAATGCTTCCTTGTGG + Intronic
1108616836 13:52141517-52141539 ACCCTGGCAATTGATCCCTTTGG + Intronic
1108817024 13:54304953-54304975 TCTCTCCCATTGCATCCCTGTGG - Intergenic
1108825470 13:54407831-54407853 GCCCTCCCGAAGGATCCCTATGG - Intergenic
1109048013 13:57438082-57438104 ACCCTCCTGATGGATCCCTGTGG + Intergenic
1109176623 13:59165908-59165930 ACTCTCCCAATGAATCCACGTGG + Intergenic
1109213654 13:59563482-59563504 ACCCTCCCAATGGATCCCTGTGG + Intergenic
1110561787 13:76917653-76917675 CCTCTCCCGCTGGATCCCTGAGG - Intergenic
1110661280 13:78061397-78061419 CCTTTCCCATTGGATCCCTGTGG + Intergenic
1111165843 13:84455952-84455974 ACCCCCCCAATAGATCCCTGTGG + Intergenic
1112035456 13:95492769-95492791 ACCCTCCTGATGGATCCCTGTGG + Intronic
1112354744 13:98664500-98664522 ACCCACCAAATAGATGCCTGAGG - Intergenic
1112738006 13:102443034-102443056 ACCCTCCCTATGGATCCCTGTGG - Intergenic
1112945232 13:104919883-104919905 ACCCTTCCAATGGATCCCTGTGG - Intergenic
1113270007 13:108662854-108662876 ACCCTCCCAATGAATCCCTGTGG + Intronic
1113329876 13:109317500-109317522 ACCCTCCAGATGGATCCCTGTGG - Intergenic
1114025587 14:18523183-18523205 TCCCTCCCAAATGATTCCTGGGG + Intergenic
1114692392 14:24595872-24595894 ACCCTCCCAATGGATCCGTGTGG + Intergenic
1115299163 14:31865186-31865208 GCCCTCCCGATGGATCTCTGTGG - Intergenic
1115680239 14:35730275-35730297 ACCCTCCCAAAGGATCCCTGTGG - Intronic
1115835568 14:37398072-37398094 GCCCTCTCGTTGGATCCCTGTGG + Intronic
1115958441 14:38808643-38808665 GCCCTCCTGAAGGATCCCTGTGG - Intergenic
1115969733 14:38932171-38932193 GCCCTCCTGAAGGATCCCTGTGG - Intergenic
1115996839 14:39203747-39203769 ACTCTCCTGATAGATCCCTGTGG - Intergenic
1116049110 14:39781615-39781637 GCCCTCCCAGTGGATCCCCGTGG + Intergenic
1116806754 14:49501334-49501356 GCCCTCCCAAAGGATCCCTGTGG - Intergenic
1117510865 14:56449235-56449257 ACCCTCCTGATGGATCCCTGTGG + Intergenic
1117639753 14:57785806-57785828 ACCCTCCCAATGGATCCCTGTGG - Intronic
1118162232 14:63301961-63301983 ACCCTCCTGATGGATCCCTGTGG - Intergenic
1118503467 14:66386042-66386064 TACCTCCCAATGAATCCCTCTGG + Intergenic
1118724315 14:68617900-68617922 ACCCTCCCCCTGTATCCCTTGGG - Intronic
1121459774 14:94065887-94065909 ACCCTCCCAGTGGATCCCTGTGG - Intronic
1121516691 14:94556830-94556852 ACCCTCCCAAAGGGCTCCTGTGG + Intergenic
1121930317 14:97966301-97966323 ACCCGCCTACTGGAACCCTGGGG + Intronic
1122428942 14:101627942-101627964 CCCAGCTCAATGGATCCCTGCGG + Intergenic
1202865575 14_GL000225v1_random:114950-114972 ACCCTCCCCGTGGAAGCCTGGGG - Intergenic
1202921830 14_KI270723v1_random:34696-34718 ACCCTCCCAGCGGAAGCCTGGGG + Intergenic
1202923086 14_KI270724v1_random:2885-2907 ACCCTCCCAGCGGAAGCCTGGGG - Intergenic
1124380647 15:29162200-29162222 GCCCTCCTGGTGGATCCCTGTGG - Intronic
1124557047 15:30735996-30736018 TCCCTCCCAAAGGATGCCTGCGG - Intronic
1124674216 15:31669748-31669770 TCCCTCCCAAAGGATCCCTGTGG + Intronic
1125056003 15:35359474-35359496 TCTCTCCCATTGGATCCCTGTGG + Intronic
1125506420 15:40270279-40270301 GCCCTCCCAGAGGCTCCCTGAGG + Intronic
1125922651 15:43534718-43534740 ACCATCCCAAGAGTTCCCTGAGG - Exonic
1126460880 15:48913703-48913725 ACCCTCCCGATGGATCCCTGTGG + Intronic
1126572637 15:50168568-50168590 ACCCTCCTGATGGATCTCTTTGG - Intronic
1126577415 15:50210526-50210548 ACCCTCCTGATGGATCCCTGTGG - Intronic
1127031064 15:54863472-54863494 ATCCTCCTGATGCATCCCTGTGG - Intergenic
1127258540 15:57310826-57310848 AGCCTCCCACTGGAGCCTTGGGG + Intergenic
1127525322 15:59786900-59786922 ATCCTCCCAATGGATCCCTGTGG + Intergenic
1128238639 15:66084685-66084707 ACCCTCCTGATGGATCCCTGTGG - Intronic
1128414942 15:67436455-67436477 ACCGTCCTGATGGATCCCTGTGG - Intronic
1128886603 15:71293899-71293921 TCCCTCCCAGTGGCTGCCTGGGG + Intronic
1129097677 15:73225892-73225914 GCCCTCCCAAAGGATCCCTGTGG + Intronic
1129410723 15:75348893-75348915 ACCCTCCCTCAGGATGCCTGAGG + Exonic
1131487922 15:92837520-92837542 ACCATCCCCTAGGATCCCTGAGG + Intergenic
1132210375 15:100017464-100017486 TCCCTCCCGATGGATCCCTGTGG + Intronic
1134757136 16:16677405-16677427 ACCATCCCTTTGGATGCCTGTGG + Intergenic
1134988932 16:18681758-18681780 ACCATCCCTTTGGATGCCTGTGG - Intergenic
1135901507 16:26464444-26464466 CCTCTCCCATTGAATCCCTGTGG - Intergenic
1136540403 16:30924989-30925011 ACCCTCCTCTTGGATCCCTCAGG - Intronic
1138118878 16:54382224-54382246 ACCCTTCCAATGGATCAGAGAGG + Intergenic
1138798059 16:59993628-59993650 GCCCTCCTGATGGATTCCTGTGG + Intergenic
1141935625 16:87236173-87236195 AGCCTCCCAGTGGCTGCCTGTGG - Intronic
1143259448 17:5587112-5587134 GCCCTCCCAATGGTTCCCGGGGG + Intronic
1144139765 17:12336993-12337015 ACCTTCCTGATGGATCTCTGTGG + Intergenic
1144439724 17:15270825-15270847 GCCCTCCCAGTGCCTCCCTGGGG - Intergenic
1144790393 17:17855198-17855220 ACCCTCCCTCCTGATCCCTGAGG - Intronic
1145879264 17:28341889-28341911 ACCCTCCCTATGATTCCCTGTGG + Intronic
1147722358 17:42547022-42547044 AACCTCTCCAGGGATCCCTGAGG - Intergenic
1151048316 17:70947788-70947810 CCTCTCCCGCTGGATCCCTGTGG - Intergenic
1151665058 17:75541052-75541074 ACCCACCCAAATGCTCCCTGGGG - Intronic
1153069565 18:1089659-1089681 ACCCTCCTGATGGATCCCTGTGG + Intergenic
1153966019 18:10182548-10182570 ACCCTCCGGATGGATCCCTGTGG + Intergenic
1154094006 18:11393480-11393502 ACCTTCCCAATGGATCCTTGTGG - Intergenic
1154435193 18:14337035-14337057 ATCCTCCCCAGGGACCCCTGTGG + Intergenic
1157559371 18:48635911-48635933 AGACTCCCAATGCATCCCTTGGG + Intronic
1158331600 18:56368469-56368491 ACCCTCCTGTTGGATCCCTGTGG + Intergenic
1158756415 18:60331470-60331492 ATCCTCCTGATGGATCCCTGTGG - Intergenic
1158829676 18:61263707-61263729 ACCCTTTCGAAGGATCCCTGTGG - Intergenic
1160267675 18:77354148-77354170 ACCCTCCCAATGGATCCCTGTGG + Intergenic
1163104339 19:15114880-15114902 ACTCTCCCACTGGAACTCTGGGG - Exonic
1164237763 19:23351930-23351952 TCCCTCCTGATGGATTCCTGTGG - Intronic
1164267369 19:23632501-23632523 ACCCTCCTGATGGATCCCTTTGG - Intronic
1164320241 19:24137863-24137885 TCCCTCCTGAAGGATCCCTGTGG + Intergenic
1165386750 19:35514394-35514416 TCCCTCCCACTCGTTCCCTGGGG - Intergenic
1166326161 19:42052379-42052401 AGCCTCCCCAGGGAGCCCTGGGG - Intronic
1168458478 19:56534213-56534235 GCCCTCCCAGTGGATCCCTGTGG + Intergenic
926872825 2:17441620-17441642 TGCCTCCCAGAGGATCCCTGTGG + Intergenic
926916087 2:17893525-17893547 ACCCTCATGATGGATCCCCGTGG + Intronic
928733663 2:34261277-34261299 ACCCTCCTGAAGGATCCCTGTGG - Intergenic
928772611 2:34720067-34720089 CCTCTCCCATTGGATCCCTGTGG + Intergenic
929598737 2:43191895-43191917 TCCCTCCCTCTGGATCTCTGGGG + Intergenic
930486582 2:52018244-52018266 ACCCTCCCAATGGATTCCTGTGG + Intergenic
931547802 2:63408471-63408493 ACCCCCTCAATGGATCCCTATGG - Intronic
932100795 2:68897381-68897403 TCCCTCCCATTGGATCCCTGTGG + Intergenic
932577303 2:72969869-72969891 GGCCTCCCAAGGGATTCCTGGGG + Intronic
933531443 2:83517316-83517338 ACCCACCTGATGGATCTCTGTGG - Intergenic
934047521 2:88185214-88185236 AATGTCCCACTGGATCCCTGGGG + Intronic
934490830 2:94761198-94761220 ATCCTCCCCAGGGACCCCTGTGG - Intergenic
937057774 2:118953955-118953977 ACCTTCCTGATGGATTCCTGTGG - Intronic
937069339 2:119050744-119050766 ACTCACCTGATGGATCCCTGTGG + Intergenic
937104755 2:119300016-119300038 AGCCTCCCAGTGGAGACCTGAGG - Intergenic
937529206 2:122808432-122808454 ACCCTCACAATGGATCCCTGTGG - Intergenic
938038228 2:128054127-128054149 ACCCTCCTAATGGATCCCTATGG + Intergenic
938598351 2:132811873-132811895 ACCTTCCTGATGGATCCCTGTGG + Intronic
938796175 2:134719360-134719382 CCCCTCCCACTGGATTCCTCTGG + Intergenic
940034789 2:149302185-149302207 ACCCTCCTGATGGATCCCTGTGG + Intergenic
940172452 2:150843484-150843506 ACCCTCCTGATGGATCCCTGTGG + Intergenic
940618765 2:156084234-156084256 TCCCTCCTGATGGATCCCTATGG + Intergenic
940709468 2:157144417-157144439 ACCCTCCTGATGGATCCCTGTGG + Intergenic
943519585 2:188931656-188931678 AGGCTACCACTGGATCCCTGAGG + Intergenic
943621231 2:190150318-190150340 ACCCTCCTGATGGATCTCTGTGG + Intronic
944874125 2:203944245-203944267 ACCCTCCAGATGGATCCCTGTGG + Intronic
945132177 2:206584841-206584863 ACCTTCCCGTTGGATCCCTATGG + Intronic
945864455 2:215161253-215161275 ACCCTCCCGATGGATCCTTGTGG - Intergenic
947457159 2:230265543-230265565 CCTCTCCCATTGGGTCCCTGTGG + Intronic
948429847 2:237912345-237912367 ACCCTCCCCACAGATACCTGGGG + Intergenic
1170245844 20:14220624-14220646 CTTCTCCCATTGGATCCCTGGGG + Intronic
1170375903 20:15699856-15699878 ATCCTTCCAATGGATCCTTGTGG + Intronic
1170721103 20:18879733-18879755 GCCCTCCTGATGGATCCCTGTGG + Intergenic
1170863240 20:20128286-20128308 GCCCTTCTGATGGATCCCTGTGG + Intronic
1171165522 20:22967084-22967106 ACCCTCCCAATGGATCCCTGTGG - Intergenic
1171242442 20:23582473-23582495 GTCTTCCCAGTGGATCCCTGTGG + Intergenic
1173914149 20:46694043-46694065 ACCCTGTGAATGGATTCCTGGGG + Intergenic
1174578570 20:51554980-51555002 ACCATCCCTGTGGAACCCTGGGG + Intronic
1175068982 20:56316082-56316104 ACCCTCCTGATGGATCCTTGTGG - Intergenic
1175636186 20:60586441-60586463 AGCCTCCCCAGGGGTCCCTGGGG + Intergenic
1175723083 20:61299308-61299330 CTCCTCCCAATGGGTCCCAGAGG + Intronic
1176841844 21:13848666-13848688 ATCCTCCCCAGGGACCCCTGTGG - Intergenic
1178499101 21:33110965-33110987 AGCCTCCCAACAGCTCCCTGAGG + Intergenic
1178958950 21:37046929-37046951 GCTCTCCCAATGGGTCCCTGCGG - Intergenic
1179716216 21:43290128-43290150 ACCCTCCCAAGGCAGCCATGGGG - Intergenic
1180929258 22:19577779-19577801 GCCCTCCGGATGCATCCCTGGGG - Intergenic
1181039636 22:20185759-20185781 GCCCTCCCCAGGAATCCCTGAGG + Intergenic
1183048533 22:35241525-35241547 ACCCTCCTGATGGATCCCGGTGG + Intergenic
949604124 3:5634796-5634818 ATCCTCCCGATGGATCCCTGTGG + Intergenic
949814166 3:8040662-8040684 ACCCTCTCGGTGGATCCCTGTGG - Intergenic
950603628 3:14058225-14058247 GCCCTCCTGAAGGATCCCTGTGG + Intronic
951236446 3:20241299-20241321 ACCCTCCTACTGGTTCCCTGAGG - Intergenic
951490507 3:23265639-23265661 TCCTTACCAATGGTTCCCTGTGG - Intronic
952097275 3:29968445-29968467 ACCCTCCTGCTGGATCCCTGTGG + Intronic
953084605 3:39654403-39654425 ACCCTCCCAATGGATCCCTGTGG + Intergenic
953114942 3:39983570-39983592 AGCCTGCCACTGGATCCCAGGGG + Intronic
953724036 3:45381993-45382015 ACTCTCCTGAAGGATCCCTGTGG + Intergenic
954580815 3:51702111-51702133 ACCCACCCAATGGCTCTCTTGGG - Intronic
954945600 3:54421515-54421537 ACACTCCCAAGGGACCCCTGAGG - Intronic
955175726 3:56611681-56611703 ACCCTCCTGATGGATCCCTGTGG + Intronic
955461701 3:59190104-59190126 ACCCTCCCAGTGGATCCTTCTGG + Intergenic
957016479 3:75069904-75069926 GCCCTCCCAGTGGATCCCTGTGG + Intergenic
957427829 3:80063505-80063527 ACCCTCACGATGAATCTCTGTGG - Intergenic
958647193 3:96888185-96888207 CCTCTCCCATTGAATCCCTGTGG + Intronic
959046909 3:101484767-101484789 ATCCACCCAATGGATTCCTGTGG - Intronic
959279704 3:104323019-104323041 ACCCTCCTGATGGCTCTCTGTGG - Intergenic
959436078 3:106316937-106316959 ACCCACCTGATGGATTCCTGTGG - Intergenic
959757044 3:109911262-109911284 TCTCTCCCATTGGATCCCTGTGG + Intergenic
960016078 3:112889558-112889580 GCCCTCCCAGTGGATCCCTGTGG + Intergenic
960066560 3:113380208-113380230 AAACTCACAATGGATCCCAGTGG + Intronic
962031532 3:131606074-131606096 AACCTTCCGTTGGATCCCTGAGG + Intronic
962401929 3:135067785-135067807 GCCCTCCTGAGGGATCCCTGTGG + Intronic
962977143 3:140455733-140455755 GCCTTCCCAAGGGATCCCTGGGG + Intronic
964917565 3:161854926-161854948 CCCTTCCTGATGGATCCCTGTGG + Intergenic
965216963 3:165875296-165875318 ACCCTCCTGATGGATCCCTGTGG + Intergenic
966117761 3:176485575-176485597 ACCTTCCTGATGGATCCCTGTGG + Intergenic
967209002 3:187150174-187150196 ACCCTCCCTATGGTTCCCTGTGG - Intronic
967257599 3:187609433-187609455 ACCCTCCCAAAGGATCTCTGTGG + Intergenic
967399858 3:189049026-189049048 ACCCTCCCAGTGGATCGCTGTGG - Intronic
967819584 3:193828611-193828633 CCCCTCCCAATAGCTCCGTGTGG - Intergenic
969286068 4:6202530-6202552 ACGCTCCCTATGAAGCCCTGGGG - Intergenic
969522542 4:7686926-7686948 ACCCTCCTCAGGGTTCCCTGTGG - Intronic
969781564 4:9408573-9408595 ACCCTCCTGATGGATGCCTGTGG - Intergenic
970346661 4:15159197-15159219 ACCCTCCTGATGGATCCCTGTGG + Intergenic
970658706 4:18260640-18260662 ACCCTCCCAAGAGATCCCTGTGG + Intergenic
971183210 4:24349904-24349926 ACCCTCCCGATGGATCCCTGTGG + Intergenic
971901076 4:32658613-32658635 ACCCTCCTGATGGATCCCTGTGG + Intergenic
972158592 4:36196421-36196443 ACCCTACCACTGGCTCTCTGAGG + Intronic
973179677 4:47252119-47252141 GCCCTCCAGATGGATCCCTGTGG + Intronic
973782320 4:54300321-54300343 ACCCTCCCTATGGATCCCTGTGG - Intergenic
973787004 4:54341737-54341759 GCCCTCCCTATGGATCCCCGTGG - Intergenic
974949332 4:68569503-68569525 ACCCTCCTAAAGGATCACTGTGG - Intronic
975033732 4:69656763-69656785 AACCTCCCAGTGGATCCCTGTGG - Intergenic
975517185 4:75259877-75259899 ACCCTCCTGATGGATCCCTGTGG - Intergenic
976207866 4:82639500-82639522 GCCCTCCCAGGGGCTCCCTGAGG - Intronic
976856395 4:89609813-89609835 ACTCACTCAATGGATCCCTGTGG - Intergenic
977020082 4:91747345-91747367 AGCCACCCAATGGATCCCTGTGG + Intergenic
977370145 4:96124960-96124982 AGTCTCCCAAAGGTTCCCTGTGG + Intergenic
977733142 4:100379534-100379556 GCCCTCCTGATGGATCCCTGTGG - Intergenic
977746712 4:100558280-100558302 GCCCTCCCGATGGATCCCTGTGG - Intronic
977904601 4:102461048-102461070 ATCCTCCTGATGGATGCCTGTGG + Intergenic
978670613 4:111244016-111244038 CCTCTCCCTTTGGATCCCTGTGG - Intergenic
978726776 4:111978069-111978091 CCTCTCCCGATGGAGCCCTGTGG + Intergenic
979704769 4:123708894-123708916 ACCCTCCTGATGGATCCCTGTGG - Intergenic
979995392 4:127425756-127425778 TCCCTCCTGGTGGATCCCTGTGG - Intergenic
981559651 4:146033124-146033146 ACCCTCCCAGTGGATCCCTATGG - Intergenic
981760876 4:148193081-148193103 ACCCTCCCGATGGATCCCTGTGG + Intronic
982190013 4:152844019-152844041 ACCCTCCTGATGGATCCCTGTGG + Intronic
982218854 4:153107521-153107543 ATCCTCCCAAAGGATCCCTGTGG + Intergenic
982630466 4:157823911-157823933 ACCCTCCGGAAGGATCCCTATGG - Intergenic
983449700 4:167895017-167895039 ACCCTCACGATGGATCCCTGTGG - Intergenic
984266786 4:177505845-177505867 ACACTCACGATGGTTCCCTGTGG + Intergenic
984527634 4:180875849-180875871 TCTCTCCCATTGGATTCCTGGGG + Intergenic
984721543 4:182977663-182977685 GCCATCCCGAAGGATCCCTGTGG - Intergenic
985092798 4:186381522-186381544 CCTCTCCCGATGGATCCCTGTGG - Intergenic
985217857 4:187672325-187672347 CCTCTCCCGATGGATCCCTGTGG + Intergenic
988344526 5:30020670-30020692 TCTCTCCCATTGGATCCCTGTGG - Intergenic
988712667 5:33794024-33794046 ACCCTCCCCATGAATCCCTGTGG + Intronic
990712906 5:58604914-58604936 ACCGTCCAGATGGATCCCTGTGG + Intronic
991386864 5:66100729-66100751 TCCCTCCTGATGGATCCTTGCGG - Intergenic
993883955 5:93395184-93395206 ACCCTCCCAATGGATCCCTGTGG + Intergenic
993964695 5:94346709-94346731 TCTCTCCCGTTGGATCCCTGTGG - Intronic
994567340 5:101466958-101466980 ACTCTGGCAGTGGATCCCTGTGG - Intergenic
994568458 5:101483355-101483377 GCCCTCCCGAAGGATCCCTATGG + Intergenic
995317978 5:110797754-110797776 ACCCTCTGGAAGGATCCCTGTGG + Intergenic
995473098 5:112523723-112523745 ACCCTTCCAATGGATCCCTGTGG + Intergenic
995817727 5:116191182-116191204 ACCCTCCTGATGGATCCCTGTGG - Intronic
996010672 5:118478734-118478756 GCCCTCCCAATGGATACCTGTGG - Intergenic
996504871 5:124257625-124257647 ACCCTCCCAATGGATCCCTGTGG + Intergenic
997530732 5:134579733-134579755 ACCCCCCAAATGGACCCCAGTGG - Exonic
997614829 5:135239225-135239247 ACAGTCCCAGTGGATCCCGGTGG + Intronic
998467419 5:142356982-142357004 CCTCTCCCAACGGTTCCCTGCGG - Intergenic
998940763 5:147280149-147280171 CCTCTCCCATTGGATCCCTGTGG - Intronic
999203234 5:149831251-149831273 ACCCTCCAATGGGCTCCCTGAGG - Intronic
999484955 5:151985793-151985815 ACCCTCCCAAAGGATTCCTGTGG + Intergenic
999818426 5:155200564-155200586 GCCCTCCCAATGGATCCCTGTGG - Intergenic
1000199874 5:158997724-158997746 AACCCTCCAGTGGATCCCTGTGG + Intronic
1000757994 5:165184576-165184598 ACCCTCCCAATGGATCCCTGTGG + Intergenic
1000779574 5:165464589-165464611 ATCCTCCAGAAGGATCCCTGTGG - Intergenic
1001526193 5:172430451-172430473 TCCCTCCCCATGGGTGCCTGTGG + Intronic
1002813761 6:659747-659769 ACCTTCCAGATGGATCCCTGTGG - Intronic
1003029515 6:2589686-2589708 ACCTTCCTGCTGGATCCCTGTGG + Intergenic
1003063070 6:2877268-2877290 ACCCTCCCAAAGGATCCCTGTGG - Intergenic
1003581856 6:7347481-7347503 ACCCTCGCTTTGGATCCCTGTGG - Intronic
1003712001 6:8602803-8602825 GCCCTCCCATTGGATGCCTGTGG + Intergenic
1005191506 6:23228922-23228944 ACCCTCCTGATGGATCCCTGTGG + Intergenic
1008121537 6:47622441-47622463 GCCCTCCCTATGGATCCCTGTGG + Intronic
1008305245 6:49891984-49892006 ACCCTCTCGAGGGATCTCTGTGG - Intergenic
1009384207 6:63069081-63069103 ACTCTCCCAATGGATCCCTGTGG + Intergenic
1009453089 6:63824794-63824816 ACCCTCCTGATGGATCCCTGTGG - Intronic
1010009034 6:71028644-71028666 GCCCTCCGGAAGGATCCCTGTGG + Intergenic
1011233252 6:85187514-85187536 ACCCTCCCAGTAGATCCATGTGG - Intergenic
1011789827 6:90885921-90885943 ACCCTCCCGATGGATCTCTATGG + Intergenic
1011957482 6:93040609-93040631 TCCCTCCGCATGGGTCCCTGTGG + Intergenic
1012793663 6:103733932-103733954 GCCCTCCTGATGGATCCCTGTGG - Intergenic
1012922605 6:105235026-105235048 CCCCTCCCGATGGATCCCTGTGG - Intergenic
1013289750 6:108709751-108709773 ACACTCCCCATGCATCCCTCTGG + Intergenic
1013852714 6:114535033-114535055 TCTCTCCCATTGGATCCCTGTGG + Intergenic
1013877793 6:114855507-114855529 ACCCTGCCAAAGGATCCCTGTGG - Intergenic
1013901071 6:115156607-115156629 ACCCTCCCAATGGATCCCTGTGG + Intergenic
1014304897 6:119727920-119727942 ACCCTCCTGAAGGATCCCTGTGG + Intergenic
1014603816 6:123448126-123448148 ACCCTCCTGATGAATCCCTGTGG - Intronic
1014738692 6:125123993-125124015 ACCCACCTGATGGGTCCCTGTGG - Intronic
1015362446 6:132355250-132355272 ACCCTCCCAAAAGATCCCTGTGG + Intronic
1015501368 6:133937040-133937062 ACCCTCCTGATGGATCCCTGTGG + Intergenic
1020860712 7:13489145-13489167 ACCCTCCTGATGGATCCCTGTGG - Intergenic
1020915169 7:14184180-14184202 ACCCTCCCGTTGGATCCCTGTGG - Intronic
1022777784 7:33545308-33545330 ACCCTCGCAATGGATCCCTGTGG + Intronic
1023159055 7:37279721-37279743 ACCCTCCCGTTGGATCCCTGTGG - Intronic
1023701179 7:42893159-42893181 AACCTCCCGATGGATCGCTGTGG - Intergenic
1024442196 7:49433346-49433368 ACCCCTCCAGTGGATCCCTATGG + Intergenic
1024545393 7:50513366-50513388 GCCTTCCCAATGGATCCCTGTGG - Intronic
1024669362 7:51577926-51577948 GCCCTCCCAAAGGGTCCCTGTGG + Intergenic
1024745444 7:52400386-52400408 GCCCTCCCAATGGATCCCTGTGG + Intergenic
1026661978 7:72310285-72310307 ACCCTCACAATGGCTCAATGAGG - Intronic
1027295300 7:76763782-76763804 ACCCTCCTGATGGATCCCTATGG - Intergenic
1027350534 7:77306790-77306812 GCCGTCCTGATGGATCCCTGTGG + Intronic
1028183039 7:87748083-87748105 GCCCTCCCTTTGGATCCCTGTGG + Intronic
1028993654 7:97076410-97076432 ACCCTCCCAATGGATCCCTGTGG + Intergenic
1029884279 7:103850486-103850508 ACCCTCTCGATGGATCCCTGTGG - Intronic
1031761326 7:125716415-125716437 ACCCTCCTGATGGATACCTGTGG + Intergenic
1031879149 7:127176892-127176914 ACCCTCCCAATGGATCCCTGTGG - Intronic
1033279199 7:139993821-139993843 ACCCTCCCATTGGATGGATGAGG - Intronic
1033521129 7:142161231-142161253 ACCATCCCTGTGGATCACTGTGG + Intronic
1034430084 7:151036778-151036800 CCCCACCCTATGCATCCCTGGGG - Intronic
1035833803 8:2727354-2727376 CCTCTCCCGTTGGATCCCTGTGG - Intergenic
1036501062 8:9314186-9314208 ATCCTCCCAATAAATCCATGTGG - Intergenic
1036859648 8:12336405-12336427 ACCCCCCCGATGGATGTCTGCGG + Intergenic
1038237002 8:25769088-25769110 ATCCTCCCTATGGATCCCTGTGG - Intergenic
1038367291 8:26948848-26948870 GCCCTCCCTGTGGATTCCTGTGG + Intergenic
1039083368 8:33755774-33755796 GCCCTCTCCAAGGATCCCTGTGG + Intergenic
1039268428 8:35854278-35854300 ACTCTCCCGATGGATCCCTGTGG - Intergenic
1040299429 8:46180286-46180308 AACCTCCCCCTGGGTCCCTGTGG + Intergenic
1040635754 8:49270891-49270913 ACCTTCCCAATGTATCCCTGTGG + Intergenic
1041227686 8:55716740-55716762 CCTCTCCCATTGGATCCCTGTGG - Intronic
1043816960 8:84813015-84813037 ACCCTCCTGATGGATCCCTGTGG + Intronic
1045657048 8:104398237-104398259 ACCCTCCACATGGATTCCTGTGG - Intronic
1045779754 8:105849366-105849388 ACCCTCCCAATGGATCCCTGTGG - Intergenic
1046498382 8:115043324-115043346 ACCCTCCTTATGGATCCCTGTGG - Intergenic
1046600371 8:116309935-116309957 ACCTTACCAATGGATCCGTGAGG + Intergenic
1047130835 8:122017897-122017919 ACCCTCCCAATGGATCCCTGTGG + Intergenic
1049064318 8:140301006-140301028 ACCTTCCCCATGGACCCATGGGG + Intronic
1049064321 8:140301011-140301033 ATCCTCCCCATGGGTCCATGGGG - Intronic
1049786998 8:144455823-144455845 ACCCTCCTAAGGGAGCACTGAGG + Intronic
1049896157 9:113592-113614 ACCCTCCCCGGGGCTCCCTGCGG - Intergenic
1050502602 9:6314843-6314865 ACCCCCGCAATGGATCCCTGTGG - Intergenic
1051362600 9:16294483-16294505 ACCCTCCCGGTGGATTCCTGTGG - Intergenic
1052537062 9:29761177-29761199 GCCCTCCTGATGGATCCCTGTGG - Intergenic
1052731547 9:32291664-32291686 TCCCTCCCAATGGATTCCTGTGG + Intergenic
1052881291 9:33602313-33602335 ACCCTCCCTGGGGACCCCTGTGG + Intergenic
1053495027 9:38543529-38543551 ACCCTCCCTGGGGACCCCTGTGG - Intronic
1055347060 9:75350439-75350461 ACCCTCCCGATGGATCCCTGTGG + Intergenic
1055905894 9:81292875-81292897 ACGCTCCCAGTGGATCCCTGTGG + Intergenic
1056322814 9:85452480-85452502 ACCCTCCCAATGGATCCCTGTGG + Intergenic
1057119583 9:92559223-92559245 GCCCTCCCGATGGATCCCTGTGG + Intronic
1057751244 9:97794993-97795015 ACCCTGAAAATGGATCCCTAGGG + Intergenic
1058085120 9:100740172-100740194 ACCCTCCTGATGGATCCCTGTGG + Intergenic
1058156751 9:101524576-101524598 ACTCTCCCGATGGATCCCTGTGG + Intronic
1058308486 9:103471783-103471805 TCCCTCCTGATGGATTCCTGTGG + Intergenic
1058410327 9:104724597-104724619 ACCCTCCTGATGGATCCCTGTGG - Intergenic
1058457032 9:105147362-105147384 ATCATCCAAATGGATCCCAGTGG + Intergenic
1058651541 9:107179586-107179608 ACTATGCCAATGGCTCCCTGTGG - Intergenic
1058861725 9:109123017-109123039 ACCCTTCCAATGGGTCAGTGAGG + Intergenic
1061207612 9:129173908-129173930 ACCCGCCCCAGGGATCCCTGTGG - Intergenic
1061303275 9:129718435-129718457 CCCCTGCCGATGGATCCCTCTGG + Intronic
1203738764 Un_GL000216v2:161208-161230 ACCCTCCCAGTGGAAGCCCGGGG + Intergenic
1187219288 X:17308175-17308197 GCCCTCCCAATGGATCCCTATGG + Intergenic
1187430731 X:19221981-19222003 ACCCTCCCAATGGATTCCTGTGG + Intergenic
1187681339 X:21770607-21770629 CCTCTCCCATTGGATTCCTGTGG - Intergenic
1187748306 X:22433230-22433252 ACCCTCCCAATGGATCCCTGTGG - Intergenic
1187773696 X:22730939-22730961 ACCCTCCTGATGGATCCCTGTGG + Intergenic
1189218087 X:39344613-39344635 ACCCTCCCAATGGATCCCTGTGG - Intergenic
1189603102 X:42648365-42648387 ACCCTCCTGATGGATCTCTGTGG - Intergenic
1189962075 X:46333486-46333508 ACCCTCCCGATGGATCCTTGTGG - Intergenic
1190448846 X:50557642-50557664 ACCCTCCGGATGGATCCCTGTGG - Intergenic
1190895558 X:54614521-54614543 ATCATCCCGCTGGATCCCTGTGG + Intergenic
1191067690 X:56367576-56367598 ACCCTCCCGATGGATCTCTGTGG + Intergenic
1191151891 X:57228244-57228266 ACCCTCCTGATGGATCCCTGTGG + Intergenic
1191779954 X:64854387-64854409 TCCCTCCTGATGGATCCCTGTGG + Intergenic
1191903656 X:66064790-66064812 ACCCTCCCGATGGATCCCTGTGG + Intergenic
1192014795 X:67317633-67317655 TCCCTCCTAATGGATCCCTGTGG + Intergenic
1192543874 X:71996878-71996900 ACTATCCCACTGGTTCCCTGAGG + Intergenic
1192914594 X:75638691-75638713 ACCCTTGTAATGGATCCTTGTGG + Intergenic
1192970336 X:76221771-76221793 ACCCTCCTGATGGATCTCTGTGG + Intergenic
1192979126 X:76319552-76319574 ACCCTCCTGATGGATCCCTATGG + Intergenic
1193062683 X:77223079-77223101 ACCCACCCGATGGATCCTTGTGG - Intergenic
1193154512 X:78158459-78158481 TCCCTCCTGATGGATCCCTGTGG - Intergenic
1193156775 X:78182886-78182908 GCCCTCCCCATGGATCCCTGCGG - Intergenic
1193253471 X:79319912-79319934 ATCCTCCTGATGGATCCCTGTGG + Intergenic
1193420727 X:81279721-81279743 ACCCTCCCGATGGATCCCTATGG - Intronic
1193779724 X:85686661-85686683 ACCCACCCAACGGATCCCTGTGG + Intergenic
1193786083 X:85760916-85760938 TCCCTCCCAAAGGATCCCTGTGG + Intergenic
1193826384 X:86231840-86231862 TCCCTCCTGATGGATCCCTGTGG + Intronic
1193937544 X:87641429-87641451 AGCCTCCAAATGTATCCCTGTGG - Intronic
1194605616 X:95974829-95974851 ACCCTTCCGATAGATCCCTGTGG - Intergenic
1195795373 X:108641778-108641800 GCCCTCCCGATGGATCCCTGTGG - Intronic
1196218827 X:113087951-113087973 ACCCTCCAGATGGATCCCTGTGG - Intergenic
1196590569 X:117481966-117481988 ACCCTCCCAATGGATCCCTGTGG + Intergenic
1196675832 X:118419281-118419303 GCCCTCCCGAAGGATCCCTGTGG + Intronic
1197132318 X:123019705-123019727 GCCCTCCTGATGGATCCCTGTGG - Intergenic
1197518841 X:127472714-127472736 GCCCTCCAGAAGGATCCCTGTGG - Intergenic
1197953622 X:131923453-131923475 ACCCTCCCAATGGATGCCTGTGG - Intergenic
1198843156 X:140880601-140880623 GCCCTCTGGATGGATCCCTGTGG - Intergenic
1199521592 X:148741743-148741765 AATCTCTCAATGGATCCCTGTGG + Intronic
1199668438 X:150120824-150120846 ACCCTCCCAATGAATCCCTGTGG - Intergenic
1201179557 Y:11332358-11332380 ACCCTCCCCACGGAAGCCTGGGG + Intergenic
1202043645 Y:20714206-20714228 ACCCTCTGGATGGATCCCTGTGG - Intergenic
1202366349 Y:24168470-24168492 ACCCTCCCAAAGTCACCCTGTGG - Intergenic
1202504432 Y:25501653-25501675 ACCCTCCCAAAGTCACCCTGTGG + Intergenic