ID: 1109213659

View in Genome Browser
Species Human (GRCh38)
Location 13:59563489-59563511
Sequence CAATGGATCCCTGTGGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 21, 1: 67, 2: 116, 3: 137, 4: 216}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109213650_1109213659 1 Left 1109213650 13:59563465-59563487 CCCTCACTCCTCTGGTCACCCTC No data
Right 1109213659 13:59563489-59563511 CAATGGATCCCTGTGGTGCCAGG 0: 21
1: 67
2: 116
3: 137
4: 216
1109213653_1109213659 -7 Left 1109213653 13:59563473-59563495 CCTCTGGTCACCCTCCCAATGGA 0: 5
1: 30
2: 62
3: 100
4: 252
Right 1109213659 13:59563489-59563511 CAATGGATCCCTGTGGTGCCAGG 0: 21
1: 67
2: 116
3: 137
4: 216
1109213648_1109213659 16 Left 1109213648 13:59563450-59563472 CCTTTGGATTTTTATCCCTCACT No data
Right 1109213659 13:59563489-59563511 CAATGGATCCCTGTGGTGCCAGG 0: 21
1: 67
2: 116
3: 137
4: 216
1109213647_1109213659 22 Left 1109213647 13:59563444-59563466 CCTTCTCCTTTGGATTTTTATCC No data
Right 1109213659 13:59563489-59563511 CAATGGATCCCTGTGGTGCCAGG 0: 21
1: 67
2: 116
3: 137
4: 216
1109213651_1109213659 0 Left 1109213651 13:59563466-59563488 CCTCACTCCTCTGGTCACCCTCC No data
Right 1109213659 13:59563489-59563511 CAATGGATCCCTGTGGTGCCAGG 0: 21
1: 67
2: 116
3: 137
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109213659 Original CRISPR CAATGGATCCCTGTGGTGCC AGG Intergenic
902644678 1:17790199-17790221 CACTGGGGCCCTGTGGTTCCTGG - Intronic
903220264 1:21865399-21865421 CGAGGGGTCCCTGGGGTGCCAGG + Intronic
903672046 1:25042200-25042222 CCTTGGGTCCCTGTGGTTCCTGG - Intergenic
904334183 1:29786360-29786382 CACTGGATCCCAGGGCTGCCAGG - Intergenic
904370179 1:30043268-30043290 CTTTGGAGCCCTGTGGTTCCTGG + Intergenic
906054042 1:42900383-42900405 CAAACGAGCCCTGTGATGCCAGG + Intergenic
906209148 1:44002646-44002668 CCATGGAGCCCTCTTGTGCCAGG - Exonic
907349058 1:53811154-53811176 TGATGGATCCCTGTGGTGCCAGG - Intronic
908564563 1:65341196-65341218 CAATGCAGCCCTTTGGTGTCTGG - Intronic
909631820 1:77775933-77775955 CAATGTCTCCCTATGTTGCCAGG - Intergenic
910077521 1:83298570-83298592 TGATGGATCCCTATGGTGCCAGG - Intergenic
910598593 1:89005960-89005982 CGATAGATCCCTGTGGTGCCAGG + Intergenic
910739087 1:90495138-90495160 TGATGGATCCCTGTGGTGCTAGG + Intergenic
911678976 1:100692152-100692174 CAATGAATCCGTGTGGTACCAGG + Intergenic
912616239 1:111102525-111102547 TGATGGATTCCTGTGGTGCCAGG + Intergenic
913151318 1:116046916-116046938 CAAGGGATCCCTGTGGTGCCAGG - Intronic
914927078 1:151897971-151897993 TGATGAATCCCTGTGGTGCCAGG - Intronic
914967882 1:152277547-152277569 CAATGGATCCTTGTGGTGCCAGG - Intergenic
915482161 1:156194315-156194337 CAAAGGATGCCTGGGGTGTCAGG + Intronic
916263652 1:162868754-162868776 TGATGGATCCCCATGGTGCCAGG - Exonic
916579836 1:166097248-166097270 CGTTGGATCCCTATGGTGCCAGG - Intronic
917318901 1:173758755-173758777 CAATGGATCCCTGTGGTGCCAGG - Intronic
917435705 1:175018963-175018985 CAGTGGATACCTGTGGGGCAAGG - Intronic
917461503 1:175234473-175234495 TGATGGATCCCTGTAGTGTCAGG - Intergenic
917898580 1:179517557-179517579 CGAAGGATCCCTGTGGTGCCAGG + Intronic
917966602 1:180182905-180182927 CAAGGCTTGCCTGTGGTGCCTGG + Intronic
918158270 1:181872295-181872317 TGAAGGATCCTTGTGGTGCCAGG - Intergenic
919308556 1:195876795-195876817 CAATGAATGCCTGTAATGCCAGG - Intergenic
919836319 1:201576107-201576129 TGAGGGATCCCTGTGGTGACAGG - Intergenic
920581864 1:207117257-207117279 CAAGGTCTCCCTGTGTTGCCCGG - Intronic
921166710 1:212513221-212513243 CACTGAATCCCTGTGGTGAGGGG - Intergenic
922041590 1:221903315-221903337 CATTGGGGCCCTGTGGTTCCTGG - Intergenic
922657822 1:227401528-227401550 CCAAAGATCCCTGTGGTGCCAGG - Intergenic
922673488 1:227532844-227532866 TGATGGATCCCTGTGGTGCCAGG + Intergenic
923648131 1:235845368-235845390 CAATGGATCCTTGTGGTGCCAGG - Intronic
923808743 1:237288912-237288934 CATTGGATCCCTGTGGTGCCAGG + Intronic
923874598 1:238034292-238034314 TGATGGATCCTTGTGGTACCAGG - Intergenic
924256139 1:242184861-242184883 AAATGGATTCCTGAGGTGCAGGG + Intronic
924302412 1:242652607-242652629 CCATGGATCCCTGTGGTGCCAGG + Intergenic
924321493 1:242855254-242855276 CAAAGGATCCCTGTGGTGCCAGG + Intergenic
1063090007 10:2856234-2856256 CAAAGGGTCCCTGTGGTGAAGGG + Intergenic
1064908222 10:20370631-20370653 CAAAGGATCCCTGTGAGGCCAGG + Intergenic
1065471067 10:26081669-26081691 CATTGGATCCCTGTGGTGCCAGG + Intronic
1066145596 10:32554425-32554447 CAATGGATCCCTGTGTTTCCAGG + Intronic
1067151948 10:43743169-43743191 CAAGGGAGGCCTGGGGTGCCCGG - Intergenic
1067251217 10:44588443-44588465 CAAAGGATCCGGGTGGTGCTGGG + Intergenic
1067298228 10:44987937-44987959 CAATGGCTCCCAGGTGTGCCTGG + Intronic
1067421795 10:46158657-46158679 CTATGGGACCCTGTGGTTCCTGG - Intergenic
1067507101 10:46864746-46864768 CTATGGGACCCTGTGGTTCCTGG - Intergenic
1067686154 10:48466902-48466924 GAAGGGATTCCTGCGGTGCCCGG - Intronic
1068096700 10:52499881-52499903 CGTTGGATCCCTGTATTGCCAGG + Intergenic
1068397140 10:56477594-56477616 CAAAGTATCAATGTGGTGCCTGG + Intergenic
1068480696 10:57585306-57585328 CAGTGGATCCCTGTGGTGCCAGG - Intergenic
1068689116 10:59897974-59897996 CAATCCAGCCTTGTGGTGCCAGG - Intronic
1069242808 10:66163318-66163340 CAATGGATCTCTGTGGTGCCAGG + Intronic
1069325188 10:67224746-67224768 CAGTGGATCCCTGTGATGCCAGG - Intronic
1069720701 10:70547756-70547778 CCCAGGAGCCCTGTGGTGCCAGG + Intronic
1071484655 10:86091017-86091039 TGATGGATCCCTGTGGTTCCAGG - Intronic
1074893176 10:117752168-117752190 CAAAGGCCCCCTGGGGTGCCTGG + Intergenic
1075289832 10:121219438-121219460 CACTGGATGCATGTGGTTCCAGG + Intergenic
1075816302 10:125267087-125267109 CAATGGATCCCTTTGGTCTGGGG + Intergenic
1075946727 10:126439938-126439960 CAAAGGATTCCTGTGATGCTTGG - Intronic
1076114301 10:127884787-127884809 AAGTGCAGCCCTGTGGTGCCTGG - Intronic
1078288501 11:9982957-9982979 TGAGGGATCCCTGTGGTGCCAGG - Intronic
1079273757 11:19013818-19013840 GGATGGATACCTGTGGTGCCAGG + Intergenic
1080324049 11:31049884-31049906 CAATGGATCCCTGTGGTGCCAGG - Intronic
1080336353 11:31202159-31202181 CAGTGGAGACCTGTGGTGCAGGG - Intronic
1080672638 11:34395199-34395221 CGATGGATCCCCATGGTGCCAGG + Intergenic
1081036125 11:38148766-38148788 CATTGCAGCCCTGGGGTGCCAGG + Intergenic
1081195180 11:40152332-40152354 CAGTGGATCCCCGTGGTGCCAGG - Intronic
1081445955 11:43131696-43131718 CAGTGAATCCCTGTAGGGCCTGG + Intergenic
1083072773 11:60003572-60003594 TGATGGATACCTGTGGTGCCAGG - Intergenic
1084840480 11:71842572-71842594 TGATGGATGCCTGTGGTGCCAGG - Intergenic
1085747715 11:79129248-79129270 CAATGGATCCCTCTGGTGCCAGG - Intronic
1086544532 11:87952131-87952153 CGATGGATCCCTGTGGTGCCAGG - Intergenic
1086825516 11:91490308-91490330 CGATAGATTCCTGTGGTGCCAGG + Intergenic
1087619397 11:100525206-100525228 TGATGGATCCTTGTGGTGCCAGG - Intergenic
1088094987 11:106088741-106088763 CCATGGATCCCTTTGTTGTCTGG - Intronic
1088173476 11:107022554-107022576 GGATGGATTCCTGTGGTGCATGG - Intergenic
1088206334 11:107397046-107397068 TGTTGGATCCCTGTGGTGCCAGG - Intronic
1088239439 11:107758572-107758594 CAAAGAATCCTTGTGGTGCTAGG - Intergenic
1088740866 11:112765788-112765810 CAAAGGCTCTGTGTGGTGCCCGG + Intergenic
1089107298 11:116023665-116023687 CGATGGATCCCTGTGGTGCCAGG - Intergenic
1089324972 11:117650845-117650867 AAAGGGAACCCTGTGGTGCCTGG + Intronic
1089937389 11:122378090-122378112 CGAAGGGCCCCTGTGGTGCCAGG - Intergenic
1089954322 11:122556170-122556192 CAAAGGATCCCTGTGATGCCAGG + Intergenic
1090706056 11:129337928-129337950 GAATGCATCCATGTGCTGCCAGG - Intergenic
1090757236 11:129803378-129803400 CGATGGATTCCTGTGGTGTCAGG - Intergenic
1091210607 11:133854915-133854937 TGATGGATCCCTGTGGTGCCAGG + Intergenic
1093010448 12:14101550-14101572 CAAAGGATCCCTGTGATACCAGG - Intergenic
1093172249 12:15874229-15874251 CAGTGGATCCCTGTGGTGCCAGG - Intronic
1093389506 12:18601921-18601943 TGATGGATCCCTGTGGTGCCAGG - Intronic
1093409357 12:18845693-18845715 CAAAGGATCCCTGTGACACCAGG + Intergenic
1093488829 12:19681784-19681806 CAAAGGATCCCTGTGGTGCCAGG + Intronic
1093497539 12:19775479-19775501 CGAAGGAGTCCTGTGGTGCCGGG + Intergenic
1093720493 12:22436982-22437004 TGATGGATCCCTGCGGTGCCAGG - Intronic
1093994871 12:25630696-25630718 CAATGGATCCCTGTGGTGCCAGG - Intronic
1094362029 12:29640661-29640683 CATTGGATCCCTGTGGTTCCAGG - Intronic
1094447437 12:30546626-30546648 TGAAGGATCCCTGTGTTGCCAGG + Intergenic
1094501270 12:31023149-31023171 TGATGGATCCCTGTGGTACCAGG - Intergenic
1094801965 12:34047915-34047937 CAAAGGATCCCTGTGGTTCCAGG - Intergenic
1095115099 12:38343823-38343845 TGAAGGATCCCTGTGGTTCCAGG - Intergenic
1095118581 12:38385490-38385512 TGAGGGATCCCTGTGATGCCAGG + Intergenic
1095248265 12:39946966-39946988 TGATGGATCACTGTGGTGCCAGG + Intronic
1095665095 12:44788543-44788565 CAAAGGATCCCTGTGGTGCTAGG - Intronic
1095732560 12:45521660-45521682 TGATGGATCCCTGTGGTGCCAGG - Intergenic
1095892693 12:47249652-47249674 CAGTGGATCCCTGTGGTGCCAGG - Intergenic
1096888686 12:54744096-54744118 CAAAGGATCCCTGTGATGCCAGG + Intergenic
1096956771 12:55534381-55534403 CAATGGATCCCTGTGGTGCCAGG - Intergenic
1097295399 12:57957767-57957789 CAATGGATCTCTGTGGTGACAGG - Intergenic
1097386067 12:58950869-58950891 CGATGGATCCCTGTGGTGCCAGG + Intergenic
1097760452 12:63459059-63459081 CGATGGATCCCTGTGGTGCCAGG - Intergenic
1097891320 12:64780663-64780685 CTCTGGATCCCCGAGGTGCCCGG - Intergenic
1098309357 12:69132972-69132994 CAGTGGGAACCTGTGGTGCCAGG + Intergenic
1098961009 12:76739598-76739620 TGTTGGATCCCTGTGGTGCCAGG + Intergenic
1099153269 12:79142242-79142264 CGAGGGATCCCTGTGGTGCCAGG + Intronic
1099392963 12:82102828-82102850 CGATGGATCCCTGTGGTACCAGG - Intergenic
1099473119 12:83074984-83075006 TGATGGATCCCTGTGGTGTCAGG + Intronic
1099777499 12:87151779-87151801 TGATGGGTCCCTGTGGTGTCAGG + Intergenic
1100041957 12:90330632-90330654 TCATTGATCCCTGGGGTGCCTGG + Intergenic
1100088215 12:90937049-90937071 CTATGGATCCCTGCAGTGCCAGG + Intronic
1100291078 12:93215350-93215372 GGATGGATCCCTGTGGTGTCAGG + Intergenic
1101635364 12:106535884-106535906 TGACGGATCCCTGTGGTGCCAGG + Intronic
1102209870 12:111118618-111118640 CAATGGATCCAACTGGTCCCAGG + Intronic
1103761197 12:123251447-123251469 CGATGGATCCCTGTGGTGCCAGG + Intronic
1104504587 12:129319212-129319234 CCATAGATCCTTGTGGTGCCAGG + Intronic
1105908167 13:24834715-24834737 CACTGAATCCCTGTGGCACCAGG - Intronic
1105930680 13:25049032-25049054 CTATGAATTCCTGTGGTGCCAGG - Intergenic
1106325527 13:28685126-28685148 CTTTGGAACCCTGTGGTTCCTGG + Intergenic
1106938230 13:34747677-34747699 TGATAGATCCCTGTGGTGCCGGG + Intergenic
1107666315 13:42694259-42694281 CAATGGATCCCTGTGGTGCCAGG + Intergenic
1107964443 13:45586673-45586695 CACTGGCTCCCTGGGGTGACAGG - Intronic
1108469869 13:50756824-50756846 CGAAGGATCCCTGTCATGCCAGG + Intronic
1108817021 13:54304946-54304968 CATTGCATCCCTGTGGTGCCAGG - Intergenic
1108825465 13:54407824-54407846 CGAAGGATCCCTATGGTGCCAGG - Intergenic
1109048017 13:57438089-57438111 TGATGGATCCCTGTGGTGCTAGG + Intergenic
1109213659 13:59563489-59563511 CAATGGATCCCTGTGGTGCCAGG + Intergenic
1109508483 13:63337282-63337304 CAATGGATCCCTTTGTTGCCAGG + Intergenic
1110561784 13:76917646-76917668 CGCTGGATCCCTGAGGTGCCAGG - Intergenic
1110661283 13:78061404-78061426 CATTGGATCCCTGTGGTGCCAGG + Intergenic
1110852713 13:80263097-80263119 CATTGGATCCTTGTGGTGCCAGG + Intergenic
1111165850 13:84455959-84455981 CAATAGATCCCTGTGGTATCAGG + Intergenic
1112035460 13:95492776-95492798 TGATGGATCCCTGTGGTGTCAGG + Intronic
1112738001 13:102443027-102443049 CTATGGATCCCTGTGGTGCCAGG - Intergenic
1112945228 13:104919876-104919898 CAATGGATCCCTGTGGTACCAGG - Intergenic
1113270012 13:108662861-108662883 CAATGAATCCCTGTGGTGCCAGG + Intronic
1113329872 13:109317493-109317515 AGATGGATCCCTGTGGTGCCAGG - Intergenic
1113460295 13:110478008-110478030 CAAGGGATGCCTGGGATGCCAGG + Exonic
1113778199 13:112960889-112960911 CAATGGCTCTCTGTGGTACGTGG + Intronic
1114680143 14:24477453-24477475 CAATGGCTCCATGTGGTGGAGGG + Intergenic
1114692397 14:24595879-24595901 CAATGGATCCGTGTGGTCCCTGG + Intergenic
1115265066 14:31492645-31492667 AAAAGGATCCCTGTGGGGCCAGG - Intronic
1115299158 14:31865179-31865201 CGATGGATCTCTGTGGTGACAGG - Intergenic
1115680234 14:35730268-35730290 CAAAGGATCCCTGTGGTGCCAGG - Intronic
1115835571 14:37398079-37398101 CGTTGGATCCCTGTGGTGCCAGG + Intronic
1115958437 14:38808636-38808658 TGAAGGATCCCTGTGGTGTCAGG - Intergenic
1115996837 14:39203740-39203762 TGATAGATCCCTGTGGTGCCAGG - Intergenic
1116049115 14:39781622-39781644 CAGTGGATCCCCGTGGTGCCAGG + Intergenic
1116806749 14:49501327-49501349 CAAAGGATCCCTGTGGTGCCAGG - Intergenic
1117510869 14:56449242-56449264 TGATGGATCCCTGTGGTGCCTGG + Intergenic
1117639748 14:57785799-57785821 CAATGGATCCCTGTGGTACTAGG - Intronic
1121459769 14:94065880-94065902 CAGTGGATCCCTGTGGTGCCAGG - Intronic
1124380643 15:29162193-29162215 TGGTGGATCCCTGTGGTGCCAGG - Intronic
1124557042 15:30735989-30736011 CAAAGGATGCCTGCGGTGCCAGG - Intronic
1124674221 15:31669755-31669777 CAAAGGATCCCTGTGGTGCCAGG + Intronic
1125056006 15:35359481-35359503 CATTGGATCCCTGTGGTGCCAGG + Intronic
1126460885 15:48913710-48913732 CGATGGATCCCTGTGGTTCCAGG + Intronic
1126577411 15:50210519-50210541 TGATGGATCCCTGTGGTGCCAGG - Intronic
1127031061 15:54863465-54863487 TGATGCATCCCTGTGGTGCCAGG - Intergenic
1128018464 15:64369064-64369086 AAATGTATCCCTCTGGGGCCAGG + Intronic
1128238635 15:66084678-66084700 TGATGGATCCCTGTGGTGCCAGG - Intronic
1128414939 15:67436448-67436470 TGATGGATCCCTGTGGTGCCAGG - Intronic
1132210380 15:100017471-100017493 CGATGGATCCCTGTGGTGCCAGG + Intronic
1132321155 15:100926559-100926581 CAGTGGGTCCAGGTGGTGCCAGG - Intronic
1135901504 16:26464437-26464459 CATTGAATCCCTGTGGCGCCAGG - Intergenic
1138798063 16:59993635-59993657 TGATGGATTCCTGTGGTGCCAGG + Intergenic
1141435357 16:83996870-83996892 CATTAGATCCCTGAGGTGCTGGG + Intronic
1142915577 17:3133810-3133832 CGCTGGATCCCTGTGGTGATCGG + Intergenic
1143427813 17:6854014-6854036 TGATGAATCCCAGTGGTGCCAGG - Intergenic
1143538573 17:7556706-7556728 CAATGGATCCCTGGGGAGTGTGG + Intronic
1144139768 17:12337000-12337022 TGATGGATCTCTGTGGTGCCAGG + Intergenic
1144143345 17:12371561-12371583 CAATGGCTCCCTGTGCTGGCAGG + Intergenic
1144709105 17:17388680-17388702 CAATGGCTTCCTGTGCTTCCTGG + Intergenic
1146594172 17:34155337-34155359 AGATGGAGCCCTGGGGTGCCCGG + Intronic
1148203122 17:45763019-45763041 CAATGGATGCCTGTGGAGACAGG - Intergenic
1149381655 17:56100383-56100405 CTATGGATCCCTGTTGTGTTTGG + Intergenic
1150538873 17:66076087-66076109 CAAAAGGTCCCTGTGGTACCAGG - Intronic
1151048313 17:70947781-70947803 CGCTGGATCCCTGTGGTGCCAGG - Intergenic
1153069569 18:1089666-1089688 TGATGGATCCCTGTGGTGCCAGG + Intergenic
1153169051 18:2293927-2293949 CGAAGGTTCCCTATGGTGCCAGG + Intergenic
1153400393 18:4678640-4678662 CAAAGGATCCCTGTGATGCCAGG - Intergenic
1153966023 18:10182555-10182577 GGATGGATCCCTGTGGTGCCAGG + Intergenic
1154094002 18:11393473-11393495 CAATGGATCCTTGTGGTGCCAGG - Intergenic
1154124722 18:11680299-11680321 CAATGGTTACCTCTGGTGCATGG - Intergenic
1156419289 18:36933602-36933624 CAATGCAGCCCTGGGGTGCCAGG + Intronic
1158331604 18:56368476-56368498 TGTTGGATCCCTGTGGTGCCAGG + Intergenic
1158756412 18:60331463-60331485 TGATGGATCCCTGTGGTGCTAGG - Intergenic
1158838720 18:61360149-61360171 CAATGGGTTACTGTGGAGCCTGG + Intronic
1159383370 18:67691020-67691042 CGATGGATCCCTGTTGTGCCAGG + Intergenic
1160267680 18:77354155-77354177 CAATGGATCCCTGTGGTGCCAGG + Intergenic
1161881114 19:6953513-6953535 CAGGGGCTTCCTGTGGTGCCAGG + Intergenic
1164251649 19:23482687-23482709 TGATGGATCCCTGTGGTGCTAGG - Intergenic
1164288047 19:23839719-23839741 CCATGGATTCCTGTGGTGCCAGG + Intergenic
1164320245 19:24137870-24137892 TGAAGGATCCCTGTGGTGCCAGG + Intergenic
1165109495 19:33493595-33493617 CCAGGGATCTGTGTGGTGCCTGG - Intronic
1166604347 19:44127149-44127171 TGATGGATCCCTGTGATGCCAGG + Intronic
1168335333 19:55593915-55593937 CAAGGTTTCCCTGTGTTGCCTGG - Intronic
1168406651 19:56114134-56114156 AGATGGAACCCTGTGGTGCCTGG - Intronic
1168458483 19:56534220-56534242 CAGTGGATCCCTGTGGTGCCAGG + Intergenic
926204351 2:10824616-10824638 GCATGGATCCCTGTTGTCCCTGG + Intronic
926872829 2:17441627-17441649 CAGAGGATCCCTGTGGTGCCAGG + Intergenic
926916090 2:17893532-17893554 TGATGGATCCCCGTGGTGCCAGG + Intronic
927716339 2:25355801-25355823 CCATGTCTCCCTGTGGTGCTGGG - Intergenic
928733659 2:34261270-34261292 TGAAGGATCCCTGTGGTGCCAGG - Intergenic
928772614 2:34720074-34720096 CATTGGATCCCTGTGGTGCTAGG + Intergenic
929139620 2:38655572-38655594 CAGTGTATCCCTGTAGTTCCAGG - Intergenic
929528111 2:42725308-42725330 CAATTCATCTCTGTAGTGCCTGG - Intronic
929805928 2:45145074-45145096 CAAAGGATCCCTGTGATGCTGGG - Intergenic
930486587 2:52018251-52018273 CAATGGATTCCTGTGGTGCCAGG + Intergenic
931547797 2:63408464-63408486 CAATGGATCCCTATGGTATCAGG - Intronic
931790872 2:65663082-65663104 CTGTGGATCCCTGTGGTTGCTGG + Intergenic
931992931 2:67809343-67809365 GAATGGAACCGTGTGGTGCCAGG - Intergenic
932252296 2:70255004-70255026 TAGTGGATGCCTGTGGTCCCAGG + Intergenic
932270301 2:70403348-70403370 CGAAGGATCCCTGTGGTGCCAGG - Intergenic
932718108 2:74117507-74117529 CCATGCATGCCTGTGGTCCCAGG - Intergenic
932954723 2:76337755-76337777 CAAACGATCCCTGTGATGCCAGG + Intergenic
933248658 2:80003860-80003882 CAATAGATCCCTAGGATGCCAGG + Intronic
933531439 2:83517309-83517331 TGATGGATCTCTGTGGTGCCAGG - Intergenic
936558947 2:113519914-113519936 CAGTGAATCCCTGTAGGGCCTGG - Intergenic
937069341 2:119050751-119050773 TGATGGATCCCTGTGGTTCCAGG + Intergenic
937521701 2:122720517-122720539 CCAAGGATCCCTGTGGTGCCAGG - Intergenic
938038232 2:128054134-128054156 TAATGGATCCCTATGGTGCCAGG + Intergenic
938180568 2:129178710-129178732 CCATGGGGCCCTGTGGTTCCTGG - Intergenic
938598354 2:132811880-132811902 TGATGGATCCCTGTGGTGCCAGG + Intronic
939769491 2:146298415-146298437 TGATAGATCTCTGTGGTGCCAGG - Intergenic
940034793 2:149302192-149302214 TGATGGATCCCTGTGGTGCCAGG + Intergenic
940618769 2:156084241-156084263 TGATGGATCCCTATGGTGTCAGG + Intergenic
940709472 2:157144424-157144446 TGATGGATCCCTGTGGTGCCAGG + Intergenic
942578145 2:177387846-177387868 CAATGGTTACCTTTGGTGGCAGG + Intronic
943621235 2:190150325-190150347 TGATGGATCTCTGTGGTGCCAGG + Intronic
943891329 2:193290345-193290367 CGATGGATCCCTGTAGTGCCAGG + Intergenic
944432159 2:199645118-199645140 CAAAGGACCCCTGTGAGGCCAGG + Intergenic
944528968 2:200649209-200649231 CCATGGATCCCTGTGTTGTTAGG + Intronic
944801106 2:203238871-203238893 CAATGGATCGCCGAGGAGCCGGG - Intronic
944874129 2:203944252-203944274 AGATGGATCCCTGTGGTGCCTGG + Intronic
945132181 2:206584848-206584870 CGTTGGATCCCTATGGTGCTAGG + Intronic
945864450 2:215161246-215161268 CGATGGATCCTTGTGGTGTCAGG - Intergenic
947382505 2:229558932-229558954 CAATGGATTCCCATGGTGCTTGG - Intronic
947457162 2:230265550-230265572 CATTGGGTCCCTGTGGTGCCAGG + Intronic
948713769 2:239844832-239844854 CTTTGTATCTCTGTGGTGCCAGG + Intergenic
1169275788 20:4232890-4232912 CCAGGGATCCCTGTGGGGTCGGG + Intronic
1169335037 20:4748917-4748939 CAATGGAGCCCTGGAGAGCCTGG - Intergenic
1169336286 20:4759928-4759950 TGATGGATCCCTGTTATGCCAGG + Intergenic
1169401251 20:5282524-5282546 TGAAGGATCCCTGTGATGCCAGG - Intergenic
1169517553 20:6333643-6333665 CAATGGATCCCTGTTGTGCCAGG + Intergenic
1170245847 20:14220631-14220653 CATTGGATCCCTGGGGTGCCAGG + Intronic
1170375906 20:15699863-15699885 CAATGGATCCTTGTGGTGCCAGG + Intronic
1170721107 20:18879740-18879762 TGATGGATCCCTGTGGTGCCAGG + Intergenic
1170863243 20:20128293-20128315 TGATGGATCCCTGTGGTGCCAGG + Intronic
1171165517 20:22967077-22967099 CAATGGATCCCTGTGGTGCCAGG - Intergenic
1171242445 20:23582480-23582502 CAGTGGATCCCTGTGGTGTCAGG + Intergenic
1171470628 20:25368326-25368348 CCATGGAGCGCTGTGGTTCCAGG - Intronic
1175068978 20:56316075-56316097 TGATGGATCCTTGTGGTGCCAGG - Intergenic
1175714594 20:61247049-61247071 CAGTGGGTCCCTCTGGGGCCTGG + Intergenic
1175917728 20:62434723-62434745 CCATGGATGCCTGGGGTGTCAGG + Intergenic
1177195680 21:17901300-17901322 TGATGGATCTCTGTGGTCCCAGG + Intronic
1178059287 21:28834535-28834557 TGTTGGATCCCTGTGGTGACAGG - Intergenic
1178801596 21:35800951-35800973 CAAAGGATCTCTGTGGTGCCAGG - Intronic
1178958947 21:37046922-37046944 CAATGGGTCCCTGCGGTGCCAGG - Intergenic
1180138284 21:45875423-45875445 CAATGCATCCCCATGGTGCAGGG - Intronic
1180176806 21:46094602-46094624 TAATGGATCAGTGTGGTGTCCGG + Intergenic
1183048537 22:35241532-35241554 TGATGGATCCCGGTGGTGCCAGG + Intergenic
1184445593 22:44545118-44545140 CAATGGCACCCTGTCGAGCCAGG - Intergenic
949604128 3:5634803-5634825 CGATGGATCCCTGTGGTGCCAGG + Intergenic
949814163 3:8040655-8040677 CGGTGGATCCCTGTGGTGCCAGG - Intergenic
950603632 3:14058232-14058254 TGAAGGATCCCTGTGGTGCCAGG + Intronic
951562334 3:23981499-23981521 CTTTGGAGCCCTGTGGTTCCTGG - Intergenic
951948365 3:28168616-28168638 CAGAGTCTCCCTGTGGTGCCCGG + Intergenic
952097279 3:29968452-29968474 TGCTGGATCCCTGTGGTGCCAGG + Intronic
952579709 3:34818633-34818655 CACTGGATCCCTGTGCAGGCAGG + Intergenic
952764375 3:36942547-36942569 GCATGGATCCCAGTGGGGCCTGG - Intronic
953084610 3:39654410-39654432 CAATGGATCCCTGTGGTGCCAGG + Intergenic
953724038 3:45382000-45382022 TGAAGGATCCCTGTGGTGCTAGG + Intergenic
954596667 3:51830876-51830898 CAAGGGGTCCCTGTGGTGAGGGG - Intergenic
955175730 3:56611688-56611710 TGATGGATCCCTGTGGTGCCAGG + Intronic
955303881 3:57810071-57810093 CTTTGGTTCCCTGTGGTTCCTGG + Intronic
955899959 3:63742263-63742285 CAAGGGCTCCTTCTGGTGCCTGG + Intergenic
956099559 3:65753195-65753217 CAATGCATCCCTGTGGTTCTCGG - Intronic
956950188 3:74273696-74273718 CGAAGGATCCCTGTGATGCCAGG - Intronic
956989897 3:74751295-74751317 CTTTGGAGCCCTGTGGTTCCAGG - Intergenic
956995775 3:74824943-74824965 CGTTGGATTCCTGTGGTGCCAGG + Intergenic
957016484 3:75069911-75069933 CAGTGGATCCCTGTGGTGCCAGG + Intergenic
957427826 3:80063498-80063520 CGATGAATCTCTGTGGTGCCAGG - Intergenic
957971639 3:87390303-87390325 CAAAGGACCCCTGTGAAGCCAGG - Intergenic
958647196 3:96888192-96888214 CATTGAATCCCTGTGGTGCCAGG + Intronic
958970025 3:100601077-100601099 TGAAGGATCCCTGTGGTGCCAGG + Intergenic
959046905 3:101484760-101484782 CAATGGATTCCTGTGGTGCCAGG - Intronic
959279700 3:104323012-104323034 TGATGGCTCTCTGTGGTGCCAGG - Intergenic
959436074 3:106316930-106316952 TGATGGATTCCTGTGGTGCCAGG - Intergenic
959757047 3:109911269-109911291 CATTGGATCCCTGTGGTGCCAGG + Intergenic
959802592 3:110512766-110512788 CGAAGGATCCCTGTGATGTCAGG + Intergenic
959997182 3:112693008-112693030 AAAAGGATCCCTGTGATGCCAGG - Intergenic
960016083 3:112889565-112889587 CAGTGGATCCCTGTGGTGCTAGG + Intergenic
960187260 3:114659179-114659201 AAATGGAGCCCTGTGGCTCCTGG + Intronic
960524690 3:118695879-118695901 TGATGGATCCCTGTGGTGCCAGG - Intergenic
960621805 3:119644383-119644405 GAATGGATCCCTGTGGAGAGTGG + Intronic
960984224 3:123263013-123263035 TGAGGGATCCCTGTGGTGACAGG - Intronic
961204024 3:125066557-125066579 CAATCGATGGCTGTGGGGCCCGG + Intergenic
961846837 3:129772223-129772245 TAGTGGATGCCTGTGGTCCCAGG + Intronic
961977483 3:131042222-131042244 CCCTGTATCCCAGTGGTGCCTGG + Intronic
962066081 3:131981693-131981715 CGTTGGATCACTGTGGTGCCAGG + Intronic
962401933 3:135067792-135067814 TGAGGGATCCCTGTGGTGCCAGG + Intronic
963454168 3:145522534-145522556 CTTTGGAGCCCTGTGGTTCCTGG - Intergenic
964160561 3:153640620-153640642 GGATTGATCCCTGGGGTGCCAGG - Intergenic
964777632 3:160295412-160295434 CAATGGCTCACTATGTTGCCCGG - Intronic
964917568 3:161854933-161854955 TGATGGATCCCTGTGGTTCCAGG + Intergenic
965052777 3:163671716-163671738 TGATGTATCCTTGTGGTGCCAGG + Intergenic
965216967 3:165875303-165875325 TGATGGATCCCTGTGGTGCCAGG + Intergenic
965519303 3:169657578-169657600 CAATGGGTCCCTCTGGAGACTGG - Intronic
966117764 3:176485582-176485604 TGATGGATCCCTGTGGTGCCAGG + Intergenic
966686720 3:182703582-182703604 CAAAGGATCCCTGTGAGGCCAGG + Intergenic
967208997 3:187150167-187150189 CTATGGTTCCCTGTGGTGCCAGG - Intronic
967257604 3:187609440-187609462 CAAAGGATCTCTGTGGTGCCAGG + Intergenic
969624019 4:8293441-8293463 CCAGGGATCCCTCTGGGGCCTGG - Intronic
969781560 4:9408566-9408588 TGATGGATGCCTGTGGTGCCAGG - Intergenic
970346665 4:15159204-15159226 TGATGGATCCCTGTGGTGTCAGG + Intergenic
970549390 4:17164013-17164035 CAAAGGATTCCTGTGAAGCCAGG + Intergenic
970614050 4:17751373-17751395 CAATGTTTCCATGTGTTGCCTGG + Intronic
970658711 4:18260647-18260669 CAAGAGATCCCTGTGGTGTCAGG + Intergenic
970996003 4:22268505-22268527 GAAAGGATCCCTGTGGTGCCAGG - Intergenic
971183215 4:24349911-24349933 CGATGGATCCCTGTGGTGCCAGG + Intergenic
971404640 4:26311239-26311261 AAATGCATCACTGTGGGGCCAGG + Intronic
971901080 4:32658620-32658642 TGATGGATCCCTGTGGTGCCAGG + Intergenic
972189148 4:36569049-36569071 CAAAGGATCTCTTTGATGCCAGG + Intergenic
973179681 4:47252126-47252148 AGATGGATCCCTGTGGTGCCAGG + Intronic
973782315 4:54300314-54300336 CTATGGATCCCTGTGGTGCCAGG - Intergenic
973786690 4:54339100-54339122 CAATGTCTCCCTCTGTTGCCTGG - Intergenic
974949328 4:68569496-68569518 TAAAGGATCACTGTGGTGCCAGG - Intronic
974958364 4:68671690-68671712 TGATAGATCCCTGTGATGCCAGG - Intergenic
975033728 4:69656756-69656778 CAGTGGATCCCTGTGGTGCCAGG - Intergenic
975517181 4:75259870-75259892 TGATGGATCCCTGTGGTGTCAGG - Intergenic
976856394 4:89609806-89609828 CAATGGATCCCTGTGGTGCCAGG - Intergenic
977020086 4:91747352-91747374 CAATGGATCCCTGTGGTGCCAGG + Intergenic
977733138 4:100379527-100379549 TGATGGATCCCTGTGGTGCCAGG - Intergenic
977746707 4:100558273-100558295 CGATGGATCCCTGTGGTGCCAGG - Intronic
977904604 4:102461055-102461077 TGATGGATGCCTGTGGTGCCAGG + Intergenic
978670610 4:111244009-111244031 CTTTGGATCCCTGTGGTGCCAGG - Intergenic
978726779 4:111978076-111978098 CGATGGAGCCCTGTGGTGTCAGG + Intergenic
979704765 4:123708887-123708909 TGATGGATCCCTGTGGTGCCAGG - Intergenic
979995388 4:127425749-127425771 TGGTGGATCCCTGTGGTGCCAGG - Intergenic
980523454 4:133960451-133960473 CTAAGGATCCTTGTGATGCCAGG - Intergenic
981346551 4:143683553-143683575 CGTTGGATCCCTGTGATGCCAGG - Intronic
981401051 4:144314008-144314030 GGATGGATCCTTGTGGTGCCAGG + Intergenic
981461024 4:145013965-145013987 TGAAGGATCCCTGTGATGCCAGG - Intronic
981760881 4:148193088-148193110 CGATGGATCCCTGTGGTGTCAGG + Intronic
981834834 4:149042727-149042749 CACTGGATCCATTTGGTCCCTGG + Intergenic
982190017 4:152844026-152844048 TGATGGATCCCTGTGGTACCAGG + Intronic
982218858 4:153107528-153107550 CAAAGGATCCCTGTGGTGCCAGG + Intergenic
982630462 4:157823904-157823926 GGAAGGATCCCTATGGTGCCAGG - Intergenic
982680237 4:158419489-158419511 TATTGGATCCCTGTGGTGCCAGG + Intronic
984266787 4:177505852-177505874 CGATGGTTCCCTGTGGTGCCAGG + Intergenic
984527637 4:180875856-180875878 CATTGGATTCCTGGGGTGCCAGG + Intergenic
984721539 4:182977656-182977678 CGAAGGATCCCTGTGGCGCCAGG - Intergenic
987221672 5:15796735-15796757 CAATGGATCCCGGTGAGCCCTGG - Intronic
988344523 5:30020663-30020685 CATTGGATCCCTGTGGTGCCAGG - Intergenic
988623734 5:32849265-32849287 CAATGGCTCCCAGTGATGCAGGG + Intergenic
988723641 5:33903764-33903786 CAAAGGACCCCTGTGAGGCCAGG + Intergenic
990316606 5:54588906-54588928 CCATGGTATCCTGTGGTGCCTGG + Intergenic
990712909 5:58604921-58604943 AGATGGATCCCTGTGGTGCCAGG + Intronic
990776300 5:59309368-59309390 GGATGGATCCCTGTGATGCCAGG + Intronic
991117332 5:62969801-62969823 CGAAGAGTCCCTGTGGTGCCAGG - Intergenic
991386860 5:66100722-66100744 TGATGGATCCTTGCGGTGCCAGG - Intergenic
991923790 5:71683959-71683981 CAAGGGATCCCTGTGATGCCAGG - Intergenic
993883961 5:93395191-93395213 CAATGGATCCCTGTGGTGCTGGG + Intergenic
993916968 5:93755761-93755783 AGTTGGATCCCTGTGATGCCAGG - Intronic
993964692 5:94346702-94346724 CGTTGGATCCCTGTGGTGCCAGG - Intronic
994222262 5:97209123-97209145 CAAAGGACCCCTGTGAGGCCAGG + Intergenic
994568463 5:101483362-101483384 CGAAGGATCCCTATGGTGCCAGG + Intergenic
994875225 5:105413534-105413556 TGATGGATCCCTGTTGTGCCAGG - Intergenic
994883659 5:105529696-105529718 CAAAGGGTACCTGTGATGCCAGG + Intergenic
995317981 5:110797761-110797783 GGAAGGATCCCTGTGGTGCCAGG + Intergenic
996010667 5:118478727-118478749 CAATGGATACCTGTGGTGCCAGG - Intergenic
996289023 5:121829458-121829480 AGAAGGATCCCTGTGTTGCCAGG + Intergenic
996325345 5:122267095-122267117 TGTTGGATCCCTGTGGTGCCAGG - Intergenic
996504876 5:124257632-124257654 CAATGGATCCCTGTGGTGCCAGG + Intergenic
997743146 5:136275479-136275501 CACTGGATCCCAGTGGTGTTGGG + Intronic
998464778 5:142334760-142334782 CAGTGGAACCCTGTTGTTCCTGG + Intergenic
998940760 5:147280142-147280164 CATTGGATCCCTGTGGTGCCAGG - Intronic
999357067 5:150945695-150945717 CAACAGTTCCCTGTGGTGACAGG + Intergenic
999484960 5:151985800-151985822 CAAAGGATTCCTGTGGTGTCAGG + Intergenic
999818420 5:155200557-155200579 CAATGGATCCCTGTGGTGCTGGG - Intergenic
1000757999 5:165184583-165184605 CAATGGATCCCTGTGGTCCCAGG + Intergenic
1000779571 5:165464582-165464604 AGAAGGATCCCTGTGGTGCCAGG - Intergenic
1002813758 6:659740-659762 AGATGGATCCCTGTGGTGCCAGG - Intronic
1003029518 6:2589693-2589715 TGCTGGATCCCTGTGGTGCCAGG + Intergenic
1003450795 6:6229975-6229997 TGATGGATCTCTGTGGTGCCAGG - Intronic
1003581851 6:7347474-7347496 CTTTGGATCCCTGTGGGGCCAGG - Intronic
1003712006 6:8602810-8602832 CATTGGATGCCTGTGGTTCCAGG + Intergenic
1005072411 6:21874205-21874227 CAATGGATCTCTGTGATGCCAGG - Intergenic
1005191510 6:23228929-23228951 TGATGGATCCCTGTGGTGCCAGG + Intergenic
1008121542 6:47622448-47622470 CTATGGATCCCTGTGGTGCCAGG + Intronic
1008305242 6:49891977-49891999 CGAGGGATCTCTGTGGTGCCAGG - Intergenic
1009384210 6:63069088-63069110 CAATGGATCCCTGTGGTGCCAGG + Intergenic
1009453085 6:63824787-63824809 TGATGGATCCCTGTGGTGCCAGG - Intronic
1009968693 6:70604225-70604247 CGATGGATCCCTGTGGTGCCAGG - Intergenic
1010123607 6:72408162-72408184 CTTTGGTTCCCTTTGGTGCCTGG + Intergenic
1011168547 6:84479043-84479065 GGATGGATCCCTGTGATGCCAGG - Intergenic
1011233247 6:85187507-85187529 CAGTAGATCCATGTGGTACCAGG - Intergenic
1011329147 6:86184295-86184317 CAATGGGACCCCATGGTGCCAGG + Intergenic
1011893393 6:92194509-92194531 AGTTGGATCCCTGTGGTGCCAGG + Intergenic
1012155883 6:95819515-95819537 GGATGGATCCTTGTGGTGCCAGG - Intergenic
1012793659 6:103733925-103733947 TGATGGATCCCTGTGGTGCCAGG - Intergenic
1012922600 6:105235019-105235041 CGATGGATCCCTGTGGTGCCAGG - Intergenic
1013592503 6:111631291-111631313 GCATGGTTCCCTGTGGTGACAGG + Intergenic
1013852717 6:114535040-114535062 CATTGGATCCCTGTGGTGCCAGG + Intergenic
1013877789 6:114855500-114855522 CAAAGGATCCCTGTGGTGCCTGG - Intergenic
1013901076 6:115156614-115156636 CAATGGATCCCTGTGGTGCCAGG + Intergenic
1014304901 6:119727927-119727949 TGAAGGATCCCTGTGGTGCCAGG + Intergenic
1014336757 6:120147090-120147112 GGTTGGATCCCTGTGGTGCCAGG - Intergenic
1014603812 6:123448119-123448141 TGATGAATCCCTGTGGTGCCAGG - Intronic
1014738688 6:125123986-125124008 TGATGGGTCCCTGTGGTGCCAGG - Intronic
1015388950 6:132659470-132659492 TAATGCATCGCTGTGGTTCCTGG - Intergenic
1015501372 6:133937047-133937069 TGATGGATCCCTGTGGTGCCAGG + Intergenic
1017054594 6:150425580-150425602 CTCTGGAACCCTGTGGTTCCTGG + Intergenic
1017065354 6:150523889-150523911 AAAGGGAGCACTGTGGTGCCAGG - Intergenic
1017600777 6:156078572-156078594 AAAAGGATACCTGGGGTGCCTGG + Intergenic
1017804682 6:157933780-157933802 CCATGGATGCCTGTGGAGCCGGG - Intronic
1018115030 6:160574509-160574531 TGATGGATCTCTGTGGTGCCAGG + Intronic
1022500821 7:30881482-30881504 GAATGGAGCCCTGGGGAGCCAGG - Intronic
1022777787 7:33545315-33545337 CAATGGATCCCTGTGGTGCCAGG + Intronic
1023159050 7:37279714-37279736 CGTTGGATCCCTGTGGTGCCAGG - Intronic
1023701175 7:42893152-42893174 CGATGGATCGCTGTGGTGCCAGG - Intergenic
1023866126 7:44239263-44239285 CAGTGGCTCCCTGTGGGCCCAGG + Intronic
1024133028 7:46375854-46375876 AAGTGGCTCACTGTGGTGCCTGG + Intergenic
1024669367 7:51577933-51577955 CAAAGGGTCCCTGTGGTGCCAGG + Intergenic
1024745449 7:52400393-52400415 CAATGGATCCCTGTGGTGCTAGG + Intergenic
1027295296 7:76763775-76763797 TGATGGATCCCTATGGTGCCAGG - Intergenic
1027350537 7:77306797-77306819 TGATGGATCCCTGTGGTGCCAGG + Intronic
1028993659 7:97076417-97076439 CAATGGATCCCTGTGGTGCCAGG + Intergenic
1029884276 7:103850479-103850501 CGATGGATCCCTGTGGTGCCAGG - Intronic
1030267550 7:107635881-107635903 CAATGTCTCACTGTGTTGCCAGG + Intergenic
1030325126 7:108211268-108211290 TGAAGGATCTCTGTGGTGCCAGG - Intronic
1030935904 7:115584931-115584953 GAATGGATCCCTGGGATGCCAGG - Intergenic
1031761330 7:125716422-125716444 TGATGGATACCTGTGGTGCCAGG + Intergenic
1031879144 7:127176885-127176907 CAATGGATCCCTGTGGTGCCAGG - Intronic
1032588152 7:133166966-133166988 AGATGGATTCCTGTTGTGCCAGG - Intergenic
1032665874 7:134035813-134035835 CAATGTGTCTCTGTGATGCCTGG - Intronic
1035058335 7:156051501-156051523 CCAGGGAGCCCTGTGTTGCCTGG + Intergenic
1035833800 8:2727347-2727369 CGTTGGATCCCTGTGGTGCCAGG - Intergenic
1036859655 8:12336412-12336434 CGATGGATGTCTGCGGTGCCAGG + Intergenic
1037737869 8:21581471-21581493 CATTGGATTCCTGTGGAGCTGGG - Intergenic
1038367296 8:26948855-26948877 CTGTGGATTCCTGTGGTGCCAGG + Intergenic
1038516752 8:28193935-28193957 CAGTGGCTTCCTGTGATGCCAGG - Intergenic
1039083372 8:33755781-33755803 CCAAGGATCCCTGTGGTGCCAGG + Intergenic
1039123490 8:34175222-34175244 TGATAGATCCCTGTGGTGCCAGG - Intergenic
1039268425 8:35854271-35854293 CGATGGATCCCTGTGGTGCCAGG - Intergenic
1039641415 8:39227396-39227418 AGATAGATCCCTGTGGTGCCAGG - Intronic
1039823976 8:41157443-41157465 CAATGGTTCCCGGTGTTGGCAGG - Intergenic
1040711616 8:50195550-50195572 CAATGGATCCCTGTTATGCCAGG + Intronic
1041205412 8:55494286-55494308 CTTTGGAGCCCTGTGGTTCCTGG - Intronic
1041227683 8:55716733-55716755 CATTGGATCCCTGTGGTGCCAGG - Intronic
1041364099 8:57083193-57083215 TGTTGGATCCCTGAGGTGCCAGG - Intergenic
1041878065 8:62712836-62712858 TGACAGATCCCTGTGGTGCCAGG + Intronic
1042122955 8:65507827-65507849 TGTTGGATCCCTGTGGTGCCAGG + Intergenic
1042304211 8:67314378-67314400 TGATGGATCCCTGTGATGCCAGG + Intronic
1042467223 8:69141255-69141277 TGTTGGATCCCTATGGTGCCAGG + Intergenic
1042777979 8:72455925-72455947 CTATGAATCCATGTGGTGCAGGG + Intergenic
1042873738 8:73421407-73421429 CGATGGAGCCCGGGGGTGCCTGG + Exonic
1043816964 8:84813022-84813044 TGATGGATCCCTGTGGTGCCAGG + Intronic
1044227467 8:89736040-89736062 TGATGGATCCTTGTGGTGCCAGG - Intergenic
1044961870 8:97539100-97539122 CACTGGGTGCCTGTGGTGCTAGG - Intergenic
1045779749 8:105849359-105849381 CAATGGATCCCTGTGGTGCCAGG - Intergenic
1046152589 8:110247152-110247174 CAATGAAACCCTGTGGTTTCAGG + Intergenic
1046498378 8:115043317-115043339 TTATGGATCCCTGTGGTGCCAGG - Intergenic
1047824403 8:128557897-128557919 CATTGGATCACTGTGGATCCAGG + Intergenic
1049514172 8:143044663-143044685 CAGTGAGTCCCTGGGGTGCCAGG - Exonic
1049893904 9:96267-96289 CAGTGAATCCCTGTAGGGCCTGG + Intergenic
1050502597 9:6314836-6314858 CAATGGATCCCTGTGGTGCCAGG - Intergenic
1050859375 9:10406858-10406880 CACAGGATCCCTGTGGTGAGTGG + Intronic
1051231154 9:14957069-14957091 TTATGGATCACTCTGGTGCCTGG - Intergenic
1051347102 9:16162126-16162148 CAATGGCTTCATGTGGTGTCTGG - Intergenic
1051362595 9:16294476-16294498 CGGTGGATTCCTGTGGTGCCAGG - Intergenic
1051966173 9:22832418-22832440 AATTGGATCCCTGAGGTGGCAGG + Intergenic
1052166155 9:25331217-25331239 TAATAGAGCACTGTGGTGCCTGG + Intergenic
1052246785 9:26346533-26346555 CATTGGATCTTTGTGGTGTCAGG + Intergenic
1052537058 9:29761170-29761192 TGATGGATCCCTGTGGTGCCAGG - Intergenic
1052731552 9:32291671-32291693 CAATGGATTCCTGTGGTGCCAGG + Intergenic
1052908615 9:33859995-33860017 CAAGGTCTCCCTGTGTTGCCCGG + Intronic
1053735132 9:41096351-41096373 CAGTGAATCCCTGTAGGGCCTGG + Intergenic
1054693250 9:68335046-68335068 CAGTGAATCCCTGTAGGGCCTGG - Intronic
1055347065 9:75350446-75350468 CGATGGATCCCTGTGGTGCCAGG + Intergenic
1055973618 9:81934767-81934789 CACAGGATCCCTGTGGGGCATGG - Intergenic
1056322819 9:85452487-85452509 CAATGGATCCCTGTGGTGCCAGG + Intergenic
1057119588 9:92559230-92559252 CGATGGATCCCTGTGGTGTCAGG + Intronic
1058085124 9:100740179-100740201 TGATGGATCCCTGTGGTGCCAGG + Intergenic
1058308490 9:103471790-103471812 TGATGGATTCCTGTGGTTCCAGG + Intergenic
1058410323 9:104724590-104724612 TGATGGATCCCTGTGGTGCCAGG - Intergenic
1058623282 9:106906003-106906025 CAATGGATCCCTGTGATGCCAGG + Intronic
1062342175 9:136098642-136098664 CACTGGCTCAGTGTGGTGCCTGG + Intergenic
1062730919 9:138108144-138108166 CAGGGGCTCCCTGTGTTGCCCGG - Intronic
1186028504 X:5340873-5340895 CAATGTATCAAAGTGGTGCCAGG + Intergenic
1187023880 X:15412609-15412631 CAATGGCTCCCTGTTCTCCCAGG + Intronic
1187219293 X:17308182-17308204 CAATGGATCCCTATGGTACCAGG + Intergenic
1187430736 X:19221988-19222010 CAATGGATTCCTGTGGTACCAGG + Intergenic
1187681336 X:21770600-21770622 CATTGGATTCCTGTGGTGCCAGG - Intergenic
1187748301 X:22433223-22433245 CAATGGATCCCTGTGGTGCCAGG - Intergenic
1187773700 X:22730946-22730968 TGATGGATCCCTGTGGTTCCAGG + Intergenic
1188045995 X:25426553-25426575 GGATGGGTCCCTGTGGTGCCAGG + Intergenic
1189218080 X:39344606-39344628 CAATGGATCCCTGTGGGGCCAGG - Intergenic
1189268706 X:39735662-39735684 CCATGGACCCCTGTGAGGCCTGG + Intergenic
1189603098 X:42648358-42648380 TGATGGATCTCTGTGGTACCAGG - Intergenic
1189962070 X:46333479-46333501 CGATGGATCCTTGTGGTGCCAGG - Intergenic
1190448842 X:50557635-50557657 GGATGGATCCCTGTGGTGCCAGG - Intergenic
1190861815 X:54352481-54352503 CAAGGTCTCCCTGTGTTGCCTGG - Intronic
1190895561 X:54614528-54614550 CGCTGGATCCCTGTGGTGCCAGG + Intergenic
1191067695 X:56367583-56367605 CGATGGATCTCTGTGGTGCCAGG + Intergenic
1191080560 X:56505652-56505674 CAATGGATCCCTGTAATGCCAGG - Intergenic
1191151895 X:57228251-57228273 TGATGGATCCCTGTGGTGCCAGG + Intergenic
1191779958 X:64854394-64854416 TGATGGATCCCTGTGGTGCCAGG + Intergenic
1191903661 X:66064797-66064819 CGATGGATCCCTGTGGTCCCAGG + Intergenic
1191965324 X:66751242-66751264 CATTGGATCCCTGTGTTGCCAGG + Intergenic
1192914597 X:75638698-75638720 TAATGGATCCTTGTGGTACCAGG + Intergenic
1192968255 X:76202784-76202806 CAAAGGATTCCTGTGATGCCAGG + Intergenic
1192970340 X:76221778-76221800 TGATGGATCTCTGTGGTGCCAGG + Intergenic
1192979130 X:76319559-76319581 TGATGGATCCCTATGGTGCCAGG + Intergenic
1192995228 X:76505895-76505917 CAGTGGATCCCTCTGGTACTAGG + Intergenic
1193062678 X:77223072-77223094 CGATGGATCCTTGTGGTGCCAGG - Intergenic
1193076934 X:77364569-77364591 CAATGGATGTCTGTAGTTCCAGG - Intergenic
1193101763 X:77622507-77622529 TGATGGATCCCTGTGTTGCCAGG - Intronic
1193154508 X:78158452-78158474 TGATGGATCCCTGTGGTGTCAGG - Intergenic
1193156769 X:78182879-78182901 CCATGGATCCCTGCGGTGCCAGG - Intergenic
1193253474 X:79319919-79319941 TGATGGATCCCTGTGGTGTCAGG + Intergenic
1193420722 X:81279714-81279736 CGATGGATCCCTATGGTGCCAGG - Intronic
1193779729 X:85686668-85686690 CAACGGATCCCTGTGGTGCCAGG + Intergenic
1193826388 X:86231847-86231869 TGATGGATCCCTGTGGTGCCAGG + Intronic
1193937541 X:87641422-87641444 AAATGTATCCCTGTGGTACCAGG - Intronic
1194466277 X:94238122-94238144 TGAAGGATCCCTGTGATGCCAGG + Intergenic
1194605612 X:95974822-95974844 CGATAGATCCCTGTGGTGCTAGG - Intergenic
1194701575 X:97120151-97120173 GGAAGGATCCCTATGGTGCCAGG + Intronic
1195019551 X:100812863-100812885 CGATGGATCCCTGTGGTGCCAGG + Intergenic
1195795368 X:108641771-108641793 CGATGGATCCCTGTGGTGCCAGG - Intronic
1196170824 X:112587165-112587187 TGAAGGATCCCTGTGGTGCCAGG - Intergenic
1196218823 X:113087944-113087966 AGATGGATCCCTGTGGTGCCAGG - Intergenic
1196464748 X:115960444-115960466 CGATGGATCCCTGTGGTGCCAGG - Intergenic
1196675837 X:118419288-118419310 CGAAGGATCCCTGTGGTGCCAGG + Intronic
1197132314 X:123019698-123019720 TGATGGATCCCTGTGGTGCCAGG - Intergenic
1197476384 X:126930047-126930069 CAAAGGATCCCTGAGAGGCCAGG + Intergenic
1197518837 X:127472707-127472729 AGAAGGATCCCTGTGGTGCCAGG - Intergenic
1197671738 X:129284834-129284856 TGTTGGGTCCCTGTGGTGCCAGG + Intergenic
1198236245 X:134738258-134738280 CACTGGAGCTCTGGGGTGCCTGG + Intronic
1198843153 X:140880594-140880616 GGATGGATCCCTGTGGTGCCAGG - Intergenic
1199057949 X:143319533-143319555 GGATGGATCCCTGTGGTGCCAGG + Intergenic
1199521593 X:148741750-148741772 CAATGGATCCCTGTGGTGTCAGG + Intronic
1199668433 X:150120817-150120839 CAATGAATCCCTGTGGTGCCAGG - Intergenic
1201315733 Y:12643750-12643772 TGAAGGATCCCTGTGATGCCAGG - Intergenic
1201611843 Y:15851819-15851841 TAATGTATCCCAGTGGTGCCTGG + Intergenic
1202043642 Y:20714199-20714221 GGATGGATCCCTGTGGTGCCAGG - Intergenic