ID: 1109213660

View in Genome Browser
Species Human (GRCh38)
Location 13:59563493-59563515
Sequence GGATCCCTGTGGTGCCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1272
Summary {0: 130, 1: 140, 2: 109, 3: 79, 4: 814}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109213650_1109213660 5 Left 1109213650 13:59563465-59563487 CCCTCACTCCTCTGGTCACCCTC No data
Right 1109213660 13:59563493-59563515 GGATCCCTGTGGTGCCAGGCAGG 0: 130
1: 140
2: 109
3: 79
4: 814
1109213651_1109213660 4 Left 1109213651 13:59563466-59563488 CCTCACTCCTCTGGTCACCCTCC No data
Right 1109213660 13:59563493-59563515 GGATCCCTGTGGTGCCAGGCAGG 0: 130
1: 140
2: 109
3: 79
4: 814
1109213653_1109213660 -3 Left 1109213653 13:59563473-59563495 CCTCTGGTCACCCTCCCAATGGA 0: 5
1: 30
2: 62
3: 100
4: 252
Right 1109213660 13:59563493-59563515 GGATCCCTGTGGTGCCAGGCAGG 0: 130
1: 140
2: 109
3: 79
4: 814
1109213647_1109213660 26 Left 1109213647 13:59563444-59563466 CCTTCTCCTTTGGATTTTTATCC No data
Right 1109213660 13:59563493-59563515 GGATCCCTGTGGTGCCAGGCAGG 0: 130
1: 140
2: 109
3: 79
4: 814
1109213648_1109213660 20 Left 1109213648 13:59563450-59563472 CCTTTGGATTTTTATCCCTCACT No data
Right 1109213660 13:59563493-59563515 GGATCCCTGTGGTGCCAGGCAGG 0: 130
1: 140
2: 109
3: 79
4: 814

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109213660 Original CRISPR GGATCCCTGTGGTGCCAGGC AGG Intergenic
900225493 1:1531419-1531441 GTCTCACTGTGTTGCCAGGCTGG - Intronic
900313902 1:2047821-2047843 GGAGATCTGTGCTGCCAGGCGGG - Intergenic
900368485 1:2321094-2321116 GGAAGCCTGTGGGGTCAGGCGGG - Intergenic
900709306 1:4102705-4102727 TCATCCCTGGGGTGCAAGGCTGG + Intergenic
900729614 1:4246709-4246731 TCATCCCTGGGGTGCAAGGCTGG - Intergenic
901103331 1:6736312-6736334 GGCTCACTCTGTTGCCAGGCTGG + Intergenic
901851002 1:12015421-12015443 GCCTCCCTCTGTTGCCAGGCTGG - Intergenic
902135518 1:14301497-14301519 AGATCCCTGTAGTGGCAGGCTGG - Intergenic
902254377 1:15178148-15178170 GGAGACCTGTGTGGCCAGGCTGG + Intronic
902427919 1:16339340-16339362 GTCTCACTGTGTTGCCAGGCTGG + Intronic
902569472 1:17337883-17337905 GTCTCCCTCTGCTGCCAGGCTGG - Intronic
903827017 1:26153716-26153738 GTCTCCCTGTGTTGCCAGGCTGG + Intergenic
903954649 1:27016871-27016893 GCCTCACTGTGTTGCCAGGCTGG + Intergenic
904060687 1:27707868-27707890 GTATCACTCTGTTGCCAGGCTGG + Intergenic
904134120 1:28297836-28297858 GATTCTCTGTGTTGCCAGGCTGG - Intergenic
904492526 1:30869897-30869919 GGGTCACTGTGGTGCCAGGCAGG + Intronic
904546126 1:31274264-31274286 GTCTCCCTCTGTTGCCAGGCTGG + Intronic
904644783 1:31957584-31957606 GTCTCCCTATGTTGCCAGGCTGG + Intergenic
904771789 1:32885018-32885040 GGAGCCCTGGGGTGCCAGGAGGG + Intergenic
905056483 1:35098709-35098731 GTTTCACTGTGTTGCCAGGCTGG - Intronic
905437933 1:37971673-37971695 TCATCCCTGTGATGCAAGGCTGG + Intronic
906031398 1:42723099-42723121 AGATGCCTGTAGTCCCAGGCGGG + Intergenic
906054043 1:42900387-42900409 CGAGCCCTGTGATGCCAGGCAGG + Intergenic
906469963 1:46120541-46120563 GGCTCCCTCTGTCGCCAGGCTGG - Intronic
906877242 1:49552415-49552437 GAGTCCCTGTGGTGCCAGACAGG + Intronic
907223527 1:52924612-52924634 GTCTCCCTATGTTGCCAGGCTGG + Intronic
907349057 1:53811150-53811172 GGATCCCTGTGGTGCCAGGCAGG - Intronic
907786661 1:57619595-57619617 GTCTCCCTGTGTTGCCAGGCTGG + Intronic
907956369 1:59231903-59231925 GTCTCCCTGTGTTGCCAGGCAGG - Intergenic
908585247 1:65560876-65560898 TCATCCCTGTGATGCAAGGCTGG - Intronic
908974817 1:69884940-69884962 TCATCCCTGTGATGCAAGGCTGG - Intronic
910598594 1:89005964-89005986 AGATCCCTGTGGTGCCAGGCAGG + Intergenic
910739088 1:90495142-90495164 GGATCCCTGTGGTGCTAGGCAGG + Intergenic
911287174 1:96009995-96010017 GGCTCCCTGAGGTGACAGGATGG + Intergenic
911607148 1:99919833-99919855 GAATCCAAGTGGTGCCAGGAGGG - Intronic
911678977 1:100692156-100692178 GAATCCGTGTGGTACCAGGCAGG + Intergenic
912314634 1:108656671-108656693 GTCTCACTATGGTGCCAGGCTGG + Intronic
912616240 1:111102529-111102551 GGATTCCTGTGGTGCCAGGTAGG + Intergenic
912619219 1:111138752-111138774 GTATCGCTCTGTTGCCAGGCTGG - Intronic
912881042 1:113414202-113414224 TCATCCCTGTGATGCAAGGCTGG - Intronic
912912244 1:113773971-113773993 GTCTCACTGTGTTGCCAGGCTGG - Intronic
913151317 1:116046912-116046934 GGATCCCTGTGGTGCCAGGCAGG - Intronic
913451094 1:118993169-118993191 GGAGCCTTGTGTGGCCAGGCCGG + Intergenic
913933646 1:125011391-125011413 TCATCCCTGGGATGCCAGGCTGG + Intergenic
914345984 1:146799012-146799034 AGATCCCTGTGATGCCAGACAGG - Intergenic
914927077 1:151897967-151897989 GAATCCCTGTGGTGCCAGGCAGG - Intronic
915077001 1:153316582-153316604 TCATCCCTGGGATGCCAGGCTGG - Intergenic
915477619 1:156162229-156162251 GTCTCACTGTGTTGCCAGGCTGG - Intronic
916151263 1:161793934-161793956 GTCTCGCTGTGTTGCCAGGCTGG + Intronic
916231798 1:162548005-162548027 GAATCTCTCTGTTGCCAGGCTGG - Intergenic
916263651 1:162868750-162868772 GGATCCCCATGGTGCCAGGCAGG - Exonic
916579835 1:166097244-166097266 GGATCCCTATGGTGCCAGGCAGG - Intronic
916826928 1:168451223-168451245 TGGCCCCTGTGGTGGCAGGCTGG - Intergenic
917057970 1:171004361-171004383 GGATCCCTGTGGTGCCAAGCAGG + Intronic
917318900 1:173758751-173758773 GGATCCCTGTGGTGCCAGGCAGG - Intronic
917461502 1:175234469-175234491 GGATCCCTGTAGTGTCAGGCAGG - Intergenic
917770130 1:178268436-178268458 GGCTCGCTCTGTTGCCAGGCTGG - Intronic
917843307 1:179000381-179000403 GTCTCCCTCTGCTGCCAGGCTGG + Intergenic
917898581 1:179517561-179517583 GGATCCCTGTGGTGCCAGGCAGG + Intronic
918122720 1:181553826-181553848 TTATCCCTGGGATGCCAGGCTGG - Intronic
918158269 1:181872291-181872313 GGATCCTTGTGGTGCCAGGAAGG - Intergenic
918554298 1:185780672-185780694 TCATCCCTGTGATGCAAGGCTGG - Intronic
918586949 1:186199335-186199357 GTCTCACTGTGTTGCCAGGCTGG + Intergenic
918638699 1:186811880-186811902 GGATCTCTGAGGTCCCAGGGTGG + Intergenic
919827342 1:201512659-201512681 GCATGCCTGTAGTCCCAGGCTGG - Intergenic
920120681 1:203654692-203654714 GTCCCCCTGTGTTGCCAGGCTGG - Intronic
921409893 1:214823985-214824007 GGATCTCTGTGGTACCAGGCAGG + Intergenic
922086409 1:222352360-222352382 TCATCCCTGGGATGCCAGGCTGG - Intergenic
922486628 1:225978020-225978042 GTCTCACTGTGTTGCCAGGCTGG - Intergenic
922657821 1:227401524-227401546 AGATCCCTGTGGTGCCAGGCAGG - Intergenic
922673489 1:227532848-227532870 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
922745642 1:228042006-228042028 GTCTCCCTCTGTTGCCAGGCTGG + Intronic
922805911 1:228389278-228389300 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
923003748 1:230028722-230028744 GTCTCACTGTGTTGCCAGGCTGG + Intergenic
923648130 1:235845364-235845386 GGATCCTTGTGGTGCCAGGCAGG - Intronic
923777709 1:236995030-236995052 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
923808744 1:237288916-237288938 GGATCCCTGTGGTGCCAGGCAGG + Intronic
923874597 1:238034288-238034310 GGATCCTTGTGGTACCAGGCTGG - Intergenic
923936846 1:238771020-238771042 GGAGCCCTGTAGTTCAAGGCTGG - Intergenic
924262452 1:242246170-242246192 GTCTCACTGTGTTGCCAGGCTGG - Intronic
924321494 1:242855258-242855280 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
924715037 1:246565680-246565702 GTCTCGCTGTGTTGCCAGGCTGG - Intronic
1063152214 10:3347194-3347216 GCATCCCTGTGGTGCCAAGATGG - Intergenic
1063364622 10:5482132-5482154 GGAGCCCTCTGCTGCCCGGCTGG + Intergenic
1064092202 10:12394879-12394901 GGACCAGTGTGGTGGCAGGCAGG + Intronic
1064706397 10:18076817-18076839 GGCTCACTCTGTTGCCAGGCTGG + Intergenic
1064908223 10:20370635-20370657 GGATCCCTGTGAGGCCAGGCAGG + Intergenic
1065085790 10:22174454-22174476 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
1065378281 10:25064410-25064432 GTCTCCCTGTGTTGCTAGGCTGG + Intergenic
1065471068 10:26081673-26081695 GGATCCCTGTGGTGCCAGGCAGG + Intronic
1065599088 10:27350215-27350237 GGAGCCATGTGGCGCAAGGCCGG + Intergenic
1066145597 10:32554429-32554451 GGATCCCTGTGTTTCCAGGCAGG + Intronic
1066639540 10:37541750-37541772 TCATCCCTGTGATGCAAGGCTGG + Intergenic
1066648080 10:37630448-37630470 TCATCCCTGTGATGCAAGGCTGG - Intergenic
1066685765 10:37979864-37979886 GACTCACTGTGTTGCCAGGCTGG - Intergenic
1067003974 10:42643779-42643801 GTCTCACTGTGTTGCCAGGCTGG + Intergenic
1067048355 10:42998522-42998544 TGCTCCCTGTGCTTCCAGGCAGG + Intergenic
1067189648 10:44058731-44058753 GTTTCTCTGTGGTGCCTGGCTGG + Intergenic
1067456265 10:46421345-46421367 ATATGCCTGTGGTGCCAGGCGGG + Intergenic
1067630934 10:47963294-47963316 ATATGCCTGTGGTGCCAGGCGGG - Intergenic
1067693914 10:48522187-48522209 GGAGCGCTGTGGTGCCAGAGTGG - Intronic
1067837154 10:49648616-49648638 GGATCCCAGGGCTGCCATGCTGG + Intronic
1067845682 10:49718726-49718748 TCATCCCTGGGGTGCAAGGCTGG + Intergenic
1068088893 10:52408438-52408460 GTCTCACTGTGTTGCCAGGCTGG - Intergenic
1068096701 10:52499885-52499907 GGATCCCTGTATTGCCAGGCAGG + Intergenic
1068368840 10:56087892-56087914 GCATCCCTGGGTTGCAAGGCTGG + Intergenic
1068480695 10:57585302-57585324 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1068642372 10:59424345-59424367 TCATCCCTGTGATGCAAGGCTGG - Intergenic
1068696552 10:59974102-59974124 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
1069150597 10:64954337-64954359 CGATCCCTGTGGTGCCAAGCAGG + Intergenic
1069160800 10:65090279-65090301 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
1069168084 10:65188822-65188844 GCATCCCTGGGATGCAAGGCTGG - Intergenic
1069242809 10:66163322-66163344 GGATCTCTGTGGTGCCAGGAAGG + Intronic
1069325187 10:67224742-67224764 GGATCCCTGTGATGCCAGGCAGG - Intronic
1070273927 10:74986014-74986036 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1070592122 10:77808737-77808759 AGGTCCCTGTGAAGCCAGGCAGG - Intronic
1071004552 10:80867518-80867540 TGATCCCTGGGATGCAAGGCTGG - Intergenic
1071448622 10:85773140-85773162 TCATCCCTGGGATGCCAGGCTGG + Intronic
1071484654 10:86091013-86091035 GGATCCCTGTGGTTCCAGGAAGG - Intronic
1071698137 10:87900148-87900170 TCATCCCTGTGATGCAAGGCTGG - Intronic
1072470301 10:95707090-95707112 GGATCCCTGAGTTGGCAGGGCGG - Intergenic
1073426112 10:103456602-103456624 AGATGCCTATGGGGCCAGGCAGG + Intronic
1073905068 10:108269547-108269569 TTATCCCTGTGATGCCAGGATGG - Intergenic
1074000841 10:109371062-109371084 TCATCCCTGTGCTGCAAGGCTGG + Intergenic
1074044986 10:109829507-109829529 TCATCCCTGGGATGCCAGGCTGG + Intergenic
1074985900 10:118659156-118659178 GGATCCCTGTGGTGCCAGCAGGG + Intergenic
1074998206 10:118775560-118775582 GTCTCACTGTGTTGCCAGGCTGG - Intergenic
1075946726 10:126439934-126439956 GGATTCCTGTGATGCTTGGCAGG - Intronic
1075955245 10:126517878-126517900 GTCTCACTGTGTTGCCAGGCTGG - Intronic
1076446984 10:130522430-130522452 GAATTCTTGTGGTACCAGGCAGG - Intergenic
1076623172 10:131806064-131806086 GGGTCCCTGTTGTGCAGGGCAGG - Intergenic
1076781506 10:132727382-132727404 GGACCCCTGAGTTCCCAGGCGGG - Intronic
1076796816 10:132802443-132802465 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
1076850557 10:133090342-133090364 GGAGCTCTGGGCTGCCAGGCCGG - Intronic
1076885698 10:133261502-133261524 GCGTCCCCGTGGTGCCAGGCTGG - Intergenic
1077423969 11:2465881-2465903 GGAGCTGTGTGCTGCCAGGCGGG + Intronic
1077582470 11:3425370-3425392 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
1077902838 11:6503681-6503703 GTCTCACTGTGTTGCCAGGCTGG + Intronic
1078284193 11:9934623-9934645 TCATCCCTGGGGTGCAAGGCTGG + Intronic
1078288500 11:9982953-9982975 GGATCCCTGTGGTGCCAGGCAGG - Intronic
1078581024 11:12539689-12539711 GGAGCCGTGTGCTTCCAGGCAGG - Intergenic
1078810925 11:14762228-14762250 GAATGCCTGTAGTACCAGGCAGG - Intronic
1079197886 11:18346244-18346266 GTCTCACTGTGTTGCCAGGCTGG + Intronic
1079268206 11:18956423-18956445 GGCTCTCTGTGGTTCCAGCCTGG - Intergenic
1079273758 11:19013822-19013844 GGATACCTGTGGTGCCAGGCAGG + Intergenic
1079791797 11:24748158-24748180 GGTTCTCTGTGATGCCAGGCAGG + Intronic
1079895828 11:26117309-26117331 TCATCCCTGGGGTGCAAGGCTGG + Intergenic
1080153118 11:29076689-29076711 GTATCCCTGTGGTGGCAGGCAGG + Intergenic
1080324048 11:31049880-31049902 GGATCCCTGTGGTGCCAGGCAGG - Intronic
1080577641 11:33614640-33614662 GTCTCCCTCTGTTGCCAGGCTGG + Intronic
1080672639 11:34395203-34395225 GGATCCCCATGGTGCCAGGCAGG + Intergenic
1081195179 11:40152328-40152350 GGATCCCCGTGGTGCCAGGCAGG - Intronic
1081410629 11:42753711-42753733 GCATCCCTGGGATGCAAGGCTGG - Intergenic
1081607959 11:44539021-44539043 GTTTCGCTGTGTTGCCAGGCTGG - Intergenic
1082135474 11:48544229-48544251 TCATCCCTGGGGTGCAAGGCTGG - Intergenic
1082140561 11:48603672-48603694 GGATCCCGGTGGTGCCAGACAGG + Intergenic
1082217923 11:49597066-49597088 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
1082303857 11:50546721-50546743 TCATCCCTGTGATGCAAGGCTGG + Intergenic
1082324407 11:51120452-51120474 TCATCCCTGTGATGCAAGGCTGG + Intergenic
1082554877 11:54552468-54552490 TCATCCCTGTGATGCAAGGCTGG + Intergenic
1082567339 11:54696632-54696654 TCATCCCTGGGGTGCAAGGCTGG - Intergenic
1082567754 11:54700772-54700794 GGATCCCTGTGGTGCCAGACAGG + Intergenic
1082582721 11:54893579-54893601 TCATCCCTGTGATGCAAGGCTGG - Intergenic
1082916770 11:58446176-58446198 GGATCCCTGTGGTGTCAAGCAGG - Intergenic
1083072772 11:60003568-60003590 GGATACCTGTGGTGCCAGGCAGG - Intergenic
1083143180 11:60738344-60738366 TGGTCCCTGTGGTGGAAGGCTGG - Intronic
1083189634 11:61040606-61040628 GTCTCCCTGTGTTGCCAGGTTGG - Intergenic
1083271020 11:61572662-61572684 GGCTCCCAGTGGTGCCTGGTGGG - Intronic
1083358423 11:62085869-62085891 GTCTCACTGTGTTGCCAGGCTGG - Intergenic
1083623530 11:64060408-64060430 GGATCCCTAGAGTCCCAGGCAGG + Intronic
1083798180 11:65030526-65030548 GTCTCACTGTGTTGCCAGGCTGG + Intronic
1084239378 11:67808187-67808209 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
1084407470 11:68983813-68983835 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
1084464029 11:69311928-69311950 GGGTCCCTGGGGTCCCAGGCTGG - Intronic
1084698019 11:70767962-70767984 GGATCCCTGCAGAGTCAGGCAGG - Intronic
1084833054 11:71784662-71784684 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
1085050837 11:73379365-73379387 GGATGACAGTGGGGCCAGGCTGG + Intronic
1085088575 11:73690410-73690432 GTCTCACTGTGTTGCCAGGCTGG + Intronic
1085534315 11:77208907-77208929 GAATCCCTTTGAGGCCAGGCTGG - Intronic
1085537848 11:77235757-77235779 GTCTCACTGTGTTGCCAGGCTGG - Intronic
1085747714 11:79129244-79129266 GGATCCCTCTGGTGCCAGGCAGG - Intronic
1086219959 11:84430407-84430429 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1086544531 11:87952127-87952149 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1086567583 11:88244278-88244300 TCATCCCTGGGGTGCAAGGCTGG + Intergenic
1086789501 11:91017995-91018017 TCATCCCTGGGATGCCAGGCTGG - Intergenic
1087619396 11:100525202-100525224 GGATCCTTGTGGTGCCAGGCAGG - Intergenic
1088206333 11:107397042-107397064 GGATCCCTGTGGTGCCAGGCAGG - Intronic
1088239438 11:107758568-107758590 GAATCCTTGTGGTGCTAGGCAGG - Intergenic
1088293300 11:108264298-108264320 TCATCCCTGGGATGCCAGGCTGG + Intronic
1088302824 11:108377297-108377319 TCATCCCTGGGATGCCAGGCTGG + Intronic
1089079972 11:115767501-115767523 GAATCCCTGTTTTGCCTGGCTGG - Intergenic
1089937388 11:122378086-122378108 GGGCCCCTGTGGTGCCAGGCAGG - Intergenic
1089954323 11:122556174-122556196 GGATCCCTGTGATGCCAGGCAGG + Intergenic
1090706054 11:129337924-129337946 GCATCCATGTGCTGCCAGGAGGG - Intergenic
1090757235 11:129803374-129803396 GGATTCCTGTGGTGTCAGGCAGG - Intergenic
1090962635 11:131570791-131570813 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1091210608 11:133854919-133854941 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1091404085 12:198091-198113 GGAGCACTGAGGGGCCAGGCTGG - Intronic
1091455055 12:600524-600546 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1091679338 12:2515635-2515657 GGATGCCCGTGGTGTGAGGCTGG + Intronic
1091925507 12:4344542-4344564 TCATCCCTGGGGTGCAAGGCTGG + Intronic
1092314229 12:7393239-7393261 TCATCCCTGGGATGCCAGGCTGG + Intronic
1092316714 12:7424144-7424166 TCATCCCTGGGATGCCAGGCTGG + Intronic
1092410062 12:8245808-8245830 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
1092449543 12:8589177-8589199 GTCTCCCTATGTTGCCAGGCTGG + Intergenic
1092507755 12:9121509-9121531 GGCTCGCTCTGTTGCCAGGCTGG - Intergenic
1092693700 12:11144706-11144728 GGAGTACTATGGTGCCAGGCAGG + Intronic
1093010447 12:14101546-14101568 GGATCCCTGTGATACCAGGCAGG - Intergenic
1093172248 12:15874225-15874247 GGATCCCTGTGGTGCCAGGCAGG - Intronic
1093273919 12:17100285-17100307 TCATCCCTGGGGTGCAAGGCTGG + Intergenic
1093382995 12:18518059-18518081 TCATCCCTGGGGTGCAAGGCTGG - Intronic
1093389505 12:18601917-18601939 GGATCCCTGTGGTGCCAGGCAGG - Intronic
1093409358 12:18845697-18845719 GGATCCCTGTGACACCAGGCAGG + Intergenic
1093488830 12:19681788-19681810 GGATCCCTGTGGTGCCAGGTAGG + Intronic
1093497540 12:19775483-19775505 GGAGTCCTGTGGTGCCGGGCAGG + Intergenic
1093651840 12:21655089-21655111 GAATCGCTCTGTTGCCAGGCTGG - Intronic
1093720492 12:22436978-22437000 GGATCCCTGCGGTGCCAGGCAGG - Intronic
1093994870 12:25630692-25630714 GGATCCCTGTGGTGCCAGGCAGG - Intronic
1094144936 12:27218936-27218958 GTATCCCTATGTTGCCTGGCTGG + Intergenic
1094362028 12:29640657-29640679 GGATCCCTGTGGTTCCAGGCAGG - Intronic
1094447438 12:30546630-30546652 GGATCCCTGTGTTGCCAGGCTGG + Intergenic
1094501269 12:31023145-31023167 GGATCCCTGTGGTACCAGGCAGG - Intergenic
1094801964 12:34047911-34047933 GGATCCCTGTGGTTCCAGGTAGG - Intergenic
1094837096 12:34327240-34327262 GGATCCCCGAGGTCCCATGCTGG + Intergenic
1095115098 12:38343819-38343841 GGATCCCTGTGGTTCCAGGAAGG - Intergenic
1095186953 12:39211547-39211569 TTATCCCTGTGATGCAAGGCTGG + Intergenic
1095224719 12:39666390-39666412 TCATCCCTGGGGTGCAAGGCTGG - Intronic
1095248266 12:39946970-39946992 GGATCACTGTGGTGCCAGGCAGG + Intronic
1095665094 12:44788539-44788561 GGATCCCTGTGGTGCTAGGCAGG - Intronic
1095779852 12:46047527-46047549 GTCTCACTGTGTTGCCAGGCTGG - Intergenic
1095892692 12:47249648-47249670 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1095931986 12:47636719-47636741 GGGTCCCTGTGGTTCCAGGCAGG - Intergenic
1096878405 12:54648050-54648072 GGAGCCCTGTGGCCCCAGCCTGG - Intronic
1096888687 12:54744100-54744122 GGATCCCTGTGATGCCAGGCAGG + Intergenic
1096956770 12:55534377-55534399 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1096997998 12:55851523-55851545 GCTTCCCTATGTTGCCAGGCTGG - Intergenic
1097256594 12:57680953-57680975 GTTTCCCTCTGTTGCCAGGCTGG + Intergenic
1097262533 12:57727610-57727632 GGGTGCCTGTGCTGCCCGGCTGG - Intronic
1097295398 12:57957763-57957785 GGATCTCTGTGGTGACAGGCAGG - Intergenic
1097386068 12:58950873-58950895 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1097412459 12:59271725-59271747 GCATCCCTGGGATGCAAGGCTGG + Intergenic
1097760451 12:63459055-63459077 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1097855808 12:64460802-64460824 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1097909725 12:64957148-64957170 GTCTCCCTTTGTTGCCAGGCAGG + Intergenic
1098961010 12:76739602-76739624 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1099309699 12:81003092-81003114 TCATCCCTGGGATGCCAGGCTGG + Intronic
1099369920 12:81816304-81816326 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
1099392962 12:82102824-82102846 GGATCCCTGTGGTACCAGGCAGG - Intergenic
1099473120 12:83074988-83075010 GGATCCCTGTGGTGTCAGGCAGG + Intronic
1099687512 12:85908503-85908525 GGATCCTTGTGATGCCAGTCAGG + Intergenic
1099777500 12:87151783-87151805 GGGTCCCTGTGGTGTCAGGCAGG + Intergenic
1100020003 12:90057635-90057657 TAATGCCTGTGGTGCCAGGTTGG + Intergenic
1100088216 12:90937053-90937075 GGATCCCTGCAGTGCCAGGCAGG + Intronic
1100115642 12:91300117-91300139 TCATCCCTGAGATGCCAGGCTGG + Intergenic
1100291079 12:93215354-93215376 GGATCCCTGTGGTGTCAGGCAGG + Intergenic
1101394864 12:104337989-104338011 GTCTCCCTATGTTGCCAGGCTGG + Intronic
1101483066 12:105121535-105121557 GTCTCACTGTGTTGCCAGGCTGG + Intronic
1101758152 12:107637684-107637706 GCATCTCTGTGGGACCAGGCAGG + Intronic
1101867237 12:108529182-108529204 GGAACCCTGTGGTGTTAGACCGG + Intronic
1102156360 12:110732365-110732387 GTCTCGCTGTGTTGCCAGGCTGG - Intronic
1102245454 12:111353058-111353080 GGCCCCCTGTGGGACCAGGCTGG + Intergenic
1102348726 12:112176440-112176462 GGTTCCCTGGGGTATCAGGCAGG - Intronic
1102916827 12:116760451-116760473 GGATCCCCGTGGTGCCAGACAGG + Intronic
1102967750 12:117141236-117141258 GGATCCCGGAGGCGCCACGCTGG + Intergenic
1103016147 12:117496022-117496044 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1103417446 12:120752536-120752558 GGATCCCTGGAATGGCAGGCAGG + Intergenic
1103477855 12:121231974-121231996 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1103761198 12:123251451-123251473 GGATCCCTGTGGTGCCAGGCAGG + Intronic
1103809921 12:123605216-123605238 GTCTCCCTGTGTTGCCTGGCTGG + Intronic
1103971331 12:124674530-124674552 GGAGCCATGTGCTGCCTGGCAGG + Intergenic
1104504588 12:129319216-129319238 AGATCCTTGTGGTGCCAGGCAGG + Intronic
1104769985 12:131355535-131355557 TGTTCCCTGCTGTGCCAGGCCGG + Intergenic
1104873826 12:132019235-132019257 GTCTCCCTGTGTTGCCAGGCTGG + Intronic
1105702881 13:22946730-22946752 GGATCCCTGTGGTGCGTACCGGG + Intergenic
1105908166 13:24834711-24834733 GAATCCCTGTGGCACCAGGCAGG - Intronic
1105930679 13:25049028-25049050 GAATTCCTGTGGTGCCAGGCAGG - Intergenic
1106022615 13:25929661-25929683 GTCTCACTGTGTTGCCAGGCTGG - Intronic
1106267412 13:28122890-28122912 GTATCTCTTTGTTGCCAGGCTGG - Intergenic
1106938231 13:34747681-34747703 AGATCCCTGTGGTGCCGGGCAGG + Intergenic
1107184749 13:37505385-37505407 GGATCCCTGCAGTGCTAGGCAGG - Intergenic
1107261680 13:38499444-38499466 GTCTCCCTATGTTGCCAGGCTGG + Intergenic
1107425811 13:40291676-40291698 GTCTCGCTGTGTTGCCAGGCTGG + Intergenic
1107666316 13:42694263-42694285 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1107756087 13:43623361-43623383 GGATCCCCATGGTGCCAGGCAGG + Intronic
1107847018 13:44525389-44525411 GGCTCACTGTGTTGCTAGGCTGG - Intronic
1107910054 13:45097119-45097141 GTCTCCCTGTGCTTCCAGGCTGG + Intergenic
1108047631 13:46398068-46398090 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1108137538 13:47381934-47381956 TCATCCCTGGGATGCCAGGCTGG + Intergenic
1108469870 13:50756828-50756850 GGATCCCTGTCATGCCAGGCAGG + Intronic
1108765935 13:53629678-53629700 GTCTCGCTGTGTTGCCAGGCTGG + Intergenic
1108817020 13:54304942-54304964 GCATCCCTGTGGTGCCAGGCAGG - Intergenic
1108825464 13:54407820-54407842 GGATCCCTATGGTGCCAGGCAGG - Intergenic
1109048018 13:57438093-57438115 GGATCCCTGTGGTGCTAGGCAGG + Intergenic
1109213660 13:59563493-59563515 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1109216391 13:59594450-59594472 TCATCCCTGTGATGCAAGGCTGG + Intergenic
1109464616 13:62713059-62713081 GTCTCCCTGTGTCGCCAGGCTGG - Intergenic
1109626293 13:64979304-64979326 GCATCCCTGAGGTGCAAGGCTGG - Intergenic
1109918646 13:69025715-69025737 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
1110056701 13:70982932-70982954 GTCTCACTGTGTTGCCAGGCTGG - Intergenic
1110561783 13:76917642-76917664 GGATCCCTGAGGTGCCAGGCAGG - Intergenic
1110852714 13:80263101-80263123 GGATCCTTGTGGTGCCAGGCAGG + Intergenic
1111445071 13:88336569-88336591 GAATCCCTGTTGTGAAAGGCTGG - Intergenic
1112035461 13:95492780-95492802 GGATCCCTGTGGTGTCAGGCAGG + Intronic
1112413986 13:99189279-99189301 GGCTCACTCTGTTGCCAGGCTGG - Intergenic
1112738000 13:102443023-102443045 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1113270013 13:108662865-108662887 GAATCCCTGTGGTGCCAGGCAGG + Intronic
1113329871 13:109317489-109317511 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1113458498 13:110465572-110465594 GGGTCCCTGCGGGGCCAGGAGGG - Exonic
1113671866 13:112181103-112181125 GCTTCCCAGAGGTGCCAGGCAGG - Intergenic
1113744585 13:112734785-112734807 GGATCACTATGGTGCCTGGTGGG + Intronic
1113837385 13:113337263-113337285 GGATCTCACTGTTGCCAGGCTGG - Intronic
1114007092 14:18325865-18325887 GTATCCCTGTGTCACCAGGCTGG + Intergenic
1114429763 14:22650735-22650757 GCATGCCAGTGGTGCGAGGCTGG - Intergenic
1114544708 14:23490390-23490412 GTCTCCCTATGTTGCCAGGCTGG - Intronic
1114549061 14:23522876-23522898 GGACCACTGTGGTGGTAGGCAGG + Exonic
1114657162 14:24323083-24323105 GGAGTACTGTGGGGCCAGGCAGG + Exonic
1114692398 14:24595883-24595905 GGATCCGTGTGGTCCCTGGCAGG + Intergenic
1115265065 14:31492641-31492663 GGATCCCTGTGGGGCCAGGCAGG - Intronic
1115299157 14:31865175-31865197 GGATCTCTGTGGTGACAGGCAGG - Intergenic
1115527463 14:34295835-34295857 TCATCCCTGTGATGCAAGGCTGG - Intronic
1115593365 14:34885515-34885537 GAGTCTCTGTGTTGCCAGGCTGG - Intergenic
1115644253 14:35356383-35356405 TGATCTCTGTGGTACCTGGCAGG - Intergenic
1115645571 14:35366621-35366643 GGAACCATGTGGGGCAAGGCTGG - Intergenic
1115680233 14:35730264-35730286 GGATCCCTGTGGTGCCAGGCAGG - Intronic
1115835572 14:37398083-37398105 GGATCCCTGTGGTGCCAGGCAGG + Intronic
1115958436 14:38808632-38808654 GGATCCCTGTGGTGTCAGGCAGG - Intergenic
1115969728 14:38932160-38932182 GGATCCCTGTGGTTTCAGGCAGG - Intergenic
1115996836 14:39203736-39203758 AGATCCCTGTGGTGCCAGGCAGG - Intergenic
1116049116 14:39781626-39781648 GGATCCCCGTGGTGCCAGGCAGG + Intergenic
1116164095 14:41311470-41311492 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
1116192664 14:41680167-41680189 AGTTCCCTTTGGTCCCAGGCAGG - Intronic
1116346623 14:43802822-43802844 GGATTCCTCTGGTGCCAGGCAGG - Intergenic
1116772761 14:49146303-49146325 GCATCCCTGGGATGCAAGGCTGG - Intergenic
1116795651 14:49387299-49387321 GCATCCCTGGGATGCAAGGCTGG + Intergenic
1116806748 14:49501323-49501345 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1117510870 14:56449246-56449268 GGATCCCTGTGGTGCCTGGAAGG + Intergenic
1117639747 14:57785795-57785817 GGATCCCTGTGGTACTAGGCAGG - Intronic
1117711074 14:58529523-58529545 TCATCCCTGGGGTGCAAGGCTGG + Intronic
1117819929 14:59637680-59637702 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1118162228 14:63301950-63301972 GGATCCCTGTGGTGCCATGCAGG - Intergenic
1118190488 14:63575637-63575659 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
1118532276 14:66719247-66719269 AGATCCCTGTAATGCCAGACAGG + Intronic
1118658759 14:67983966-67983988 GTCTCCCTCTGTTGCCAGGCTGG + Intronic
1118831832 14:69440701-69440723 GTCTCCCTCTGTTGCCAGGCTGG + Intronic
1118886782 14:69873981-69874003 CAAGCCATGTGGTGCCAGGCTGG - Intronic
1119063605 14:71502290-71502312 GTCTCGCTGTGTTGCCAGGCTGG + Intronic
1119237549 14:73032356-73032378 GGCTCACTCTGTTGCCAGGCTGG + Intergenic
1119361358 14:74053000-74053022 GTCTCACTGTGTTGCCAGGCTGG - Intronic
1120344355 14:83266108-83266130 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
1120559304 14:85971360-85971382 TCATCCCTGGGATGCCAGGCTGG - Intergenic
1121117023 14:91351039-91351061 TGATCCCGGTGGTCCCACGCAGG + Intronic
1121459768 14:94065876-94065898 GGATCCCTGTGGTGCCAGGCAGG - Intronic
1121494756 14:94384543-94384565 GGATCACTGTGGGGCAGGGCAGG - Intronic
1121516696 14:94556841-94556863 GGGCTCCTGTGGTGCCATGCAGG + Intergenic
1121904481 14:97727215-97727237 GCCTCCCTCTGTTGCCAGGCTGG + Intergenic
1122226259 14:100281916-100281938 GGATCAGTGTGGTGCCAGAGAGG + Exonic
1122231982 14:100310802-100310824 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
1122363243 14:101179855-101179877 GCGTCCCTGGTGTGCCAGGCTGG + Intergenic
1122813559 14:104301042-104301064 GTATCACTGTGTTGCCAGGCTGG + Intergenic
1122844520 14:104484970-104484992 GGATCCCTGTGGTGCACAGCAGG + Intronic
1122890002 14:104727812-104727834 GGAGCCCTGTGGTCCTCGGCAGG - Intronic
1123391006 15:19872504-19872526 GTATCCCTGTGTCACCAGGCTGG + Intergenic
1123862486 15:24482859-24482881 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
1124011522 15:25843164-25843186 GCAGCCCTCTGGTGCCAGGGAGG - Intronic
1124380642 15:29162189-29162211 GGATCCCTGTGGTGCCAGGCAGG - Intronic
1124557041 15:30735985-30736007 GGATGCCTGCGGTGCCAGGCAGG - Intronic
1124674222 15:31669759-31669781 GGATCCCTGTGGTGCCAGGCAGG + Intronic
1124925515 15:34066607-34066629 GTCTCCCTATGTTGCCAGGCTGG - Exonic
1125056007 15:35359485-35359507 GGATCCCTGTGGTGCCAGGCAGG + Intronic
1125269487 15:37922083-37922105 GGATCCCTGTAGTGCCAAGCAGG + Intronic
1125697704 15:41652565-41652587 GTCTCACTGTGTTGCCAGGCTGG + Intronic
1126041252 15:44593383-44593405 GGTTCACTGTGTTGCCAGGCTGG + Intronic
1126045183 15:44633141-44633163 GTCTCACTGTGTTGCCAGGCTGG - Intronic
1126100663 15:45116499-45116521 GGGTCCCTGTGGGGTGAGGCGGG - Exonic
1126418422 15:48443835-48443857 GCCTCCCTATGTTGCCAGGCTGG - Intronic
1126460886 15:48913714-48913736 GGATCCCTGTGGTTCCAGGCAGG + Intronic
1126572632 15:50168557-50168579 GGATCTCTTTGGTGTCAGGCAGG - Intronic
1126577409 15:50210515-50210537 GGATCCCTGTGGTGCCAGGCGGG - Intronic
1126767493 15:52023639-52023661 GTCTCCCTCTGTTGCCAGGCTGG + Intronic
1127031060 15:54863461-54863483 GCATCCCTGTGGTGCCAGGCAGG - Intergenic
1127407882 15:58671676-58671698 GTCTCACTGTGTTGCCAGGCTGG - Intronic
1127468836 15:59272148-59272170 GTCTCCCTGTGTTGCCAGGATGG + Intronic
1128238634 15:66084674-66084696 GGATCCCTGTGGTGCCAGGCAGG - Intronic
1128294575 15:66506884-66506906 GTCTCGCTGTGTTGCCAGGCTGG + Intronic
1128612167 15:69083041-69083063 GGCTCCCTGAGGTGCAAGGCAGG - Intergenic
1128622509 15:69161750-69161772 GGATCCCTGTGGGGGCGCGCTGG + Intronic
1128728090 15:70002559-70002581 GGAGCCCTCTGGGGGCAGGCAGG + Intergenic
1128817493 15:70624084-70624106 GTCTCACTGTGTTGCCAGGCTGG + Intergenic
1129097682 15:73225903-73225925 GGATCCCTGTGGTGCCAGTTAGG + Intronic
1130432694 15:83864430-83864452 TCATCCCTGTGATGCAAGGCTGG + Intronic
1130574387 15:85078518-85078540 GTATCGCTCTGTTGCCAGGCTGG - Intronic
1131039052 15:89245196-89245218 GTCTCCCTCTGTTGCCAGGCTGG + Intronic
1131145944 15:90012173-90012195 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1131164009 15:90129192-90129214 GTCTCGCTGTGTTGCCAGGCTGG - Intergenic
1132210381 15:100017475-100017497 GGATCCCTGTGGTGCCAGGCAGG + Intronic
1132927900 16:2441202-2441224 GTATCGCTCTGTTGCCAGGCTGG - Intronic
1132943248 16:2518888-2518910 GGCTCCCTGGGGTGACAGGTGGG + Intronic
1133369556 16:5237720-5237742 GTATTCCTGTGGGGGCAGGCTGG + Intergenic
1133599271 16:7323226-7323248 GTCTCGCTGTGTTGCCAGGCGGG - Intronic
1134170291 16:11963026-11963048 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1134378694 16:13703671-13703693 GTCTCACTGTGTTGCCAGGCTGG - Intergenic
1134465943 16:14477747-14477769 GTCTCGCTGTGTTGCCAGGCTGG - Intronic
1134491541 16:14699497-14699519 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
1134496922 16:14738615-14738637 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1135254061 16:20926479-20926501 GTCTCGCTGTGTTGCCAGGCTGG - Intergenic
1135901503 16:26464433-26464455 GAATCCCTGTGGCGCCAGGCAGG - Intergenic
1136119778 16:28125120-28125142 GGAGCCCAGTGGTGAAAGGCTGG + Intronic
1136191439 16:28617569-28617591 GTCTCCCTCTGTTGCCAGGCTGG + Intronic
1136417829 16:30114262-30114284 GCATCCCTGAGGAGCCAGGCCGG - Exonic
1137007462 16:35290992-35291014 TCATCCCTGGGATGCCAGGCTGG + Intergenic
1137049736 16:35698457-35698479 TCATCCCTGGGATGCCAGGCTGG + Intergenic
1137467243 16:48720945-48720967 GCAACCCTGTGGTCCCAGGCTGG - Intergenic
1137678347 16:50315796-50315818 TGTTCCCTGAGGTGCCAGGCAGG + Exonic
1137890623 16:52158102-52158124 TCATCCCTGTGATGCAAGGCTGG - Intergenic
1138229578 16:55327339-55327361 GGCTCCTGGTTGTGCCAGGCTGG - Exonic
1138798064 16:59993639-59993661 GGATTCCTGTGGTGCCAGGAAGG + Intergenic
1138829678 16:60360227-60360249 GGAAACCTGTGGAGCGAGGCTGG - Intergenic
1139571933 16:67818317-67818339 ATCTCCCTGTGTTGCCAGGCTGG - Intronic
1139778616 16:69332318-69332340 GTCTCGCTGTGTTGCCAGGCTGG - Intronic
1139838981 16:69862920-69862942 GTCTCCCTGTGCTGCCAGGCTGG + Intronic
1139987997 16:70916255-70916277 AGATCCCTGTGATGCCAGACAGG + Intronic
1140620892 16:76731195-76731217 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
1140674674 16:77316282-77316304 GTCTCGCTGTGATGCCAGGCTGG + Intronic
1141476564 16:84277749-84277771 GTTTCCCTATGTTGCCAGGCTGG + Intergenic
1141699940 16:85637795-85637817 GGGTCCCTCTGGTGCCTGCCAGG + Intronic
1141928696 16:87186147-87186169 GGAGCCCCGTGGTGAGAGGCGGG - Intronic
1142179370 16:88659946-88659968 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1143014439 17:3884121-3884143 GGAGCCATGTGGAGCCAAGCAGG - Intronic
1143427812 17:6854010-6854032 GAATCCCAGTGGTGCCAGGCAGG - Intergenic
1143587233 17:7856371-7856393 GGAACTCGGTGTTGCCAGGCCGG + Intergenic
1144139769 17:12337004-12337026 GGATCTCTGTGGTGCCAGGCAGG + Intergenic
1144548685 17:16220316-16220338 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1144966555 17:19080174-19080196 GGATCAGTGTGGGACCAGGCAGG - Intergenic
1144981363 17:19171883-19171905 GGATCAGTGTGGGACCAGGCAGG + Intergenic
1144986861 17:19206356-19206378 GGATCAGTGTGGGACCAGGCAGG - Intergenic
1145371315 17:22308548-22308570 GTCTCACTGTGTTGCCAGGCTGG - Intergenic
1145899614 17:28481854-28481876 GTCTCACTGTGTTGCCAGGCTGG + Intronic
1146203819 17:30884186-30884208 GTCTCCCTCTGTTGCCAGGCTGG + Intronic
1146231904 17:31118962-31118984 GTCTCACTGTGTTGCCAGGCTGG + Intronic
1146319799 17:31838091-31838113 GGCTGCCTGTGGTGGCAGGTCGG + Intergenic
1146440586 17:32890816-32890838 TCATCCCTGTGATGCAAGGCTGG + Intergenic
1146670677 17:34735373-34735395 GCAGCCCAGTGGTGGCAGGCTGG + Intergenic
1147213061 17:38883348-38883370 GTGTCCCTCTGTTGCCAGGCTGG - Intronic
1147271941 17:39279301-39279323 GTCTCCCTATGTTGCCAGGCTGG - Intronic
1147350282 17:39836959-39836981 GTCTCACTGTGTTGCCAGGCTGG + Intronic
1147409318 17:40238034-40238056 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1147470110 17:40650624-40650646 GTCTCCCTATGTTGCCAGGCTGG - Intergenic
1147706564 17:42429344-42429366 GTCTCGCTGTGTTGCCAGGCTGG + Intergenic
1147899645 17:43775698-43775720 GGATCCCTCTGGGGGCAGGGAGG - Intronic
1148620321 17:49029832-49029854 GTCTCCCTATGTTGCCAGGCTGG + Intronic
1148933874 17:51149154-51149176 GTCTCCCTTTGTTGCCAGGCTGG - Intergenic
1148949736 17:51300392-51300414 GTGTCACTGTGTTGCCAGGCTGG - Intergenic
1150190069 17:63229252-63229274 TCATCCCTGGGGTGCAAGGCTGG - Intronic
1150371846 17:64645666-64645688 GTATCGCTATGTTGCCAGGCTGG + Intronic
1150414941 17:64979522-64979544 TGAACTCTGTGGTGTCAGGCTGG - Intergenic
1150538872 17:66076083-66076105 AGGTCCCTGTGGTACCAGGCAGG - Intronic
1150636862 17:66919091-66919113 GGAGCCCAGTGGTGCCTGGATGG + Intergenic
1150796696 17:68244147-68244169 TGAACTCTGTGGTGTCAGGCTGG + Intergenic
1151048312 17:70947777-70947799 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1151565650 17:74896272-74896294 GGATCCCTGTGGGGTAGGGCTGG + Intergenic
1151607917 17:75151631-75151653 GTCTCACTGTGTTGCCAGGCTGG - Intronic
1151910666 17:77080717-77080739 GTCTCGCTGTGTTGCCAGGCTGG - Intergenic
1151959217 17:77396665-77396687 GGAGCCCTGTTCTGCCAGCCTGG + Intronic
1152040156 17:77897795-77897817 GCATCCCTGAGGCCCCAGGCTGG + Intergenic
1152082966 17:78199887-78199909 GGATCCTTGGGGTGACAGGATGG + Intronic
1152262480 17:79274592-79274614 GGAGCCCTGTGGTGCAGGGCTGG + Intronic
1152469797 17:80484388-80484410 GGCTCACTGTGATGCCCGGCTGG - Intergenic
1152928226 17:83097646-83097668 TCACCCCTGGGGTGCCAGGCAGG - Intergenic
1153069570 18:1089670-1089692 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1153169052 18:2293931-2293953 GGTTCCCTATGGTGCCAGGCAGG + Intergenic
1153400392 18:4678636-4678658 GGATCCCTGTGATGCCAGGAAGG - Intergenic
1153780609 18:8492146-8492168 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
1153966024 18:10182559-10182581 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1154070097 18:11146396-11146418 GGGTCCCAGTGGTGAGAGGCAGG + Intronic
1154094001 18:11393469-11393491 GGATCCTTGTGGTGCCAGGCAGG - Intergenic
1154241125 18:12654996-12655018 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1154339729 18:13492905-13492927 GGATCGCTGTGCTACCAGCCTGG + Intronic
1154530376 18:15338153-15338175 GTATCCCTGTGTCACCAGGCTGG - Intergenic
1155051369 18:22150792-22150814 GTCTCGCTGTGTTGCCAGGCTGG + Intergenic
1155327572 18:24680657-24680679 GGAACACTGAGGTGTCAGGCAGG + Intergenic
1155856975 18:30846589-30846611 TCATCCCTGGGGTGCAAGGCTGG - Intergenic
1155988265 18:32253515-32253537 GTTTCACTGTGGTGCCAGACTGG + Intronic
1156011464 18:32501799-32501821 GGATCCCAGTGATGCCAGGCAGG + Intergenic
1157854750 18:51095136-51095158 TCATCCCTGGGATGCCAGGCTGG - Intergenic
1158002532 18:52636221-52636243 GGATCCCTGTGGTGCCAAGCAGG - Intronic
1158331605 18:56368480-56368502 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1158756411 18:60331459-60331481 GGATCCCTGTGGTGCTAGGCAGG - Intergenic
1159364453 18:67447948-67447970 TCATCCCTGTGATGCAAGGCGGG - Intergenic
1159787014 18:72726743-72726765 AAATCCCTGTGATGCCAGGCAGG - Intergenic
1160267681 18:77354159-77354181 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1161404814 19:4085498-4085520 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
1161423896 19:4191509-4191531 GTCTCGCTGTGTTGCCAGGCTGG + Intronic
1161556161 19:4944016-4944038 GGATGGTAGTGGTGCCAGGCGGG + Intronic
1161668487 19:5590964-5590986 GAGTCTCTGTGGTGCCATGCGGG - Intronic
1161728377 19:5944060-5944082 GGATGCGTGAGGTGACAGGCAGG + Intronic
1162261134 19:9535047-9535069 GTCTCGCTGTGTTGCCAGGCTGG - Intronic
1162372736 19:10289026-10289048 GTATCCATGTGGTGGCAGCCGGG + Intergenic
1162432835 19:10639445-10639467 GGGTCCAGGTGGTGCCATGCAGG + Intronic
1162500572 19:11051097-11051119 GGTTCCCTGTGGAGCCGTGCTGG + Intronic
1162942438 19:14019555-14019577 GTCTCGCTGTGTTGCCAGGCTGG - Intergenic
1163075239 19:14884943-14884965 TCATCCCTGGGATGCCAGGCTGG + Intergenic
1163170401 19:15527200-15527222 GAATCCCTCTGGGGCCAGGATGG - Intronic
1163561592 19:18022500-18022522 AGATCCCTGTGGAGTCAGGGTGG + Intergenic
1163712734 19:18856505-18856527 GGATCCCAGTGGAGGCTGGCAGG - Intronic
1163880803 19:19920275-19920297 TCATCCCTGGGATGCCAGGCTGG - Intronic
1163988608 19:20976233-20976255 GTATCACTCTGTTGCCAGGCTGG - Intergenic
1164251648 19:23482683-23482705 GGATCCCTGTGGTGCTAGGCAGG - Intergenic
1164288048 19:23839723-23839745 GGATTCCTGTGGTGCCAGGCAGG + Intergenic
1164320246 19:24137874-24137896 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1164347362 19:27282876-27282898 TCATCCCTGGGGTGCAAGGCTGG - Intergenic
1164348351 19:27296993-27297015 TCATCCCTGGGGTGCAAGGCTGG + Intergenic
1164618489 19:29680470-29680492 GAAACCCTCTGGTGCCAGCCTGG - Intergenic
1164882528 19:31745411-31745433 GTATCGCTTTGTTGCCAGGCTGG - Intergenic
1165112279 19:33509380-33509402 AGATCCCAGTCTTGCCAGGCTGG + Intronic
1165642379 19:37400863-37400885 GTCTCCCTGTGTTGCCAGGCTGG + Intergenic
1166026070 19:40085848-40085870 GGCTCGCTCTGTTGCCAGGCTGG - Intronic
1166124011 19:40702969-40702991 GGAACCCTGTGGTGCTATGAAGG - Intronic
1166511378 19:43411424-43411446 AGATCGCTCTGGTGCCAGGTGGG + Intronic
1167293448 19:48636538-48636560 GGACCCCTGGGGTCCCAGGGAGG - Intronic
1167399295 19:49254325-49254347 GTCTCACTGTGTTGCCAGGCTGG - Intergenic
1167440429 19:49505532-49505554 GGATCCCTGGGGGCCCAGCCTGG + Intergenic
1167745571 19:51349775-51349797 GCCTCCCTCTGTTGCCAGGCTGG + Intronic
1167871398 19:52373701-52373723 GTCTCCCTGTGTTGCCAGGCTGG + Intronic
1168058483 19:53877041-53877063 GAATCCCTCTGGAGCCAGGGTGG - Intergenic
1168458484 19:56534224-56534246 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1168584571 19:57582574-57582596 GGTTTCCTGTGGTGACAGGGTGG + Intronic
1168616141 19:57838569-57838591 GTCTCCCTCTGCTGCCAGGCTGG - Intronic
925085081 2:1101335-1101357 GGATCCCAGTGGGGAGAGGCAGG - Intronic
925124988 2:1448068-1448090 AGACCCCTGTGCTGTCAGGCAGG - Intronic
925369409 2:3333540-3333562 GTCTCACTGTGTTGCCAGGCTGG - Intronic
926872830 2:17441631-17441653 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
926916091 2:17893536-17893558 GGATCCCCGTGGTGCCAGGCAGG + Intronic
927111202 2:19864859-19864881 GGATACTTGGGGTTCCAGGCTGG - Intergenic
927463522 2:23320353-23320375 GGACCCCTGTGGTCCAGGGCAGG + Intergenic
927740814 2:25568126-25568148 GTCTCCCTGTGTCGCCAGGCTGG - Intronic
927975123 2:27332743-27332765 GTCTCCCTCTGTTGCCAGGCTGG + Intronic
928117996 2:28561693-28561715 GCCTCCCTATGTTGCCAGGCTGG - Intronic
928342345 2:30455710-30455732 GCCTCCCTGTGTTCCCAGGCTGG - Intronic
928733658 2:34261266-34261288 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
928772615 2:34720078-34720100 GGATCCCTGTGGTGCTAGGCAGG + Intergenic
929264482 2:39903009-39903031 AAATGCCTATGGTGCCAGGCAGG + Intergenic
929329328 2:40660808-40660830 GTCTCGCTGTGTTGCCAGGCTGG - Intergenic
929805927 2:45145070-45145092 GGATCCCTGTGATGCTGGGCAGG - Intergenic
929954045 2:46441917-46441939 GTCTCGCTGTGTTGCCAGGCTGG - Intronic
930331260 2:49987540-49987562 GGTACACTGTGGTTCCAGGCAGG - Intronic
930486588 2:52018255-52018277 GGATTCCTGTGGTGCCAGGCAGG + Intergenic
930787709 2:55286713-55286735 GTCTCGCTGTGTTGCCAGGCTGG + Intergenic
930885458 2:56320957-56320979 GCATCCCTGGGATGCAAGGCTGG + Intronic
930913761 2:56662630-56662652 TCATCCCTGTGATGCAAGGCTGG - Intergenic
931446794 2:62333553-62333575 GTCTCGCTGTGTTGCCAGGCTGG - Intergenic
931631977 2:64310160-64310182 GTCTCGCTGTGTTGCCAGGCTGG - Intergenic
931790873 2:65663086-65663108 GGATCCCTGTGGTTGCTGGAAGG + Intergenic
931992930 2:67809339-67809361 GGAACCGTGTGGTGCCAGGCAGG - Intergenic
932100800 2:68897392-68897414 GGATCCCTGTGGTTCCAGAGAGG + Intergenic
932136731 2:69237614-69237636 GTCTCACTGTGTTGCCAGGCTGG + Intronic
932951652 2:76300972-76300994 GAATCCCTGGGATGCAAGGCTGG + Intergenic
932954724 2:76337759-76337781 CGATCCCTGTGATGCCAGGCAGG + Intergenic
933121292 2:78541669-78541691 GAATTCCTGTGATGCCAGGCAGG - Intergenic
933531438 2:83517305-83517327 GGATCTCTGTGGTGCCAGGAAGG - Intergenic
933814886 2:86058435-86058457 GTCTCACTGTGTTGCCAGGCTGG + Intronic
934097206 2:88617725-88617747 GTCTCGCTGTGTTGCCAGGCTGG - Intronic
934617405 2:95782270-95782292 TCATCCCTGGGATGCCAGGCTGG + Intergenic
934643488 2:96042289-96042311 TCATCCCTGGGATGCCAGGCTGG - Intergenic
934653484 2:96105278-96105300 GGCCCCCTGTGTTGCCAGGATGG + Intergenic
935005224 2:99067815-99067837 GGCTCACTGTATTGCCAGGCTGG - Intronic
935278385 2:101495955-101495977 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
935380540 2:102447086-102447108 GGGTCCCGATGGTGCCAAGCAGG - Exonic
935408948 2:102738560-102738582 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
935700534 2:105807931-105807953 GTCTCCCTCTGTTGCCAGGCTGG + Intronic
937057771 2:118953944-118953966 GGATTCCTGTGGTGCCAGCCAGG - Intronic
937069342 2:119050755-119050777 GGATCCCTGTGGTTCCAGGCAGG + Intergenic
937521700 2:122720513-122720535 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
937529203 2:122808421-122808443 GGATCCCTGTGGTGCCAAGCAGG - Intergenic
937917492 2:127106236-127106258 GGCTCCCGGTGGGGCCGGGCTGG + Intronic
938038233 2:128054138-128054160 GGATCCCTATGGTGCCAGGCAGG + Intergenic
938138869 2:128780677-128780699 GGCTCCTTGTGGGGCCATGCAGG + Intergenic
938290892 2:130149856-130149878 GTCTCACTGTGTTGCCAGGCTGG - Intergenic
938529479 2:132169615-132169637 GTATCCCTGTGTCACCAGGCTGG - Intronic
938598355 2:132811884-132811906 GGATCCCTGTGGTGCCAGGCAGG + Intronic
939522437 2:143247375-143247397 AGAGGCCAGTGGTGCCAGGCTGG - Intronic
939607808 2:144274102-144274124 GTCTCGCTGTGTTGCCAGGCTGG - Intronic
939769490 2:146298411-146298433 AGATCTCTGTGGTGCCAGGCAGG - Intergenic
939848999 2:147281514-147281536 TCATCCCTGGGATGCCAGGCTGG + Intergenic
939876343 2:147582769-147582791 TCATCCCTGTGATGCAAGGCTGG - Intergenic
940034794 2:149302196-149302218 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
940172456 2:150843495-150843517 GGATCCCTGTGGTGCCAAACAGG + Intergenic
940315334 2:152322122-152322144 GTATCACTCTGTTGCCAGGCTGG + Intergenic
940401042 2:153248379-153248401 TCATCCCTGGGGTGCAAGGCTGG + Intergenic
940431266 2:153592957-153592979 GGATCTTTGTGATGCCAGGCAGG - Intergenic
940618770 2:156084245-156084267 GGATCCCTATGGTGTCAGGCAGG + Intergenic
940709473 2:157144428-157144450 GGATCCCTGTGGTGCCAGGTAGG + Intergenic
940999380 2:160184796-160184818 TCATCCCTGTGATGCAAGGCTGG + Intronic
941627352 2:167844623-167844645 GGATCCTTGTGGTGCCCAGCAGG - Intergenic
941646446 2:168046334-168046356 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
941973651 2:171380065-171380087 TCATCCCTGTGATGCAAGGCTGG + Intronic
942739756 2:179161630-179161652 GTCTCACTGTGTTGCCAGGCTGG - Intronic
943621236 2:190150329-190150351 GGATCTCTGTGGTGCCAGGCAGG + Intronic
943691874 2:190877855-190877877 GTATCGCTCTGTTGCCAGGCTGG + Intergenic
943769734 2:191703596-191703618 GTGTCCCTGTGGTGCCCTGCTGG - Intergenic
943891330 2:193290349-193290371 GGATCCCTGTAGTGCCAGGTAGG + Intergenic
944097405 2:195984375-195984397 GTATTGCTGTGTTGCCAGGCTGG + Intronic
944232127 2:197406890-197406912 GTCTCACTGTGTTGCCAGGCTGG - Intronic
944349914 2:198714479-198714501 GTCTCACTGTGTTGCCAGGCTGG - Intergenic
944528969 2:200649213-200649235 GGATCCCTGTGTTGTTAGGCAGG + Intronic
944558609 2:200912613-200912635 GGTCTCCTGTGTTGCCAGGCTGG + Intronic
944569034 2:201024291-201024313 GTCTCACTGTGTTGCCAGGCTGG - Intronic
944783929 2:203048350-203048372 GTCTCGCTGTGTTGCCAGGCTGG - Intronic
945075236 2:206032065-206032087 AGATCTCTGTGATGCCAGGCAGG - Intronic
945079912 2:206078385-206078407 GTCTCGCTGTGTTGCCAGGCTGG - Intronic
945132182 2:206584852-206584874 GGATCCCTATGGTGCTAGGCAGG + Intronic
945482659 2:210361279-210361301 AGATCCCTGTGTTACCAGGCAGG + Intergenic
945631367 2:212282194-212282216 ATATCCCTGTGGTGCCTGCCAGG - Intronic
945864449 2:215161242-215161264 GGATCCTTGTGGTGTCAGGCAGG - Intergenic
946033663 2:216724860-216724882 GTTTCACTGTGTTGCCAGGCTGG - Intergenic
946332903 2:219020404-219020426 GTCTCACTGTGTTGCCAGGCTGG + Intronic
946451261 2:219781908-219781930 GTCTCACTCTGGTGCCAGGCTGG + Intergenic
946498967 2:220225519-220225541 GTCTCACTGTGTTGCCAGGCTGG + Intergenic
946934532 2:224706538-224706560 GTCTCGCTGTGTTGCCAGGCTGG + Intergenic
947457163 2:230265554-230265576 GGGTCCCTGTGGTGCCAGGCAGG + Intronic
947702417 2:232245374-232245396 GGATCCCTGTGGAGGAGGGCTGG - Intronic
947828594 2:233123422-233123444 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
948471624 2:238184756-238184778 GTCTCCCTATGTTGCCAGGCTGG + Intronic
948887674 2:240892255-240892277 GGAGCCCTGTGGCCCCAGCCTGG - Intronic
948969458 2:241413910-241413932 GTTTCACTCTGGTGCCAGGCTGG - Intronic
949002515 2:241624455-241624477 GTCTCACTGTGTTGCCAGGCTGG - Intronic
949045733 2:241871949-241871971 GCCTCCCTGGGGTGCCGGGCTGG - Exonic
1168788492 20:559841-559863 GGATTTCTGTAGCGCCAGGCTGG - Intergenic
1169003846 20:2190431-2190453 GTGTCCCTCTGTTGCCAGGCTGG - Intergenic
1169336287 20:4759932-4759954 GGATCCCTGTTATGCCAGGCAGG + Intergenic
1169401250 20:5282520-5282542 GGATCCCTGTGATGCCAGGCAGG - Intergenic
1169465175 20:5831541-5831563 GGAACCATGTGGTGACTGGCCGG + Intronic
1169517554 20:6333647-6333669 GGATCCCTGTTGTGCCAGGCAGG + Intergenic
1170229017 20:14024696-14024718 TCATCCCTGTGATGCAAGGCTGG - Intronic
1170245848 20:14220635-14220657 GGATCCCTGGGGTGCCAGGCAGG + Intronic
1170375907 20:15699867-15699889 GGATCCTTGTGGTGCCAGGCAGG + Intronic
1170721108 20:18879744-18879766 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1170863244 20:20128297-20128319 GGATCCCTGTGGTGCCAGGCAGG + Intronic
1171160393 20:22916862-22916884 GGATCCCTGTGATGACAGGCAGG + Intergenic
1171165516 20:22967073-22967095 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1171242446 20:23582484-23582506 GGATCCCTGTGGTGTCAGGCAGG + Intergenic
1171264290 20:23758206-23758228 TGATCCCTGGGATGCAAGGCTGG + Intergenic
1172251258 20:33480833-33480855 GTCTCGCTGTGTTGCCAGGCTGG + Intergenic
1172749181 20:37237825-37237847 GGCTCCCTGGGGGCCCAGGCAGG - Intronic
1172889343 20:38252959-38252981 GGGTTCCTGTGGTCCCAGGCTGG - Intronic
1173118376 20:40268107-40268129 GGAACTCTGTGGTTCCACGCAGG - Intergenic
1173807764 20:45937202-45937224 GGATCCCTGTGCAGCCGTGCAGG + Intronic
1173854703 20:46242606-46242628 GGATCCCTGCTGGGCCAGGCAGG + Intronic
1174255523 20:49251800-49251822 GGCTCACTATGTTGCCAGGCTGG - Intronic
1174609601 20:51788368-51788390 GTCTCCCTATGTTGCCAGGCTGG + Intronic
1174889379 20:54374249-54374271 GGATACTGGTGGTGGCAGGCAGG + Intergenic
1175106501 20:56618810-56618832 GTCTCACTGTGTTGCCAGGCTGG + Intergenic
1175156097 20:56972722-56972744 GGGACCCTGTGCTGCCAGCCTGG - Intergenic
1176111816 20:63414299-63414321 GGCTCCCTGTGGTGCCCCTCGGG + Intronic
1176258441 20:64166184-64166206 GGAGTCCTGTGGTACCAGCCAGG + Intronic
1176758273 21:10743325-10743347 TCATCCCTGGGGTGCAAGGCTGG + Intergenic
1176767030 21:13030304-13030326 GTATCCCTGTGTCACCAGGCTGG + Intergenic
1176928784 21:14782730-14782752 TCATCCCTGTGATGCAAGGCTGG + Intergenic
1177122502 21:17155558-17155580 TCATCCCTGTGATGCAAGGCTGG + Intergenic
1177195681 21:17901304-17901326 GGATCTCTGTGGTCCCAGGCAGG + Intronic
1177404739 21:20650848-20650870 GTCTCGCTGTGTTGCCAGGCTGG + Intergenic
1177956236 21:27602736-27602758 TCATCCCTGTGATGCAAGGCTGG - Intergenic
1177995437 21:28090402-28090424 GGATCTTTGTGTTGCCAGGCAGG + Intergenic
1178059286 21:28834531-28834553 GGATCCCTGTGGTGACAGGCAGG - Intergenic
1178264947 21:31134036-31134058 GTCTCGCTGTGTTGCCAGGCTGG - Intronic
1178455091 21:32741752-32741774 GAATCCCTGTTGCCCCAGGCGGG - Intronic
1178458594 21:32779777-32779799 GTCTCGCTGTGTTGCCAGGCTGG + Intergenic
1178560608 21:33635949-33635971 GCCTCGCTGTGTTGCCAGGCTGG - Intronic
1178671378 21:34594520-34594542 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1178801595 21:35800947-35800969 GGATCTCTGTGGTGCCAGGCAGG - Intronic
1180431600 22:15256672-15256694 GTATCCCTGTGTCACCAGGCTGG + Intergenic
1181371071 22:22417271-22417293 GTATTCCTGTGGTGCCAGAAAGG - Intergenic
1181639141 22:24187697-24187719 GGCTGCCTCTTGTGCCAGGCTGG - Exonic
1181696351 22:24594708-24594730 GGAAACCTGTGGTGCCAAGGTGG - Intronic
1182298232 22:29322885-29322907 GCCTCCCTTTGTTGCCAGGCTGG - Intergenic
1182986413 22:34722010-34722032 GTCTCACTGTGTTGCCAGGCTGG - Intergenic
1183048538 22:35241536-35241558 GGATCCCGGTGGTGCCAGGCAGG + Intergenic
1183106727 22:35620297-35620319 GGCTCGCTCTGTTGCCAGGCTGG - Intronic
1183211188 22:36452432-36452454 GCAACCCTGAGGAGCCAGGCAGG + Intergenic
1183415707 22:37680774-37680796 GGATCCCTGAGGAGCCCCGCAGG - Intergenic
1183518905 22:38284885-38284907 GTATCGCTCTGCTGCCAGGCTGG + Intergenic
1183527669 22:38333566-38333588 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1183562508 22:38586696-38586718 GTATCGCTCTGTTGCCAGGCTGG + Intronic
1183575502 22:38686110-38686132 AGCTCCCTGTGGTGCCAAGCAGG + Exonic
1183582204 22:38732724-38732746 GTCTCGCTGTGTTGCCAGGCTGG + Exonic
1183741095 22:39669048-39669070 GGGTCCCTCTGGGGCTAGGCGGG + Intronic
1184446422 22:44550054-44550076 GTATCGCTCTGTTGCCAGGCTGG + Intergenic
1184876809 22:47281491-47281513 GGGTCCATGCAGTGCCAGGCAGG - Intergenic
1184937525 22:47735917-47735939 CTATCCCTGTGCTCCCAGGCAGG - Intergenic
1185020480 22:48371799-48371821 GGGTCCCTGTGTGGCCAGGTGGG - Intergenic
1185116956 22:48943261-48943283 GGGATGCTGTGGTGCCAGGCTGG - Intergenic
1185408427 22:50670892-50670914 GGAGCAGTGTGGGGCCAGGCAGG + Intergenic
949280527 3:2341610-2341632 GGCACCCTGTGGTGCCACCCTGG + Intronic
949469503 3:4379810-4379832 GGCTCGCTCTGTTGCCAGGCTGG - Intronic
949604129 3:5634807-5634829 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
949814162 3:8040651-8040673 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
949974555 3:9444030-9444052 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
950509131 3:13415196-13415218 GTCTCGCTGTGTTGCCAGGCTGG - Intronic
950592477 3:13948249-13948271 GGATCCCTGTGGTGTCAGGCAGG + Intronic
950603633 3:14058236-14058258 GGATCCCTGTGGTGCCAGGCAGG + Intronic
950739251 3:15036519-15036541 GTCTCTCTGTGTTGCCAGGCTGG + Intronic
950779936 3:15382634-15382656 GTCTCCCTCTGTTGCCAGGCTGG - Exonic
950869424 3:16215878-16215900 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
951196519 3:19829119-19829141 GGAGCCCTTTGGTACCAAGCAGG + Intergenic
951450960 3:22837418-22837440 GTCTCGCTGTGTTGCCAGGCTGG - Intergenic
951618102 3:24570556-24570578 TCATCCCTGGGGTGCAAGGCTGG + Intergenic
952097280 3:29968456-29968478 GGATCCCTGTGGTGCCAGGCAGG + Intronic
952334281 3:32391732-32391754 GGATCCCTCCGGTGACTGGCCGG - Exonic
952770322 3:36993796-36993818 GGTTCCCTGACGTGCCAGTCAGG + Intronic
952776913 3:37055534-37055556 GTATCGCTCTGTTGCCAGGCTGG - Intronic
952841013 3:37645371-37645393 GTTTCCCCGTGTTGCCAGGCTGG - Intronic
953084611 3:39654414-39654436 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
953359658 3:42284249-42284271 TCATCCCTGGGGTGCAAGGCTGG - Intergenic
953568993 3:44056921-44056943 GGATGCCTGTGGGGCCACACAGG - Intergenic
953619455 3:44520618-44520640 GTATCACTCTGTTGCCAGGCTGG + Intergenic
953724039 3:45382004-45382026 GGATCCCTGTGGTGCTAGGCAGG + Intergenic
953984310 3:47429542-47429564 GTATCACTATGTTGCCAGGCTGG + Intronic
954026751 3:47789157-47789179 GTCTCCCTTTGTTGCCAGGCTGG - Intergenic
954478131 3:50768489-50768511 TCATCCCTGGGGTGCAAGGCTGG + Intronic
954572272 3:51651603-51651625 TCATCCCTGTGATGCAAGGCTGG + Intronic
955175731 3:56611692-56611714 GGATCCCTGTGGTGCCAGGCAGG + Intronic
955461706 3:59190115-59190137 GGATCCTTCTGGTGCCAGAAAGG + Intergenic
955682594 3:61518018-61518040 GGCTTCCTATGTTGCCAGGCGGG - Intergenic
956209856 3:66791619-66791641 GTATCTCTGTGGTGGCATGCAGG - Intergenic
956243766 3:67158088-67158110 GCATCCCTGGGATGCAAGGCTGG + Intergenic
956650611 3:71501322-71501344 GTCTCGCTGTGTTGCCAGGCTGG + Intronic
956950187 3:74273692-74273714 GGATCCCTGTGATGCCAGGCAGG - Intronic
956995776 3:74824947-74824969 GGATTCCTGTGGTGCCAGGCAGG + Intergenic
957016485 3:75069915-75069937 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
957427825 3:80063494-80063516 GAATCTCTGTGGTGCCAGGCAGG - Intergenic
958011567 3:87886157-87886179 TCATCCCTGTGATGCAAGGCTGG + Intergenic
958090777 3:88873514-88873536 TCATCCCTGGGATGCCAGGCTGG + Intergenic
958109485 3:89121725-89121747 GTCTCCCTGTGTCGCCAGGCTGG - Intronic
958508532 3:95014517-95014539 TCATCCCTGGGATGCCAGGCTGG - Intergenic
958647197 3:96888196-96888218 GAATCCCTGTGGTGCCAGGCAGG + Intronic
958805402 3:98803869-98803891 TCATCCCTGGGATGCCAGGCTGG - Intronic
959046904 3:101484756-101484778 GGATTCCTGTGGTGCCAGGCAGG - Intronic
959275309 3:104270090-104270112 GGAACCCTGTTGTGCCAGATAGG + Intergenic
959279699 3:104323008-104323030 GGCTCTCTGTGGTGCCAGGCAGG - Intergenic
959335464 3:105058957-105058979 GTCTCGCTGTGTTGCCAGGCTGG - Intergenic
959353745 3:105299902-105299924 TCATCCCTGGGATGCCAGGCTGG + Intergenic
959436073 3:106316926-106316948 GGATTCCTGTGGTGCCAGGCAGG - Intergenic
959757048 3:109911273-109911295 GGATCCCTGTGGTGCCAGGAAGG + Intergenic
959997181 3:112693004-112693026 GGATCCCTGTGATGCCAGGTAGG - Intergenic
960016084 3:112889569-112889591 GGATCCCTGTGGTGCTAGGCAGG + Intergenic
960090761 3:113635843-113635865 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
960512994 3:118572421-118572443 GGATTCCTTTGGTGCCAGACAGG + Intergenic
960524689 3:118695875-118695897 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
961013846 3:123452232-123452254 GTATTGCTGTGTTGCCAGGCTGG - Intergenic
961299520 3:125913723-125913745 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
961628812 3:128281671-128281693 GGATCCCAGAGGTGGCATGCTGG - Intronic
961672118 3:128541072-128541094 GCATCCATGTGGAGCCATGCTGG + Intergenic
961888972 3:130114320-130114342 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
962066082 3:131981697-131981719 GGATCACTGTGGTGCCAGGCAGG + Intronic
962401934 3:135067796-135067818 GGATCCCTGTGGTGCCAGGCAGG + Intronic
964049070 3:152369334-152369356 TCATCCCTGGGGTGCTAGGCTGG - Intronic
964065148 3:152568898-152568920 GTCTCCCTATGTTGCCAGGCTGG - Intergenic
964160560 3:153640616-153640638 TGATCCCTGGGGTGCCAGGCAGG - Intergenic
964552506 3:157900494-157900516 TGATCCCTGGGATGCAAGGCTGG + Intergenic
964601346 3:158503990-158504012 GGATTCCTGTGGTGTCAGGCAGG + Intronic
964917569 3:161854937-161854959 GGATCCCTGTGGTTCCAGGCAGG + Intergenic
965052778 3:163671720-163671742 GTATCCTTGTGGTGCCAGGCAGG + Intergenic
965216968 3:165875307-165875329 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
965817680 3:172653784-172653806 GTCTCCCTTTGTTGCCAGGCTGG + Intronic
965945665 3:174238390-174238412 GTCTCCCTCTGTTGCCAGGCTGG + Intronic
966020514 3:175203253-175203275 GGATCCCTGTGATTCCAGGCAGG + Intronic
966117765 3:176485586-176485608 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
966295797 3:178421242-178421264 GGTACACTGTGGTGCCAGTCTGG + Intronic
966686721 3:182703586-182703608 GGATCCCTGTGAGGCCAGGAAGG + Intergenic
966793974 3:183697034-183697056 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
966992093 3:185242973-185242995 GGATCTCTGTGATGCTAGGCAGG + Intronic
967208996 3:187150163-187150185 GGTTCCCTGTGGTGCCAGGCAGG - Intronic
967257605 3:187609444-187609466 GGATCTCTGTGGTGCCAGGCAGG + Intergenic
967399853 3:189049015-189049037 GGATCGCTGTGGTGCCATGCAGG - Intronic
967408691 3:189145330-189145352 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
967886135 3:194334846-194334868 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
968421488 4:488798-488820 GTATCGCTCTGTTGCCAGGCCGG - Intronic
968463468 4:737543-737565 TGATCCCTGAGGTCCCAGCCTGG + Intronic
968865152 4:3204770-3204792 GTTTCTCTGTGTTGCCAGGCTGG - Intronic
968998116 4:3958242-3958264 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
969381219 4:6799722-6799744 GGCTCGCTCTGTTGCCAGGCTGG + Intronic
969755888 4:9150418-9150440 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
969777661 4:9370114-9370136 TCATCCCTTTGGTGCAAGGCTGG + Intergenic
969781559 4:9408562-9408584 GGATGCCTGTGGTGCCAGGCAGG - Intergenic
969816213 4:9689576-9689598 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
970042745 4:11814489-11814511 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
970346666 4:15159208-15159230 GGATCCCTGTGGTGTCAGGCAGG + Intergenic
970368627 4:15386142-15386164 AGAACCCTGTGGAGCCGGGCTGG - Intronic
970549391 4:17164017-17164039 GGATTCCTGTGAAGCCAGGTAGG + Intergenic
970658712 4:18260651-18260673 AGATCCCTGTGGTGTCAGGCAGG + Intergenic
970996002 4:22268501-22268523 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
971183216 4:24349915-24349937 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
971901081 4:32658624-32658646 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
972061226 4:34876108-34876130 TCATCCCTGTGATGCCAGGCTGG + Intergenic
972444288 4:39128765-39128787 GTCTCCCTGTGTTCCCAGGCTGG - Intergenic
972528431 4:39938938-39938960 GTCTCGCTGTGTTGCCAGGCTGG - Intronic
972567654 4:40283798-40283820 GTATCGCTCTGTTGCCAGGCTGG + Intergenic
972972704 4:44596885-44596907 TCATCCCTGGGGTGCAAGGCTGG + Intergenic
973179682 4:47252130-47252152 GGATCCCTGTGGTGCCAGGCAGG + Intronic
973271182 4:48264664-48264686 GTCTCCCTGTGTTGCCAGGCTGG + Intronic
973312177 4:48721464-48721486 GTCTCCCTATGTTGCCAGGCTGG - Intronic
973676340 4:53267609-53267631 GTCTCTCTGTGTTGCCAGGCTGG + Intronic
973782314 4:54300310-54300332 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
973786999 4:54341726-54341748 GGATCCCCGTGGTGCCAGTCAGG - Intergenic
974114573 4:57564643-57564665 TCATCCCTGTGATGCAAGGCTGG - Intergenic
974143840 4:57921887-57921909 TCATCCCTGTGATGCAAGGCTGG + Intergenic
974474529 4:62362010-62362032 GGATCCCCATGGTGCCAGGCAGG + Intergenic
974612765 4:64238099-64238121 TCATCCCTGTGATGCAAGGCTGG - Intergenic
974658935 4:64861468-64861490 TCATCCCTGGGGTGCAAGGCTGG - Intergenic
974949327 4:68569492-68569514 GGATCACTGTGGTGCCAGGCAGG - Intronic
974958363 4:68671686-68671708 AGATCCCTGTGATGCCAGGCAGG - Intergenic
975033727 4:69656752-69656774 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
975116524 4:70687248-70687270 GGCTCGCTCTGTTGCCAGGCTGG - Intergenic
975247808 4:72140583-72140605 TCATCCCTGTGATGCAAGGCTGG - Intronic
975517180 4:75259866-75259888 GGATCCCTGTGGTGTCAGGCAGG - Intergenic
976038787 4:80857730-80857752 TCATCCCTGGGGTGCAAGGCTGG - Intronic
976156910 4:82155777-82155799 TCATCCCTGGGATGCCAGGCTGG + Intergenic
976523976 4:86064932-86064954 GTATCCCTCTGTTGCCAGGCTGG + Intronic
976573235 4:86637496-86637518 TCATCCCTGGGGTGCAAGGCTGG + Intronic
976856393 4:89609802-89609824 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
977020087 4:91747356-91747378 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
977563967 4:98562629-98562651 GTCTCGCTGTGTTGCCAGGCTGG - Intronic
977626591 4:99194919-99194941 GTCTCACTGTGTTGCCAGGCTGG + Intergenic
977733137 4:100379523-100379545 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
977746706 4:100558269-100558291 GGATCCCTGTGGTGCCAGGCAGG - Intronic
977754586 4:100652612-100652634 GTCTCGCTGTGTTGCCAGGCTGG + Intronic
977852565 4:101847974-101847996 GGATCCCTTTGGCGCCAGCGAGG + Intronic
977904605 4:102461059-102461081 GGATGCCTGTGGTGCCAGGCAGG + Intergenic
978023766 4:103847316-103847338 TCATCCCTGTGATGCAAGGCTGG + Intergenic
978598416 4:110402995-110403017 GTCTCCCTCTGCTGCCAGGCTGG + Intronic
978670609 4:111244005-111244027 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
978681107 4:111381725-111381747 TCATCCCTGTGATGCAAGGCTGG + Intergenic
978699426 4:111625048-111625070 GCATCCCTGGGATGCAAGGCTGG - Intergenic
978726780 4:111978080-111978102 GGAGCCCTGTGGTGTCAGGCAGG + Intergenic
978775282 4:112499579-112499601 TCATCCCTGGGGTGCAAGGCTGG - Intergenic
978999751 4:115201272-115201294 GGATCCGTCTGATGCCAAGCAGG + Intergenic
979253777 4:118591627-118591649 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
979498513 4:121411778-121411800 GGATCCCTGTGATGCCAGCCAGG + Intergenic
979704764 4:123708883-123708905 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
979784737 4:124701719-124701741 GTCTCACTGTGTTGCCAGGCTGG + Intronic
979794984 4:124834778-124834800 GGATCCTGGTGGTACCAGGCAGG + Intergenic
979995387 4:127425745-127425767 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
980035877 4:127881634-127881656 GGATACCTGCGCTTCCAGGCTGG - Intronic
980139614 4:128899341-128899363 TCATCCCTGGGATGCCAGGCTGG + Intronic
980251367 4:130319981-130320003 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
980523453 4:133960447-133960469 GGATCCTTGTGATGCCAGGCAGG - Intergenic
980732851 4:136845085-136845107 TCATCCCTGTGATGCAAGGCTGG - Intergenic
981337131 4:143580731-143580753 AGATCCCAGTGGTAGCAGGCAGG + Intronic
981346550 4:143683549-143683571 GGATCCCTGTGATGCCAGGCAGG - Intronic
981401052 4:144314012-144314034 GGATCCTTGTGGTGCCAGGCAGG + Intergenic
981559646 4:146033113-146033135 GGATCCCTATGGTACCAGAGAGG - Intergenic
981760882 4:148193092-148193114 GGATCCCTGTGGTGTCAGGTAGG + Intronic
981810049 4:148763556-148763578 TCATCCCTGGGGTGCAAGGCTGG + Intergenic
982122447 4:152156215-152156237 GGGTGCCTGTGGTTCAAGGCAGG - Intergenic
982152248 4:152473042-152473064 GTCTCCCTATGTTGCCAGGCTGG - Intronic
982190018 4:152844030-152844052 GGATCCCTGTGGTACCAGGCAGG + Intronic
982218859 4:153107532-153107554 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
982312234 4:153997801-153997823 GGGTCCCTGTGGTACCAGGCAGG + Intergenic
982378655 4:154723979-154724001 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
982630461 4:157823900-157823922 GGATCCCTATGGTGCCAGGCAGG - Intergenic
982680238 4:158419493-158419515 GGATCCCTGTGGTGCCAGGTAGG + Intronic
983227664 4:165100187-165100209 GTCTCGCTGTGTTGCCAGGCTGG + Intronic
983449697 4:167895006-167895028 GGATCCCTGTGGTGCCAACCAGG - Intergenic
983978427 4:173965256-173965278 TCATCCCTGTGATGCAAGGCTGG - Intergenic
984110115 4:175602344-175602366 TCATCCCTGGGGTGCAAGGCTGG - Intergenic
984266788 4:177505856-177505878 GGTTCCCTGTGGTGCCAGGCAGG + Intergenic
984323484 4:178223940-178223962 GGAGCCCTGTGGTGCCAGGCAGG - Intergenic
984356505 4:178666484-178666506 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
984519663 4:180786616-180786638 GTATCACTCTGTTGCCAGGCTGG - Intergenic
984527638 4:180875860-180875882 GGATTCCTGGGGTGCCAGGCAGG + Intergenic
984659605 4:182359043-182359065 TCATCCCTGGGGTGCAAGGCTGG - Intronic
985686767 5:1285597-1285619 GTCTCGCTGTGTTGCCAGGCTGG + Intronic
986728426 5:10617542-10617564 AGACCACTGTGGGGCCAGGCAGG - Intronic
987983305 5:25116058-25116080 TCATCCCTGGGATGCCAGGCTGG - Intergenic
988307751 5:29515247-29515269 GAATCGCTCTGTTGCCAGGCTGG - Intergenic
988712674 5:33794035-33794057 GAATCCCTGTGGTGCCCAGCGGG + Intronic
988820520 5:34879964-34879986 GTATCACTCTGTTGCCAGGCTGG - Intronic
988902137 5:35745197-35745219 GGAACCCTGTGATGCCCAGCAGG - Intronic
989121743 5:38011186-38011208 GTCTCGCTGTGTTGCCAGGCTGG + Intergenic
989284601 5:39684841-39684863 GCATCCCTGGGATGCAAGGCTGG - Intergenic
989543624 5:42646844-42646866 GAATCACTGTGGTACCAGACTGG + Intronic
990212677 5:53497445-53497467 TCATCCCTGTGATGCAAGGCTGG + Intergenic
990712910 5:58604925-58604947 GGATCCCTGTGGTGCCAGGCAGG + Intronic
991117331 5:62969797-62969819 GAGTCCCTGTGGTGCCAGGCAGG - Intergenic
991265335 5:64711362-64711384 TGATCCCTGGGATGCAAGGCTGG - Intronic
991923789 5:71683955-71683977 GGATCCCTGTGATGCCAGGCAGG - Intergenic
992032055 5:72731406-72731428 TCATCCCTGGGGTGCAAGGCTGG + Intergenic
992038505 5:72805494-72805516 TCATCCCTGGGGTGCAAGGCTGG - Intergenic
992725980 5:79607761-79607783 GTCTCACTGTGTTGCCAGGCTGG + Intergenic
992740262 5:79766629-79766651 TGATCCCTGGGATGCAAGGCTGG - Intronic
992756825 5:79914767-79914789 TTATCCCTGGGATGCCAGGCTGG + Intergenic
992976245 5:82123731-82123753 GTCTCCCTGTGTTGCCAAGCTGG - Intronic
993012979 5:82504910-82504932 TCATCCCTGGGATGCCAGGCTGG - Intergenic
993612939 5:90076900-90076922 ACATCCCTGGGGTGCAAGGCTGG + Intergenic
993717276 5:91288096-91288118 GGTACCTTGTGGAGCCAGGCAGG + Intergenic
993889306 5:93454259-93454281 GTTTCCCTCTGTTGCCAGGCTGG - Intergenic
993916967 5:93755757-93755779 GGATCCCTGTGATGCCAGGCAGG - Intronic
993964691 5:94346698-94346720 GGATCCCTGTGGTGCCAGGCAGG - Intronic
994048870 5:95339997-95340019 GCATCCCTGGGATGCAAGGCTGG + Intergenic
994444825 5:99859598-99859620 TCATCCCTGTGATGCAAGGCTGG + Intergenic
994527618 5:100926544-100926566 TGATCCCTGTGCTTCGAGGCTGG - Intergenic
994568464 5:101483366-101483388 GGATCCCTATGGTGCCAGGCAGG + Intergenic
994665268 5:102697248-102697270 GCACCCCTGTGTTTCCAGGCTGG + Intergenic
994826100 5:104714630-104714652 GTTTCTCTGTGTTGCCAGGCTGG + Intergenic
994860438 5:105185848-105185870 TCATCCCTGTGTTGCAAGGCTGG - Intergenic
994875224 5:105413530-105413552 GGATCCCTGTTGTGCCAGGCAGG - Intergenic
994883660 5:105529700-105529722 GGGTACCTGTGATGCCAGGCAGG + Intergenic
995211243 5:109541811-109541833 TCATCCCTGTGATGCAAGGCTGG + Intergenic
995317982 5:110797765-110797787 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
995473102 5:112523734-112523756 GGATCCCTGTGGTGTCATGCAGG + Intergenic
995817723 5:116191171-116191193 GGATCCCTGTGGTGTCATGCAGG - Intronic
995949103 5:117688302-117688324 GGCTCACTCTGTTGCCAGGCTGG + Intergenic
996010666 5:118478723-118478745 GGATACCTGTGGTGCCAGGCAGG - Intergenic
996124237 5:119706560-119706582 GGATCCCTGTATTGCTAGGCAGG + Intergenic
996289024 5:121829462-121829484 GGATCCCTGTGTTGCCAGGCAGG + Intergenic
996295616 5:121912126-121912148 GATTAACTGTGGTGCCAGGCTGG + Intergenic
996325344 5:122267091-122267113 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
996426285 5:123316855-123316877 GCATCCCTGGGATGCAAGGCTGG - Intergenic
996504877 5:124257636-124257658 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
997051921 5:130392665-130392687 TCATCCCTGGGATGCCAGGCTGG + Intergenic
997115865 5:131124976-131124998 GTATCCCTGGGATGCAAGGCTGG + Intergenic
997328886 5:133044816-133044838 GTCTCACTGTGTTGCCAGGCTGG - Intergenic
997348228 5:133209549-133209571 GGATCCCTGATGGGCAAGGCTGG + Intronic
997488436 5:134251726-134251748 GTCTCGCTGTGTTGCCAGGCTGG - Intergenic
997527103 5:134560494-134560516 GTGTCCCTGTGGTCACAGGCAGG + Intronic
997787077 5:136723235-136723257 GTCTCACTGTGTTGCCAGGCTGG + Intergenic
997985863 5:138501192-138501214 GTCTCTCTGTGTTGCCAGGCTGG - Intergenic
998639699 5:143995730-143995752 GTCTCGCTGTGTTGCCAGGCTGG + Intergenic
998940759 5:147280138-147280160 GGATCCCTGTGGTGCCAGGCAGG - Intronic
999287238 5:150401503-150401525 AGATGCCTGCGGGGCCAGGCAGG - Intergenic
999422453 5:151456803-151456825 GGATCTCTCTGGTGCCAGACTGG + Intronic
999484961 5:151985804-151985826 GGATTCCTGTGGTGTCAGGCAGG + Intergenic
999489485 5:152035628-152035650 TCATCCCTGTGATGCAAGGCTGG - Intergenic
999818419 5:155200553-155200575 GGATCCCTGTGGTGCTGGGCAGG - Intergenic
999917961 5:156284489-156284511 TCATCCCTGGGGTGCAAGGCTGG + Intronic
1000758000 5:165184587-165184609 GGATCCCTGTGGTCCCAGGCAGG + Intergenic
1000762191 5:165239984-165240006 GTATCACTCTGTTGCCAGGCTGG - Intergenic
1000779570 5:165464578-165464600 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1001054032 5:168434774-168434796 GGCTCCCTGTGATGCCATGCAGG - Intronic
1001839358 5:174861265-174861287 TGATCCCTGGGATGCAAGGCTGG - Intergenic
1002063306 5:176639404-176639426 GGATGCCTGTAGCGCCAGGGGGG + Intronic
1002161107 5:177314569-177314591 GGATCCCTGCTGGTCCAGGCTGG - Intergenic
1002599519 5:180346361-180346383 GGACCCATCTGGTGCTAGGCGGG - Intronic
1002813757 6:659736-659758 GGATCCCTGTGGTGCCAGGCAGG - Intronic
1002882569 6:1265881-1265903 GGGTCCCAGTGGTCCCAGCCTGG + Intergenic
1003029519 6:2589697-2589719 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1003063065 6:2877257-2877279 GGATCCCTGTGGTGCCAGACAGG - Intergenic
1003450794 6:6229971-6229993 GGATCTCTGTGGTGCCAGGCAGG - Intronic
1003509683 6:6769135-6769157 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
1003581850 6:7347470-7347492 GGATCCCTGTGGGGCCAGGCAGG - Intronic
1003712007 6:8602814-8602836 GGATGCCTGTGGTTCCAGGCAGG + Intergenic
1003870165 6:10396154-10396176 GGAGCCCTGTGGTGATAGGAAGG + Intronic
1004725042 6:18303241-18303263 GCATCCCTGTTGAGCCAGGACGG + Intergenic
1005072410 6:21874201-21874223 GGATCTCTGTGATGCCAGGCAGG - Intergenic
1005191511 6:23228933-23228955 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1006050589 6:31339974-31339996 GTCTCGCTGTGCTGCCAGGCTGG - Intronic
1006083243 6:31579662-31579684 CCAGCCCTGGGGTGCCAGGCAGG + Intergenic
1006347607 6:33495793-33495815 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
1006451087 6:34106087-34106109 GGACCCCTGTGGTGTCACTCAGG - Intronic
1006587220 6:35123680-35123702 GTCTCGCTGTGTTGCCAGGCTGG + Intronic
1006704281 6:36004269-36004291 GTGTCACTGTGTTGCCAGGCTGG + Intronic
1006796977 6:36738022-36738044 GGAGGCCTGTGGGGCCTGGCGGG + Intergenic
1006947121 6:37791977-37791999 AGAACACTGCGGTGCCAGGCAGG + Intergenic
1007528502 6:42519296-42519318 GTCTCACTGTGTTGCCAGGCTGG + Intergenic
1007653783 6:43439611-43439633 GTCTCACTGTGTTGCCAGGCTGG + Intronic
1007896136 6:45361075-45361097 GGGTCTCTATGTTGCCAGGCTGG - Intronic
1008121543 6:47622452-47622474 GGATCCCTGTGGTGCCAGGCAGG + Intronic
1008607247 6:53152181-53152203 GTCTCACTGTGTTGCCAGGCTGG + Intergenic
1008834276 6:55807387-55807409 TGATCCCTGGGATGCAAGGCTGG - Intronic
1008962961 6:57285439-57285461 TCATCCCTGTGATGCAAGGCTGG + Intergenic
1009188681 6:60603633-60603655 TGATCCCTGGGATGCAAGGCTGG + Intergenic
1009384211 6:63069092-63069114 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1009399198 6:63234105-63234127 TTATCCCTGGGGTGCAAGGCTGG - Intergenic
1009453084 6:63824783-63824805 GGATCCCTGTGGTGCCAGGCAGG - Intronic
1009499538 6:64393448-64393470 TGATCCCTGGGATGCAAGGCTGG + Intronic
1009968691 6:70604221-70604243 GGATCCCTGTGGTGCCAGGTGGG - Intergenic
1010009038 6:71028655-71028677 GGATCCCTGTGGTGCTATGCAGG + Intergenic
1010513666 6:76747976-76747998 TCATCCCTGGGGTGCAAGGCTGG - Intergenic
1010679241 6:78780837-78780859 GGATTCCTGTTGTGCTAGGCAGG - Intergenic
1011168546 6:84479039-84479061 GGATCCCTGTGATGCCAGGCAGG - Intergenic
1011233246 6:85187503-85187525 AGATCCATGTGGTACCAGGCAGG - Intergenic
1011321452 6:86098047-86098069 GCATCCCTGGGATGCAAGGCTGG + Intergenic
1011329148 6:86184299-86184321 GGGACCCCATGGTGCCAGGCAGG + Intergenic
1011513257 6:88124856-88124878 GTCTCACTGTGTTGCCAGGCTGG - Intergenic
1011789832 6:90885932-90885954 GGATCTCTATGGTGTCAAGCAGG + Intergenic
1011893394 6:92194513-92194535 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1011914907 6:92491417-92491439 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
1012155882 6:95819511-95819533 GGATCCTTGTGGTGCCAGGCAGG - Intergenic
1012269741 6:97194085-97194107 GTCTCGCTCTGGTGCCAGGCTGG + Intronic
1012793658 6:103733921-103733943 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1012922599 6:105235015-105235037 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1013260432 6:108436172-108436194 GTCTCGCTGTGTTGCCAGGCTGG + Intronic
1013331956 6:109111848-109111870 TCATCCCTGTGATGCAAGGCTGG - Intronic
1013541884 6:111118649-111118671 GGCTCACTCTGTTGCCAGGCTGG - Intronic
1013814800 6:114084859-114084881 GTCTCCCTCTGCTGCCAGGCTGG + Intronic
1013852718 6:114535044-114535066 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1013877788 6:114855496-114855518 GGATCCCTGTGGTGCCTGGCAGG - Intergenic
1013901077 6:115156618-115156640 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1013906492 6:115225879-115225901 TTATCCCTGTGATGCAAGGCCGG + Intergenic
1014146183 6:118000266-118000288 TCATCCCTGTGATGCAAGGCTGG + Intronic
1014216870 6:118761036-118761058 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
1014234832 6:118941719-118941741 GTCTCACTGTGTTGCCAGGCTGG - Intergenic
1014336756 6:120147086-120147108 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1014603811 6:123448115-123448137 GAATCCCTGTGGTGCCAGGCAGG - Intronic
1014613937 6:123579465-123579487 TCATCCCTGTGATGCCAGGTTGG - Intronic
1014738687 6:125123982-125124004 GGGTCCCTGTGGTGCCAGGCAGG - Intronic
1015362451 6:132355261-132355283 AGATCCCTGTGGTACCAAGCAGG + Intronic
1015501373 6:133937051-133937073 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1015849877 6:137560577-137560599 GGATCCCTGTGAGGCCAGGCAGG + Intergenic
1017190570 6:151648803-151648825 GGATCCTTGTGATGCCAGGCAGG + Intergenic
1017317898 6:153053589-153053611 GGCTCACTGTGTTACCAGGCTGG - Intronic
1017392210 6:153953221-153953243 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
1017500669 6:155020021-155020043 GTATCACTCTGTTGCCAGGCTGG - Intronic
1017831799 6:158137126-158137148 GCCTCGCTGTGTTGCCAGGCTGG - Intronic
1018009314 6:159655335-159655357 GGTGCCTGGTGGTGCCAGGCAGG - Intergenic
1018019917 6:159752031-159752053 GTCTCACTGTGTTGCCAGGCTGG - Intronic
1018115031 6:160574513-160574535 GGATCTCTGTGGTGCCAGGCAGG + Intronic
1018552909 6:165018765-165018787 TCATCCCTGGGGTGCAAGGCTGG - Intergenic
1019213117 6:170422164-170422186 GGTTCCCTGGGGTGACAGGAAGG + Intergenic
1019462872 7:1170524-1170546 GTGTCCCTCTGTTGCCAGGCTGG + Intergenic
1019606070 7:1910865-1910887 GGCTCCCTGTGACGCCAGTCAGG + Intronic
1019668162 7:2263087-2263109 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1019823204 7:3261642-3261664 GTCTCGCTGTGTTGCCAGGCTGG + Intergenic
1020227449 7:6291392-6291414 GTCTCGCTGTGTTGCCAGGCTGG + Intergenic
1020634825 7:10684568-10684590 GGATCCCTGTGAGGCCAGGTAGG - Intergenic
1020753058 7:12167207-12167229 GCATCCCTGAGATGCAAGGCTGG - Intergenic
1020785674 7:12570331-12570353 GGATCTCAGTTGTGCCTGGCAGG - Intergenic
1020860708 7:13489134-13489156 GGATCCCTGTGGTGCCAGACAGG - Intergenic
1020873931 7:13670394-13670416 TCATCCCTGTGATGCAAGGCTGG - Intergenic
1020923728 7:14297371-14297393 GCATCCCTGGGATGCAAGGCTGG + Intronic
1021703755 7:23346620-23346642 GTCTCCCTCTGGCGCCAGGCAGG + Intronic
1021844632 7:24752556-24752578 GGCTCCCTGGGGTGTCATGCTGG + Intronic
1022500819 7:30881478-30881500 GGAGCCCTGGGGAGCCAGGAGGG - Intronic
1023429337 7:40073619-40073641 GCCTCGCTGTGTTGCCAGGCTGG + Intronic
1023438123 7:40159398-40159420 GTCTCGCTGTGTTGCCAGGCTGG + Intronic
1023701174 7:42893148-42893170 GGATCGCTGTGGTGCCAGGCAGG - Intergenic
1024745450 7:52400397-52400419 GGATCCCTGTGGTGCTAGGCAGG + Intergenic
1025202644 7:56971692-56971714 GCCTCACTGTGTTGCCAGGCTGG + Intergenic
1025223207 7:57133834-57133856 GAGTCCCTCTGTTGCCAGGCTGG - Intronic
1025669305 7:63605234-63605256 GCCTCACTGTGTTGCCAGGCTGG - Intergenic
1025772716 7:64528181-64528203 AGATCCTTGTGATGCCAGGAAGG - Intronic
1025834084 7:65079542-65079564 GTCTCCCTATGTTGCCAGGCTGG - Intergenic
1025903854 7:65769059-65769081 GTCTCCCTATGTTGCCAGGCTGG - Intergenic
1026035078 7:66824848-66824870 GCTTCACTGTGTTGCCAGGCTGG - Intergenic
1026084463 7:67251746-67251768 GTCTCGCTGTGTTGCCAGGCTGG + Intergenic
1026720146 7:72823588-72823610 GTCTCCCTGTGTCGCCAGGCTGG - Intronic
1026737243 7:72956787-72956809 GGATACTTGTGATGCCATGCAGG - Intergenic
1026898074 7:74021999-74022021 TGATCCCTGTGGCGCCAGGCGGG - Intergenic
1027106489 7:75408281-75408303 GGATACTTGTGATGCCATGCAGG + Intronic
1027338706 7:77182574-77182596 GTCTCACTGTGCTGCCAGGCTGG - Intronic
1027350538 7:77306801-77306823 GGATCCCTGTGGTGCCAGGCAGG + Intronic
1027756862 7:82224551-82224573 GTCTCGCTGTGTTGCCAGGCTGG - Intronic
1028919184 7:96292096-96292118 TCATCCCTGGGGTGCAAGGCTGG + Intronic
1028993660 7:97076421-97076443 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1029280952 7:99435149-99435171 GGACCCCTGTAGAGCCAGGTGGG - Exonic
1029281227 7:99437059-99437081 GTCTCCCTATGTTGCCAGGCTGG + Intronic
1029884275 7:103850475-103850497 GGATCCCTGTGGTGCCAGGCAGG - Intronic
1029970857 7:104787740-104787762 GTCTTCCTGTGTTGCCAGGCTGG + Intronic
1030240509 7:107318055-107318077 GGTTCGCTCTGTTGCCAGGCTGG + Intronic
1030325125 7:108211264-108211286 GGATCTCTGTGGTGCCAGGCAGG - Intronic
1030935903 7:115584927-115584949 GGATCCCTGGGATGCCAGGCAGG - Intergenic
1031462134 7:122064564-122064586 GTTTCACTGTGTTGCCAGGCTGG + Intergenic
1031761331 7:125716426-125716448 GGATACCTGTGGTGCCAGGCAGG + Intergenic
1031879143 7:127176881-127176903 GGATCCCTGTGGTGCCAGGCAGG - Intronic
1031908789 7:127491143-127491165 TCATCCCTGTGATGCAAGGCTGG + Intergenic
1032162981 7:129524939-129524961 GTCTCACTGTGTTGCCAGGCTGG + Intergenic
1032199610 7:129810179-129810201 GTCTCACTGTGTTGCCAGGCTGG - Intergenic
1033191904 7:139288970-139288992 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1033370316 7:140701421-140701443 GTTTCCCTATGTTGCCAGGCTGG - Intronic
1035762233 8:2077278-2077300 GTCTCACTGTGTTGCCAGGCTGG - Intronic
1035833799 8:2727343-2727365 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1036022189 8:4858081-4858103 GCATCCCTGGGATGCAAGGCTGG + Intronic
1036346249 8:7966273-7966295 TCATCCCTTTGGTGCAAGGCTGG - Intergenic
1036837865 8:12090168-12090190 GGATGTCTGCCGTGCCAGGCAGG + Intergenic
1036850428 8:12196892-12196914 GTATCCCTCTGTCGCCAGGCTGG + Intergenic
1036859656 8:12336416-12336438 GGATGTCTGCGGTGCCAGGCAGG + Intergenic
1036863381 8:12373278-12373300 TCATCCCTTTGGTGCAAGGCTGG - Intergenic
1036871794 8:12439165-12439187 GTATCCCTCTGTCGCCAGGCTGG + Intergenic
1037278163 8:17203835-17203857 GTCTCCCTTTGTTGCCAGGCTGG + Intronic
1037670529 8:21011605-21011627 GGAGACTTGAGGTGCCAGGCTGG - Intergenic
1037757615 8:21721439-21721461 GGGTCCCTGTGGAGGAAGGCTGG + Intronic
1038242986 8:25827519-25827541 GCATCCCTGGGATGCAAGGCTGG - Intergenic
1038367297 8:26948859-26948881 GGATTCCTGTGGTGCCAGGAAGG + Intergenic
1038929301 8:32175148-32175170 TCATCCCTGGGATGCCAGGCTGG + Intronic
1039083373 8:33755785-33755807 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1039123489 8:34175218-34175240 AGATCCCTGTGGTGCCAGGCTGG - Intergenic
1039145515 8:34442172-34442194 TCATCCCTGTGATGCAAGGCTGG + Intergenic
1039268424 8:35854267-35854289 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1039641414 8:39227392-39227414 AGATCCCTGTGGTGCCAGGCAGG - Intronic
1039756884 8:40532951-40532973 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1039974057 8:42344783-42344805 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1039987952 8:42463794-42463816 GGATCCCTGAGCTGCCAGGCAGG - Intronic
1040457572 8:47614246-47614268 GTCTCGCTGTGTTGCCAGGCTGG + Intronic
1040635758 8:49270902-49270924 GTATCCCTGTGGTGCCACACAGG + Intergenic
1040734264 8:50486975-50486997 TCATCCCTGTGATGCAAGGCTGG - Intronic
1040800174 8:51331356-51331378 GGATCCCTGCAGTGTCAGGCAGG - Intronic
1041227682 8:55716729-55716751 GGATCCCTGTGGTGCCAGGCAGG - Intronic
1041364098 8:57083189-57083211 GGATCCCTGAGGTGCCAGGCAGG - Intergenic
1041459326 8:58094573-58094595 TCATCCCTGTGATGCAAGGCCGG - Intronic
1041570645 8:59333536-59333558 CGGATCCTGTGGTGCCAGGCAGG + Intergenic
1041878066 8:62712840-62712862 AGATCCCTGTGGTGCCAGGCAGG + Intronic
1042088518 8:65133493-65133515 GGATCCCTGTGATGCCAAGCAGG - Intergenic
1042122956 8:65507831-65507853 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1042140968 8:65677984-65678006 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1042304212 8:67314382-67314404 GGATCCCTGTGATGCCAGGCAGG + Intronic
1042467224 8:69141259-69141281 GGATCCCTATGGTGCCAGGCAGG + Intergenic
1042754290 8:72193401-72193423 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
1043040705 8:75259214-75259236 GGATACCTGTGAGGCCAGGCAGG - Intergenic
1043400736 8:79881708-79881730 GTCTCGCTGTGTTGCCAGGCTGG - Intergenic
1043437890 8:80252242-80252264 GTCTCACTGTGTTGCCAGGCTGG + Intergenic
1043446628 8:80325590-80325612 GAAGCCCTGGGGTGACAGGCAGG + Intergenic
1043816965 8:84813026-84813048 GGATCCCTGTGGTGCCAGGCAGG + Intronic
1044196047 8:89377720-89377742 TCATCCCTGGGATGCCAGGCTGG + Intergenic
1044227466 8:89736036-89736058 GGATCCTTGTGGTGCCAGGTAGG - Intergenic
1044984543 8:97746028-97746050 GTCTCCCTATGTTGCCAGGCTGG - Intergenic
1045587159 8:103551266-103551288 TCATCCCTGTGATGCAAGGCTGG + Intronic
1045779748 8:105849355-105849377 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1045810462 8:106215083-106215105 GTTTCACTGTGTTGCCAGGCTGG - Intergenic
1046246277 8:111566920-111566942 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
1046880496 8:119301201-119301223 GGGTCCCTGTGGATCCAGGTTGG - Intergenic
1047045917 8:121053016-121053038 TCATCCCTGGGGTGCAAGGCTGG - Intergenic
1048184470 8:132227088-132227110 GTCTCGCTGTGTTGCCAGGCTGG + Intronic
1048647435 8:136437898-136437920 GTATCCCTGTGTCACCAGGCTGG - Intergenic
1048872995 8:138814121-138814143 GGACACCTGGGGAGCCAGGCAGG - Intronic
1049372861 8:142276011-142276033 GGATCCCTGTGAGGCCTGGGTGG - Intronic
1050502596 9:6314832-6314854 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1050908016 9:11029041-11029063 GGATGCCTGGGATGCAAGGCTGG + Intergenic
1051113221 9:13663946-13663968 GCATCCCTGAGATGCAAGGCTGG + Intergenic
1051362594 9:16294472-16294494 GGATTCCTGTGGTGCCAGGCAGG - Intergenic
1051626154 9:19101888-19101910 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1052246786 9:26346537-26346559 GGATCTTTGTGGTGTCAGGCAGG + Intergenic
1052413069 9:28147426-28147448 GGAAACCTGTGGAGCGAGGCTGG + Intronic
1052632004 9:31053214-31053236 TCATCCCTGGGGTGCAAGGCTGG + Intergenic
1052670680 9:31553276-31553298 GCATCCCTGGGATGCAAGGCTGG + Intergenic
1052731553 9:32291675-32291697 GGATTCCTGTGGTGCCAGGCAGG + Intergenic
1052943149 9:34146258-34146280 GAGTCCCTCTGTTGCCAGGCTGG - Intergenic
1053136270 9:35652088-35652110 GTCTCCCTGTGTTGCCAGGCTGG + Intergenic
1053708081 9:40775876-40775898 GTATCCCTGTGTCACCAGGCTGG - Intergenic
1054417992 9:64896666-64896688 GTATCCCTGTGTCACCAGGCTGG - Intergenic
1054980381 9:71199197-71199219 TCATCCCTGTGATGCAAGGCTGG - Intronic
1055086632 9:72320750-72320772 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
1055210663 9:73786847-73786869 GCATCCCTGGGATGCAAGGCTGG + Intergenic
1055347066 9:75350450-75350472 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1055572131 9:77627560-77627582 TCATCCCTGGGATGCCAGGCTGG + Intronic
1055629100 9:78204744-78204766 TCATCCCTGGGGTGCAAGGCTGG + Intergenic
1055686929 9:78785408-78785430 GTCTTCCTGTGTTGCCAGGCTGG + Intergenic
1055861037 9:80749175-80749197 GTCTCACTGTGTTGCCAGGCTGG + Intergenic
1056052900 9:82788654-82788676 GTCTCGCTGTGTTGCCAGGCTGG - Intergenic
1056322821 9:85452491-85452513 GGATCCCTGTGGTGCCAGGGAGG + Intergenic
1056614153 9:88148558-88148580 GTCTCGCTGTGTTGCCAGGCTGG - Intergenic
1057077844 9:92148590-92148612 GGACCCCAGTGGTGCCTGGTAGG - Intergenic
1057119589 9:92559234-92559256 GGATCCCTGTGGTGTCAGGCAGG + Intronic
1057802255 9:98197659-98197681 GCCTCCCTCTGCTGCCAGGCTGG - Intergenic
1057901060 9:98948566-98948588 GTCTCCCTCTGTTGCCAGGCTGG - Intronic
1058085125 9:100740183-100740205 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1058153011 9:101482413-101482435 GTCTCACTGTGTTGCCAGGCTGG - Intronic
1058156754 9:101524587-101524609 GGATCCCTGTGGTGCCAGCCAGG + Intronic
1058308491 9:103471794-103471816 GGATTCCTGTGGTTCCAGGCAGG + Intergenic
1058402155 9:104631915-104631937 GTCTCACTGTGTTGCCAGGCTGG - Intergenic
1058410322 9:104724586-104724608 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1058623283 9:106906007-106906029 GGATCCCTGTGATGCCAGGCAGG + Intronic
1058714881 9:107714593-107714615 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
1059138110 9:111826674-111826696 GTCTCCCTCTGTTGCCAGGCTGG - Intergenic
1059200994 9:112416397-112416419 GGGTCTCTCTGTTGCCAGGCTGG - Intronic
1059214506 9:112548188-112548210 GTTTCACTGTGTTGCCAGGCTGG + Intronic
1059429949 9:114243953-114243975 GTCTCCCTCTGTTGCCAGGCTGG + Intronic
1060100904 9:120840473-120840495 GTCTCACTGTGTTGCCAGGCTGG + Intronic
1060710836 9:125862414-125862436 GTTTCACTGTGTTGCCAGGCTGG + Intronic
1060827481 9:126695257-126695279 GGAGCCCTGGGGTGCCGAGCTGG - Intronic
1061028611 9:128066651-128066673 GGATCTCTGTGGTGCTGGGCAGG + Exonic
1061230878 9:129315256-129315278 GAATCTCTGTGTTGCCAGGAAGG - Intergenic
1061893175 9:133633398-133633420 GCCTCCCTGTGGTGCCCCGCGGG - Intergenic
1203653197 Un_KI270751v1:149573-149595 GCATCCCTGGGATGCAAGGCTGG - Intergenic
1185464739 X:347516-347538 GGGTCCCCGTGGTGCCAGGACGG - Intronic
1185527818 X:793326-793348 GGAACCCAGTGGTGCCAACCAGG + Intergenic
1186523541 X:10227219-10227241 TCATCCCTGGGGTGCAAGGCTGG + Intronic
1187219294 X:17308186-17308208 GGATCCCTATGGTACCAGGCAGG + Intergenic
1187430737 X:19221992-19222014 GGATTCCTGTGGTACCAGGCAGG + Intergenic
1187681335 X:21770596-21770618 GGATTCCTGTGGTGCCAGGCAGG - Intergenic
1187748300 X:22433219-22433241 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1187773701 X:22730950-22730972 GGATCCCTGTGGTTCCAGGCAGG + Intergenic
1188023368 X:25183475-25183497 GCATACCTGTGGTGACAGGAGGG - Intergenic
1188045996 X:25426557-25426579 GGGTCCCTGTGGTGCCAGGCAGG + Intergenic
1188319860 X:28722917-28722939 TCATCCCTGGGGTGCAAGGCTGG - Intronic
1188421100 X:29991723-29991745 GGCTCCCTGTGGTCCAGGGCAGG + Intergenic
1188560875 X:31467489-31467511 TCATCCCTGGGATGCCAGGCTGG - Intronic
1189218079 X:39344602-39344624 GGATCCCTGTGGGGCCAGGCAGG - Intergenic
1189268095 X:39731540-39731562 TGAACCCTGTGGGGCCAAGCTGG - Intergenic
1189416091 X:40814768-40814790 GTCTCACTGTGTTGCCAGGCTGG - Intergenic
1189477317 X:41366021-41366043 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
1189603097 X:42648354-42648376 GGATCTCTGTGGTACCAGGCAGG - Intergenic
1189879262 X:45471814-45471836 GGATCCCTGTGGTGCCAAGCAGG + Intergenic
1189962069 X:46333475-46333497 GGATCCTTGTGGTGCCAGGCAGG - Intergenic
1190327470 X:49215646-49215668 GGGTCTTTGGGGTGCCAGGCAGG - Intronic
1190448841 X:50557631-50557653 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1190895562 X:54614532-54614554 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1191066610 X:56354943-56354965 TCATCCCTGGGGTGCAAGGCTGG - Intergenic
1191080559 X:56505648-56505670 GGATCCCTGTAATGCCAGGCAGG - Intergenic
1191114489 X:56837986-56838008 TCATCCCTGTGATGCAAGGCTGG - Intergenic
1191151896 X:57228255-57228277 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1191273830 X:58514445-58514467 GCATCCCTGGGATGCAAGGCTGG + Intergenic
1191779959 X:64854398-64854420 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1191874283 X:65779156-65779178 TCATCCCTGGGGTGCAAGGCTGG + Intergenic
1191903662 X:66064801-66064823 GGATCCCTGTGGTCCCAGGCAGG + Intergenic
1191906329 X:66094664-66094686 TCATCCCTGTGATGCAAGGCTGG + Intergenic
1191925775 X:66308135-66308157 TCATCCCTGGGGTGCAAGGCTGG - Intergenic
1191965325 X:66751246-66751268 GGATCCCTGTGTTGCCAGGCAGG + Intergenic
1192014799 X:67317644-67317666 GGATCCCTGTGGTGCCAAGCAGG + Intergenic
1192714197 X:73622020-73622042 TCATCCCTGGGGTGCAAGGCTGG - Intronic
1192781406 X:74297068-74297090 GTTTCACTGTGTTGCCAGGCTGG - Intergenic
1192820130 X:74636682-74636704 GGATCCCTGTGATTCCAGGCAGG - Intergenic
1192881196 X:75285405-75285427 GGATCCCTGTTTTGTCAGGCAGG + Intronic
1192914598 X:75638702-75638724 GGATCCTTGTGGTACCAGGCAGG + Intergenic
1192970341 X:76221782-76221804 GGATCTCTGTGGTGCCAGGCAGG + Intergenic
1192979131 X:76319563-76319585 GGATCCCTATGGTGCCAGGCAGG + Intergenic
1192995229 X:76505899-76505921 GGATCCCTCTGGTACTAGGCAGG + Intergenic
1192998439 X:76537514-76537536 TCATCCCTGTGATGCAAGGCTGG - Intergenic
1193062677 X:77223068-77223090 GGATCCTTGTGGTGCCAGGCAGG - Intergenic
1193101762 X:77622503-77622525 GGATCCCTGTGTTGCCAGGCAGG - Intronic
1193154507 X:78158448-78158470 GGATCCCTGTGGTGTCAGGCAGG - Intergenic
1193156768 X:78182875-78182897 GGATCCCTGCGGTGCCAGGCAGG - Intergenic
1193210814 X:78804703-78804725 TCATCCCTGTGATGCAAGGCTGG - Intergenic
1193244928 X:79216811-79216833 TGATCCCTGGGATGCAAGGCTGG - Intergenic
1193245638 X:79225353-79225375 TCATCCCTGGGATGCCAGGCTGG + Intergenic
1193253475 X:79319923-79319945 GGATCCCTGTGGTGTCAGGCAGG + Intergenic
1193309384 X:79987561-79987583 TCATCCCTGTGATGCAAGGCTGG - Intergenic
1193461415 X:81794876-81794898 TCATCCCTGGGGTGCAAGGCGGG + Intergenic
1193524947 X:82577638-82577660 TCATCCCTGGGGTGCAAGGCTGG - Intergenic
1193592831 X:83410880-83410902 TCATCCCTGGGGTGCAAGGCTGG + Intergenic
1193615658 X:83685234-83685256 TCATCCCTGTGATGCAAGGCTGG - Intergenic
1193776305 X:85646464-85646486 GTCTCACTGTGTTGCCAGGCTGG - Intergenic
1193779730 X:85686672-85686694 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1193786088 X:85760927-85760949 GGATCCCTGTGGTGCCAATCAGG + Intergenic
1193826389 X:86231851-86231873 GGATCCCTGTGGTGCCAGGCAGG + Intronic
1193937540 X:87641418-87641440 GTATCCCTGTGGTACCAGGCAGG - Intronic
1194575994 X:95615254-95615276 TCATCCCTGTGATGCAAGGCTGG - Intergenic
1194701576 X:97120155-97120177 GGATCCCTATGGTGCCAGGCAGG + Intronic
1194949854 X:100112028-100112050 TCATCCCTGGGGTGCAAGGCTGG - Intergenic
1195019552 X:100812867-100812889 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1195795367 X:108641767-108641789 GGATCCCTGTGGTGCCAGGCAGG - Intronic
1195814411 X:108869390-108869412 ACATCTCTGTGGTGCCAGACAGG + Intergenic
1195827524 X:109018615-109018637 GTCTCGCTGTGTTGCCAGGCAGG + Intergenic
1196170823 X:112587161-112587183 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1196218822 X:113087940-113087962 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1196464747 X:115960440-115960462 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1196590574 X:117481977-117481999 GGATCCCTGTGGTGCCAATCAGG + Intergenic
1196675838 X:118419292-118419314 GGATCCCTGTGGTGCCAGGCAGG + Intronic
1197066311 X:122237693-122237715 GGTTTCCTGTGGTGCCAGGAAGG + Intergenic
1197132313 X:123019694-123019716 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1197212042 X:123836283-123836305 GTCTCCCTCTGTTGCCAGGCTGG + Intergenic
1197293337 X:124686587-124686609 TCATCCCTGTGATGCAAGGCTGG + Intronic
1197476385 X:126930051-126930073 GGATCCCTGAGAGGCCAGGCAGG + Intergenic
1197518836 X:127472703-127472725 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1197671740 X:129284838-129284860 GGGTCCCTGTGGTGCCAGGGAGG + Intergenic
1197822392 X:130554365-130554387 GTATCACTATGGTGCCAGGTTGG - Intergenic
1197880414 X:131160736-131160758 GCATCCCTGGGATGCAAGGCTGG - Intergenic
1197953617 X:131923442-131923464 GGATGCCTGTGGTGCCAAGCAGG - Intergenic
1198843152 X:140880590-140880612 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1199057950 X:143319537-143319559 GGATCCCTGTGGTGCCAGGCAGG + Intergenic
1199668432 X:150120813-150120835 GAATCCCTGTGGTGCCAGGTAGG - Intergenic
1200281416 X:154780113-154780135 GTCTCACTGTGTTGCCAGGCTGG - Intronic
1200549726 Y:4562766-4562788 TCATCCCTGGGTTGCCAGGCTGG + Intergenic
1200969662 Y:9137293-9137315 GCCTCGCTGTGTTGCCAGGCTGG - Intergenic
1201077853 Y:10200340-10200362 GGCTCCCTGGGGTGCACGGCTGG + Intergenic
1201173118 Y:11290738-11290760 GCATCCCTGGGATGCAAGGCTGG - Intergenic
1201188268 Y:11424649-11424671 TCATCCCTGGGGTGCAAGGCTGG + Intergenic
1201306628 Y:12556225-12556247 AGAGCCCTGTGGTGCCAGGCAGG - Intergenic
1201315732 Y:12643746-12643768 GGATCCCTGTGATGCCAGGCAGG - Intergenic
1202043641 Y:20714195-20714217 GGATCCCTGTGGTGCCAGGCAGG - Intergenic
1202057835 Y:20854073-20854095 TCATCCCTGTGATGCAAGGCTGG - Intergenic
1202105351 Y:21358206-21358228 GCATCCCTGTGATGCAAGGTTGG + Intergenic
1202141338 Y:21726951-21726973 GCCTCGCTGTGTTGCCAGGCTGG + Intergenic
1202145527 Y:21776851-21776873 GCCTCGCTGTGTTGCCAGGCTGG - Intergenic