ID: 1109213663

View in Genome Browser
Species Human (GRCh38)
Location 13:59563498-59563520
Sequence CCTGTGGTGCCAGGCAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1102
Summary {0: 137, 1: 146, 2: 97, 3: 112, 4: 610}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109213650_1109213663 10 Left 1109213650 13:59563465-59563487 CCCTCACTCCTCTGGTCACCCTC No data
Right 1109213663 13:59563498-59563520 CCTGTGGTGCCAGGCAGGAATGG 0: 137
1: 146
2: 97
3: 112
4: 610
1109213656_1109213663 -9 Left 1109213656 13:59563484-59563506 CCTCCCAATGGATCCCTGTGGTG No data
Right 1109213663 13:59563498-59563520 CCTGTGGTGCCAGGCAGGAATGG 0: 137
1: 146
2: 97
3: 112
4: 610
1109213653_1109213663 2 Left 1109213653 13:59563473-59563495 CCTCTGGTCACCCTCCCAATGGA 0: 5
1: 30
2: 62
3: 100
4: 252
Right 1109213663 13:59563498-59563520 CCTGTGGTGCCAGGCAGGAATGG 0: 137
1: 146
2: 97
3: 112
4: 610
1109213648_1109213663 25 Left 1109213648 13:59563450-59563472 CCTTTGGATTTTTATCCCTCACT No data
Right 1109213663 13:59563498-59563520 CCTGTGGTGCCAGGCAGGAATGG 0: 137
1: 146
2: 97
3: 112
4: 610
1109213655_1109213663 -8 Left 1109213655 13:59563483-59563505 CCCTCCCAATGGATCCCTGTGGT No data
Right 1109213663 13:59563498-59563520 CCTGTGGTGCCAGGCAGGAATGG 0: 137
1: 146
2: 97
3: 112
4: 610
1109213651_1109213663 9 Left 1109213651 13:59563466-59563488 CCTCACTCCTCTGGTCACCCTCC No data
Right 1109213663 13:59563498-59563520 CCTGTGGTGCCAGGCAGGAATGG 0: 137
1: 146
2: 97
3: 112
4: 610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109213663 Original CRISPR CCTGTGGTGCCAGGCAGGAA TGG Intergenic
900220318 1:1505230-1505252 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
900339806 1:2182646-2182668 CCTTCGGTGCCAGCCAGGATGGG - Intronic
900396206 1:2454206-2454228 CCAGTGCTGCAGGGCAGGAAGGG - Intronic
900418721 1:2546492-2546514 CCTGCGGGGCCAGGCAGGGGCGG + Intergenic
900491258 1:2950258-2950280 CGAGGGGTGCCTGGCAGGAACGG - Intergenic
900536670 1:3182082-3182104 CGTGTGGTGGCTGGCAGGGAAGG - Intronic
900570261 1:3354863-3354885 CCTGTGTTCCCAGGCAGAAGAGG + Intronic
900664594 1:3806208-3806230 CCTCGGCTGCCAGGCAGGAAAGG - Intergenic
900957216 1:5893435-5893457 CCTGGGCTGCCAGGCAGGAAAGG - Intronic
901041021 1:6363630-6363652 CCTTGGCTGCCAGGCAGGGAAGG + Intronic
901142312 1:7043089-7043111 GCTGTGGAGCCTGGCAGGACGGG + Intronic
901792636 1:11662299-11662321 CCTGTGGTTTCTGGAAGGAAAGG + Exonic
902386278 1:16077818-16077840 CATCTGGTCCCAGGCATGAAAGG + Intergenic
902460210 1:16569236-16569258 CCTGATGAGCCAGGCAGGACAGG + Exonic
903140993 1:21339077-21339099 CAGGTGGTGCCAGACAGGGAGGG + Intronic
903159730 1:21478122-21478144 CCTGATGAGCCAGGCAGGACAGG - Exonic
903967522 1:27099914-27099936 GCTGTGGTCCCACCCAGGAAGGG - Exonic
904612859 1:31735044-31735066 TGTGTGGTGGCTGGCAGGAAAGG + Intronic
905835611 1:41117779-41117801 CCTCGGCTGCCAGGCAGGGAAGG + Intronic
906054046 1:42900392-42900414 CCTGTGATGCCAGGCAGGAATGG + Intergenic
906877245 1:49552420-49552442 CCTGTGGTGCCAGACAGGAATGG + Intronic
907349054 1:53811145-53811167 CCTGTGGTGCCAGGCAGGAATGG - Intronic
907637164 1:56146911-56146933 CTTGAGGAGCCAGGCAGGTAGGG + Intergenic
907865184 1:58392457-58392479 CCTGAGGTGGCAAGAAGGAATGG - Intronic
907917621 1:58885398-58885420 CAGGTGGAGCCAAGCAGGAAGGG - Intergenic
908104337 1:60825774-60825796 CCTGTGGTGTCAGGCAGGCTGGG - Intergenic
908666292 1:66494703-66494725 CCTGTGTGCCCAGGAAGGAAAGG + Intergenic
908818564 1:68058640-68058662 CCTTGGCTGCCAGGCAGGGAAGG + Intergenic
908981660 1:69966827-69966849 CCTGTGAGACCAGGCAGAAATGG - Intronic
909455304 1:75843097-75843119 CCTCGGCTGCCAGGCAGGGAAGG + Intronic
909673492 1:78214090-78214112 CCTGTGGTGCCAGACAAGAATGG - Intergenic
910598597 1:89005969-89005991 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
910739091 1:90495147-90495169 CCTGTGGTGCTAGGCAGGAATGG + Intergenic
911678979 1:100692161-100692183 CGTGTGGTACCAGGCAGGAATGG + Intergenic
912311016 1:108621547-108621569 GCTGTGGAGTCAGGCTGGAAGGG + Intronic
912616242 1:111102534-111102556 CCTGTGGTGCCAGGTAGGACTGG + Intergenic
913075598 1:115338378-115338400 GCTGTGGTGCCCGGCTGGAGGGG + Intergenic
913151314 1:116046907-116046929 CCTGTGGTGCCAGGCAGGAATGG - Intronic
913193336 1:116432184-116432206 CCCGTGTTGCCTGGCAGGAGAGG + Intergenic
913605207 1:120459345-120459367 CCTGATGAGCCAGGCAGGACAGG - Intergenic
913642074 1:120822082-120822104 CCTGATGAGCCAGGCAGGACAGG - Exonic
914083331 1:144429863-144429885 CCTGATGAGCCAGGCAGGACAGG + Exonic
914189355 1:145395141-145395163 CCTGATGAGCCAGGCAGGACAGG + Exonic
914211203 1:145580853-145580875 CCTGATGAGCCAGGCAGGACAGG + Intergenic
914276407 1:146128282-146128304 CCTGATGAGCCAGGCAGGACAGG + Exonic
914345981 1:146799007-146799029 CCTGTGATGCCAGACAGGAATGG - Intergenic
914366410 1:146982906-146982928 CCTGATGAGCCAGGCAGGACAGG - Exonic
914380924 1:147115477-147115499 CCTGATGAGCCAGGCAGGACAGG + Intergenic
914486037 1:148110541-148110563 CCTGATGAGCCAGGCAGGACAGG + Exonic
914537451 1:148579237-148579259 CCTGATGAGCCAGGCAGGACAGG + Exonic
914586369 1:149065689-149065711 CCTGATGAGCCAGGCAGGACAGG + Exonic
914628475 1:149486108-149486130 CCTGATGAGCCAGGCAGGACAGG - Intergenic
914767631 1:150653493-150653515 GCTTTGTTGCCAGGCTGGAATGG + Intronic
914927074 1:151897962-151897984 CCTGTGGTGCCAGGCAGGTATGG - Intronic
914967880 1:152277538-152277560 CTTGTGGTGCCAGGCAGTAATGG - Intergenic
915481930 1:156192839-156192861 CCTCGGCTGCCAGGCAGGAAAGG + Intergenic
916263648 1:162868745-162868767 CCCATGGTGCCAGGCAGGAATGG - Exonic
916579832 1:166097239-166097261 CCTATGGTGCCAGGCAGGAATGG - Intronic
917057973 1:171004366-171004388 CCTGTGGTGCCAAGCAGGAATGG + Intronic
917318897 1:173758746-173758768 CCTGTGGTGCCAGGCAGGAATGG - Intronic
917320244 1:173773721-173773743 CCTGTGTTGCCAGCCGGGCACGG + Intronic
917461499 1:175234464-175234486 CCTGTAGTGTCAGGCAGGAATGG - Intergenic
917898584 1:179517566-179517588 CCTGTGGTGCCAGGCAGGAATGG + Intronic
918074099 1:181156586-181156608 CCTGTGGGTCCAGAGAGGAAAGG + Intergenic
918158267 1:181872286-181872308 CTTGTGGTGCCAGGAAGGAATGG - Intergenic
919637591 1:200017925-200017947 CCTGTGGTCCCAGCTAGGCAGGG - Intergenic
919823179 1:201485522-201485544 CCTATGGTGCAAGGCAGTAGAGG + Intronic
919915847 1:202138583-202138605 CCTGTGCTTTCAGGCAGGATGGG + Intronic
920386815 1:205575440-205575462 CCTGGGGTGGCAGGCAGGAATGG + Intronic
920559141 1:206926506-206926528 GCTGTGGAGCAAGGCAGGCATGG - Intergenic
921409894 1:214823990-214824012 TCTGTGGTACCAGGCAGGAATGG + Intergenic
922396147 1:225202806-225202828 CCTGTGAGGCAAGGCAGAAATGG + Intronic
922657818 1:227401519-227401541 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
922673492 1:227532853-227532875 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
923639624 1:235741593-235741615 CCAGTGGTTCCAAGCAGCAATGG - Exonic
923648128 1:235845359-235845381 CTTGTGGTGCCAGGCAGGAATGG - Intronic
923808747 1:237288921-237288943 CCTGTGGTGCCAGGCAGGTATGG + Intronic
923874595 1:238034283-238034305 CTTGTGGTACCAGGCTGGAATGG - Intergenic
924139870 1:241011299-241011321 CCCCTGCTGCCAGGAAGGAAGGG - Intronic
924302416 1:242652616-242652638 CCTGTGGTGCCAGGCCAGGCAGG + Intergenic
924321497 1:242855263-242855285 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1063787559 10:9402653-9402675 CCTGGGCTGCCAGGCAGGGAAGG + Intergenic
1063985216 10:11494704-11494726 CCTCAGCTGCCAGGCAGGAAAGG - Intronic
1064018831 10:11793353-11793375 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1064284089 10:13977297-13977319 CTTGTGTTGGAAGGCAGGAAAGG - Intronic
1064908226 10:20370640-20370662 CCTGTGAGGCCAGGCAGGAATGG + Intergenic
1065263712 10:23953543-23953565 CCCCTGTTGCCAGGAAGGAACGG + Intronic
1065471071 10:26081678-26081700 CCTGTGGTGCCAGGCAGGAGTGG + Intronic
1066145600 10:32554434-32554456 CCTGTGTTTCCAGGCAGGAATGG + Intronic
1067526971 10:47044941-47044963 CCAGTGGTTCCAGGCAGCGATGG + Intergenic
1067673383 10:48346856-48346878 CCTCAGCTGCCAGGCAGGGAAGG + Intronic
1067697982 10:48549203-48549225 CCTATGTTCCCAGGCTGGAAGGG + Intronic
1067804250 10:49382189-49382211 CTGGTAGTGCCAGGCAGGGAGGG + Intronic
1068096704 10:52499890-52499912 CCTGTATTGCCAGGCAGGAATGG + Intergenic
1068480692 10:57585297-57585319 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1069150600 10:64954342-64954364 CCTGTGGTGCCAAGCAGGAATGG + Intergenic
1069325184 10:67224737-67224759 CCTGTGATGCCAGGCAGGAATGG - Intronic
1070615494 10:77966604-77966626 AGTGTGGTGACAGGGAGGAAAGG - Intergenic
1070787935 10:79172958-79172980 ACTGTGGGGCCAGCCAGGAGAGG + Intronic
1071484651 10:86091008-86091030 CCTGTGGTTCCAGGAAGGAATGG - Intronic
1072247184 10:93554221-93554243 CCAGTGGTGCAAGCCAGGCATGG - Intergenic
1072962232 10:99939870-99939892 CCTGTGGTCCCACCCAGAAAGGG + Intronic
1074896230 10:117779977-117779999 CCGGTGGTGCCAGCCAGGATGGG - Intergenic
1075216916 10:120544456-120544478 TCTGTGTTGCGGGGCAGGAAGGG - Intronic
1075788693 10:125068006-125068028 CCTCTGGTGCCAAGCAACAACGG + Intronic
1075946724 10:126439929-126439951 CCTGTGATGCTTGGCAGGAATGG - Intronic
1076202947 10:128572805-128572827 CCTGGGGGGCCAGGAAGGATGGG - Intergenic
1076419656 10:130321957-130321979 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1076628748 10:131839885-131839907 CCTCAGCTGCCAGGCAGGGAAGG - Intergenic
1076912322 10:133397251-133397273 CCTTGGCTGCCAGGCAGGGAAGG + Intronic
1076926373 10:133490266-133490288 CATGTGGTGCCAGGCAGAATGGG + Intergenic
1076927132 10:133497153-133497175 CCTCGGCTGCCAGGCAGGAAAGG - Intergenic
1077006745 11:361654-361676 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1077265021 11:1644372-1644394 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1077388308 11:2286156-2286178 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1077520115 11:3028156-3028178 CCTTGGCTGCCAGGCAGGGAAGG + Intronic
1077708397 11:4511249-4511271 CCTCTGGTGCCTGGCAGTAGAGG + Intergenic
1077774713 11:5258420-5258442 CCTGTGAGGCAAGGCAGAAATGG - Intronic
1077929135 11:6712142-6712164 CCTTGGCTGCCAGGCAGGGAAGG + Intergenic
1078088390 11:8248408-8248430 CCTGGGCAGCCAGGCAGGAGTGG + Intronic
1078288497 11:9982948-9982970 CCTGTGGTGCCAGGCAGGAATGG - Intronic
1078324640 11:10369603-10369625 CCTGTTGTGTGAGGCAGCAAAGG + Intronic
1079010054 11:16820682-16820704 GCTGCAGAGCCAGGCAGGAAGGG - Intronic
1079273760 11:19013827-19013849 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1079356855 11:19736999-19737021 ACTGTAGTGCCAGCCAGGAGGGG + Intronic
1079791798 11:24748163-24748185 TCTGTGATGCCAGGCAGGAATGG + Intronic
1079983623 11:27177680-27177702 CCTGTGATGACAGGCAGCAGTGG - Intergenic
1080153121 11:29076694-29076716 CCTGTGGTGGCAGGCAGGAATGG + Intergenic
1080324045 11:31049875-31049897 CCTGTGGTGCCAGGCAGGAATGG - Intronic
1080672642 11:34395208-34395230 CCCATGGTGCCAGGCAGGAATGG + Intergenic
1081117341 11:39220089-39220111 ACTGAGGTGGCAGGCAGGAAAGG - Intergenic
1081195176 11:40152323-40152345 CCCGTGGTGCCAGGCAGGAATGG - Intronic
1082092542 11:48101613-48101635 CCTGGGGAGCCAGGAAGGCATGG + Intronic
1082140564 11:48603677-48603699 CCGGTGGTGCCAGACAGGAATGG + Intergenic
1082567757 11:54700777-54700799 CCTGTGGTGCCAGACAGGAATGG + Intergenic
1082580097 11:54855655-54855677 CCTTGGCTGCCAGGCAGGGAAGG + Intergenic
1082689072 11:56277817-56277839 CCTTGGCTGCCAGGCAGGGAAGG + Intergenic
1082789936 11:57340208-57340230 CCAGTGGAGCCAGGCCAGAAGGG - Intronic
1082916767 11:58446171-58446193 CCTGTGGTGTCAAGCAGGAATGG - Intergenic
1083072770 11:60003563-60003585 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1083349443 11:62017011-62017033 CCTCAGCTGCCAGGCAGGGAAGG + Intergenic
1084264394 11:67997445-67997467 CCTGTGGTCCGAGGCAGGCGTGG - Intronic
1084352858 11:68615781-68615803 CCTGTGGGCCCAGGCACGGAGGG - Intergenic
1084549151 11:69830651-69830673 CTCGTGGTCCCAGGCAGAAAAGG - Intergenic
1084799891 11:71536614-71536636 CCTGTAGTGATGGGCAGGAAGGG + Intronic
1084840478 11:71842563-71842585 CCTGTGGTGCCAGGCAAGAATGG - Intergenic
1085045978 11:73353684-73353706 CCTGTGGTGAGAGGCAGTATGGG - Intronic
1085250644 11:75141390-75141412 CCAGTGGTAAAAGGCAGGAAGGG + Intronic
1085518700 11:77125936-77125958 CCTTGGGGGCCAGGCAGGTAAGG + Exonic
1085747711 11:79129239-79129261 CCTCTGGTGCCAGGCAGGAATGG - Intronic
1085788216 11:79473470-79473492 CCTGTGGTTCCAGGGGGAAAGGG + Intergenic
1085817905 11:79760574-79760596 CTTGTGGGGCCAGACATGAAGGG - Intergenic
1085917071 11:80903012-80903034 CCTATGAGGCCAGGCAGAAATGG - Intergenic
1086825518 11:91490317-91490339 CCTGTGGTGCCAGGCAGAAATGG + Intergenic
1087619394 11:100525197-100525219 CTTGTGGTGCCAGGCAGGAATGG - Intergenic
1088179394 11:107092264-107092286 CATGTGAGGCCAGGCAGAAATGG - Intergenic
1088206330 11:107397037-107397059 CCTGTGGTGCCAGGCAGGAACGG - Intronic
1088239436 11:107758563-107758585 CTTGTGGTGCTAGGCAGGAATGG - Intergenic
1088388124 11:109282045-109282067 CCTGTGGTGCCATGTAGTAATGG + Intergenic
1088391934 11:109323963-109323985 CCTGTGGTGCCAGAGAAGTAAGG - Intergenic
1088895112 11:114072550-114072572 CCTGCACTGACAGGCAGGAAAGG - Intronic
1089083855 11:115800326-115800348 CCAGTGGTGGCAGGCTGGACAGG - Intergenic
1089107295 11:116023656-116023678 CCTGTGGTGCCAGGTAAGAATGG - Intergenic
1089702696 11:120255080-120255102 CCAGAGGTGGCAGGCAGGAAAGG - Intronic
1089937384 11:122378081-122378103 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1089954326 11:122556179-122556201 CCTGTGATGCCAGGCAGGAATGG + Intergenic
1089984816 11:122803339-122803361 CATGTGGTGACAGGCAGAAAGGG + Intronic
1090587253 11:128226559-128226581 CATGTGGTGCCTGGCTGGAAAGG - Intergenic
1090669406 11:128935667-128935689 ACTGTGGCTCCAGGAAGGAAAGG + Exonic
1090757233 11:129803369-129803391 CCTGTGGTGTCAGGCAGGAATGG - Intergenic
1091086756 11:132728210-132728232 CCTGTAGCCCCAGGCAGAAAGGG + Intronic
1091210611 11:133854924-133854946 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1091323500 11:134667769-134667791 CCTGCGGTGCCAGCGAGAAAGGG - Intergenic
1091798041 12:3308515-3308537 CCTGCGGGGCCACGCAGGACAGG - Intergenic
1092099104 12:5868766-5868788 CCTGCGGTCTCAGGCAGGACTGG - Intronic
1092224951 12:6742236-6742258 CCTCAGCTGCCAGGCAGGGAAGG + Intergenic
1092444191 12:8538402-8538424 CCTCGGCTGCCAGGCAGGGAAGG + Intronic
1092449054 12:8585064-8585086 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1092947698 12:13472138-13472160 CTTGTTTTGCCTGGCAGGAAAGG + Intergenic
1093010444 12:14101541-14101563 CCTGTGATACCAGGCAGGAATGG - Intergenic
1093147078 12:15579456-15579478 GCTGTGGAGCTAGGCATGAATGG + Intronic
1093172245 12:15874220-15874242 CCTGTGGTGCCAGGCAGGAACGG - Intronic
1093389502 12:18601912-18601934 CCTGTGGTGCCAGGCAGGAATGG - Intronic
1093409361 12:18845702-18845724 CCTGTGACACCAGGCAGGAATGG + Intergenic
1093488833 12:19681793-19681815 CCTGTGGTGCCAGGTAGGAATGG + Intronic
1093497542 12:19775488-19775510 CCTGTGGTGCCGGGCAGGAATGG + Intergenic
1093588277 12:20868853-20868875 CCTCGGCTGCCAGGCAGGGAAGG - Intronic
1093720489 12:22436973-22436995 CCTGCGGTGCCAGGCAGGAATGG - Intronic
1093994867 12:25630687-25630709 CCTGTGGTGCCAGGCAGGAATGG - Intronic
1094342743 12:29430928-29430950 CCTGTGAGTCCAGGCAGAAACGG + Intronic
1094362025 12:29640652-29640674 CCTGTGGTTCCAGGCAGGAACGG - Intronic
1094447441 12:30546635-30546657 CCTGTGTTGCCAGGCTGGAATGG + Intergenic
1094501266 12:31023140-31023162 CCTGTGGTACCAGGCAGGAATGG - Intergenic
1094801961 12:34047906-34047928 CCTGTGGTTCCAGGTAGGAATGG - Intergenic
1095115095 12:38343814-38343836 CCTGTGGTTCCAGGAAGGAATGG - Intergenic
1095118584 12:38385499-38385521 CCTGTGATGCCAGGCAGTATTGG + Intergenic
1095248267 12:39946975-39946997 ACTGTGGTGCCAGGCAGGAATGG + Intronic
1095665091 12:44788534-44788556 CCTGTGGTGCTAGGCAGGAATGG - Intronic
1095732557 12:45521651-45521673 CCTGTGGTGCCAGGCAAGAATGG - Intergenic
1095892689 12:47249643-47249665 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1095931983 12:47636714-47636736 CCTGTGGTTCCAGGCAGGAGTGG - Intergenic
1096717275 12:53499238-53499260 CCTGTGGGGCTGGGAAGGAAGGG - Intronic
1096860902 12:54527389-54527411 CAGTTGGGGCCAGGCAGGAAAGG + Intronic
1096956767 12:55534372-55534394 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1097089980 12:56497291-56497313 CCTCAGCTGCCAGGCAGGGAAGG + Intergenic
1097090527 12:56500979-56501001 CCTCAGCTGCCAGGCAGGGAAGG - Intergenic
1097233674 12:57526343-57526365 CTGGTGGTCCCAGGCAGGGAGGG - Exonic
1097295397 12:57957758-57957780 TCTGTGGTGACAGGCAGGAATGG - Intergenic
1097591677 12:61582453-61582475 CCTCAGCTGCCAGGCAGGAAAGG - Intergenic
1097760448 12:63459050-63459072 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1098935342 12:76472641-76472663 CCTCAGCTGCCAGGCAGGGAAGG - Intronic
1098961013 12:76739607-76739629 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1099232490 12:80043354-80043376 CCTGTGGATCAAGGCAAGAAGGG + Intergenic
1099473123 12:83074993-83075015 CCTGTGGTGTCAGGCAGGAATGG + Intronic
1099477286 12:83122437-83122459 CCTGTGAGGCCAGGCAGAGATGG + Intronic
1099687514 12:85908508-85908530 CTTGTGATGCCAGTCAGGAATGG + Intergenic
1099777503 12:87151788-87151810 CCTGTGGTGTCAGGCAGGAATGG + Intergenic
1099894821 12:88631925-88631947 ACTGTGGTGACAGGCAAGACAGG + Intergenic
1100088219 12:90937058-90937080 CCTGCAGTGCCAGGCAGGAATGG + Intronic
1100291082 12:93215359-93215381 CCTGTGGTGTCAGGCAGGAATGG + Intergenic
1100685993 12:96986208-96986230 CCTGCGCTGCCAGGCGGGACTGG - Intergenic
1101390301 12:104293934-104293956 CCTCGGCTGCCAGGCAGGGAAGG - Intronic
1101635367 12:106535893-106535915 CCTGTGGTGCCAGGCAAGAATGG + Intronic
1101839197 12:108315791-108315813 CCTATGGTTTCAGCCAGGAAAGG + Intronic
1102306949 12:111812051-111812073 CCTTGGCTGCCAGGCAGGGAAGG - Intergenic
1102916830 12:116760456-116760478 CCCGTGGTGCCAGACAGGAATGG + Intronic
1103340821 12:120220321-120220343 CCTGTGGAGCCACCCAGGGAGGG + Intronic
1103357992 12:120336020-120336042 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1103567967 12:121826608-121826630 CCTGGGGTGACAGGCAGCAGAGG + Intronic
1103600547 12:122051721-122051743 CCTGCTGTGCCCGGCAGAAAAGG + Intronic
1103761201 12:123251456-123251478 CCTGTGGTGCCAGGCAGGAATGG + Intronic
1104287421 12:127437121-127437143 CCTCTGGCACAAGGCAGGAAAGG - Intergenic
1104416549 12:128600573-128600595 CCTGTGGTGCCCAGCTGCAAAGG - Intronic
1104504590 12:129319221-129319243 CTTGTGGTGCCAGGCAGGAATGG + Intronic
1104878224 12:132051529-132051551 CCTCGGCTGCCAGGCAGGGAAGG - Intronic
1104944109 12:132408046-132408068 GCTGTGGTGCCAGATAGGACAGG + Intergenic
1104960990 12:132488747-132488769 CCTCTTGTGCAGGGCAGGAAGGG - Intergenic
1105019911 12:132809119-132809141 CCTTGGTTGCCAGGCAGGGAAGG - Intronic
1105041437 12:132964498-132964520 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1105855329 13:24366600-24366622 CCAGTGGAGTCAGGCAGGACAGG - Intergenic
1105856369 13:24376099-24376121 CCTCAGCTGCCAGGCAGGGAAGG + Intergenic
1105876117 13:24554828-24554850 CCTTGGCTGCCAGGCAGGGAAGG - Intergenic
1105908163 13:24834706-24834728 CCTGTGGCACCAGGCAGGAATGG - Intronic
1105930677 13:25049023-25049045 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1106627054 13:31431623-31431645 CCTGAGGTTTCAGGCAGGAGAGG - Intergenic
1106797165 13:33218403-33218425 CCAGTGGTGGCAGGCTGGACAGG - Intronic
1106938234 13:34747686-34747708 CCTGTGGTGCCGGGCAGGAATGG + Intergenic
1107184746 13:37505380-37505402 CCTGCAGTGCTAGGCAGGAATGG - Intergenic
1107666319 13:42694268-42694290 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1107756090 13:43623366-43623388 CCCATGGTGCCAGGCAGGAATGG + Intronic
1107849726 13:44558915-44558937 TTTGAGGTTCCAGGCAGGAAGGG - Intronic
1108558384 13:51619338-51619360 CCTGTGGTCCCAGTGAGGCAAGG + Intronic
1108589185 13:51897051-51897073 CCTGTGGTGCCAGAGAACAAAGG - Intergenic
1108817017 13:54304937-54304959 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1109213663 13:59563498-59563520 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1109300483 13:60585494-60585516 CGTGAGGAGCCAGGCAGGGAGGG - Intergenic
1109508486 13:63337291-63337313 CCTTTGTTGCCAGGCAGTAATGG + Intergenic
1109956832 13:69580216-69580238 CCTGTGGAGCCTGTCAGGACAGG - Intergenic
1109961842 13:69641446-69641468 TATGTGTTGCCAGACAGGAAAGG + Intergenic
1110661286 13:78061413-78061435 CCTGTGGTGCCAGGCAGAAATGG + Intergenic
1110852716 13:80263106-80263128 CTTGTGGTGCCAGGCAGGAATGG + Intergenic
1110881461 13:80577672-80577694 CCTCTAGTGCCAGGCAGGAATGG - Intergenic
1111819522 13:93195721-93195743 ACTTTGCTGTCAGGCAGGAAGGG + Intergenic
1112035464 13:95492785-95492807 CCTGTGGTGTCAGGCAGGAATGG + Intronic
1112390353 13:98977987-98978009 CCAGTGGTCCAAGGAAGGAAAGG + Exonic
1112737997 13:102443018-102443040 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1112945225 13:104919867-104919889 CCTGTGGTACCAGGCAAAAATGG - Intergenic
1113270016 13:108662870-108662892 CCTGTGGTGCCAGGCAGGAATGG + Intronic
1113329868 13:109317484-109317506 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1113775419 13:112942317-112942339 CCTCGGCTGCCAGGCAGGGAAGG + Intronic
1113856749 13:113450637-113450659 CCTCGGCTGCCAGGCAGGGAAGG - Intronic
1113877686 13:113604829-113604851 GCTGTTGTCTCAGGCAGGAATGG + Intronic
1113880346 13:113622056-113622078 CCTCGGCTGCCAGGCAGGGAAGG + Intronic
1114658149 14:24328524-24328546 CCTCGGCTGCCAGGCAGGGAAGG + Intronic
1115176059 14:30562863-30562885 CCTCGGCTGCCAGGCAGGGAAGG + Intronic
1115265062 14:31492636-31492658 CCTGTGGGGCCAGGCAGGAAAGG - Intronic
1115680230 14:35730259-35730281 CCTGTGGTGCCAGGCAGGAATGG - Intronic
1115800677 14:36990163-36990185 CCTGAGATTCCAGGCTGGAAAGG + Intronic
1115835575 14:37398088-37398110 CCTGTGGTGCCAGGCAGGAATGG + Intronic
1115958433 14:38808627-38808649 CCTGTGGTGTCAGGCAGGAATGG - Intergenic
1115969725 14:38932155-38932177 CCTGTGGTTTCAGGCAGGAATGG - Intergenic
1115996833 14:39203731-39203753 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1116049119 14:39781631-39781653 CCCGTGGTGCCAGGCAGGAATGG + Intergenic
1116346621 14:43802817-43802839 CCTCTGGTGCCAGGCAGGAATGG - Intergenic
1117510873 14:56449251-56449273 CCTGTGGTGCCTGGAAGGAATGG + Intergenic
1117632559 14:57708878-57708900 CCTCAGCTGCCAGGCAGGGAAGG - Intronic
1117768394 14:59107364-59107386 CCTGTGAGGCCAGGCAGAAATGG - Intergenic
1118162225 14:63301945-63301967 CCTGTGGTGCCATGCAGGAATGG - Intergenic
1118493404 14:66284224-66284246 CTTATGATGCCAGGCTGGAAAGG + Intergenic
1118532279 14:66719252-66719274 CCTGTAATGCCAGACAGGAATGG + Intronic
1119025301 14:71147926-71147948 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1119153637 14:72388547-72388569 TCTGTGGTCTCAGGCAGGGAAGG + Intronic
1119495998 14:75079814-75079836 CCTGTGGTACCAGGCAGATAAGG - Exonic
1119533443 14:75379918-75379940 CCAGTGGTGGCAGGCTGGATGGG + Intergenic
1120398551 14:83999778-83999800 CCTGTGGTGGAATGGAGGAAAGG + Intergenic
1120961935 14:90132908-90132930 CCAGTGAGGCAAGGCAGGAAAGG - Intronic
1121459765 14:94065871-94065893 CCTGTGGTGCCAGGCAGGAATGG - Intronic
1121516698 14:94556846-94556868 CCTGTGGTGCCATGCAGGAATGG + Intergenic
1121609737 14:95269691-95269713 CCTTTGGTGCCAGGCAGCTGGGG - Intronic
1121880252 14:97493986-97494008 CCTGTGGTGAGAGGAGGGAATGG + Intergenic
1122363247 14:101179860-101179882 CCTGGTGTGCCAGGCTGGGATGG + Intergenic
1122631945 14:103111313-103111335 GCTGTGGTGCCAGGCAAGCAGGG + Intergenic
1122755977 14:103980383-103980405 CCTTGGCTGCCAGGCAGGGAAGG - Intronic
1123008097 14:105334003-105334025 CATATGGCCCCAGGCAGGAAGGG - Intronic
1123104299 14:105830952-105830974 CATATGGTGCCATGCAGGAATGG + Intergenic
1123183498 14:106491639-106491661 CCTCAGCTGTCAGGCAGGAAAGG - Intergenic
1123193226 14:106591507-106591529 CCTCAGCTGCCAGGCAGGAAAGG - Intergenic
1202893519 14_KI270722v1_random:182362-182384 CCTTGGCTGCCAGGCAGGAAAGG + Intergenic
1124411395 15:29440652-29440674 CCTGTGGTGAGAGGCAGGACGGG - Intronic
1124557039 15:30735980-30736002 CCTGCGGTGCCAGGCAGGAATGG - Intronic
1124606826 15:31175694-31175716 CTGGTGGTGCCAGTCAGGCATGG - Intergenic
1124667826 15:31609116-31609138 CCTGTGGTGACAGGCAAGAATGG - Intronic
1124674225 15:31669764-31669786 CCTGTGGTGCCAGGCAGGAATGG + Intronic
1125056010 15:35359490-35359512 CCTGTGGTGCCAGGCAGGAATGG + Intronic
1125269490 15:37922088-37922110 CCTGTAGTGCCAAGCAGGAATGG + Intronic
1126572631 15:50168552-50168574 TCTTTGGTGTCAGGCAGGAATGG - Intronic
1126577406 15:50210510-50210532 CCTGTGGTGCCAGGCGGGAATGG - Intronic
1126704578 15:51395543-51395565 CCAGTGGTGGCAGGCTGGACAGG + Intronic
1126974207 15:54156330-54156352 TCTAAGGTGCCAGGTAGGAAAGG + Intronic
1127031057 15:54863456-54863478 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1127525328 15:59786916-59786938 CCTGTGGTGCCAAGCAGCACTGG + Intergenic
1127752182 15:62056855-62056877 CCTCGGCTGCCAGGCAGGGAAGG + Intronic
1127877556 15:63123701-63123723 CCTCGGCTGCCAGGCAGGGAAGG - Intronic
1127915380 15:63450833-63450855 CCAGTGGTGGCAGGCTGGACAGG + Intergenic
1128238631 15:66084669-66084691 CCTGTGGTGCCAGGCAGGAATGG - Intronic
1128414936 15:67436439-67436461 CCTGTGGTGCCAGGCAGAAATGG - Intronic
1129076320 15:72999401-72999423 CCTGGGATTCCAGGCAGGAAAGG + Intergenic
1129097685 15:73225908-73225930 CCTGTGGTGCCAGTTAGGAATGG + Intronic
1129298775 15:74613884-74613906 CCATGGGTACCAGGCAGGAATGG + Intronic
1129318207 15:74759004-74759026 CCTGCTGTGGGAGGCAGGAATGG - Intergenic
1129525199 15:76209239-76209261 CCTGTTGTGCCACTCAGGGAAGG - Intronic
1129574908 15:76732890-76732912 CCTCAGCTGCCAGGCAGGGAAGG + Intronic
1129921103 15:79319768-79319790 CCTTGGCTGCCAGGCAGGGAAGG - Intronic
1129923284 15:79339181-79339203 CCTCAGCTGCCAGGCAGGGAAGG + Intronic
1132210384 15:100017480-100017502 CCTGTGGTGCCAGGCAGGAATGG + Intronic
1132576750 16:667922-667944 CCTGTGGTGCCGTGAAGCAATGG + Intronic
1132838342 16:1965896-1965918 CCCGTGGTGCTAGGCTGGAGTGG + Intergenic
1132966793 16:2660530-2660552 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1132967925 16:2669797-2669819 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1133010302 16:2906817-2906839 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1133054843 16:3140739-3140761 CCGGTGGTGCCAGGCCAGACAGG + Exonic
1133108179 16:3527817-3527839 CCTCAGCTGCCAGGCAGGGAAGG + Intronic
1133796401 16:9050117-9050139 CCTGTGGTCCCAGGAAGGTGAGG - Intergenic
1133849641 16:9490117-9490139 CTTGTGGTGCCAAGGAGGTATGG - Intergenic
1134400502 16:13905415-13905437 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1135670900 16:24374666-24374688 CCTCGGCTGCCAGGCAGGAAAGG - Intergenic
1135901500 16:26464428-26464450 CCTGTGGCGCCAGGCAGGAATGG - Intergenic
1135957101 16:26965018-26965040 GCTGAGATGCCAGCCAGGAAAGG + Intergenic
1136147132 16:28322241-28322263 GCTGTGGTGCAAGGCAGGCCTGG - Exonic
1136191208 16:28615815-28615837 CCTCGGCTGCCAGGCAGGGAAGG - Intronic
1136319218 16:29471705-29471727 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1136352686 16:29721348-29721370 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1136433789 16:30211049-30211071 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1136584001 16:31171890-31171912 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1137038844 16:35591445-35591467 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1137592012 16:49699505-49699527 CATGTGGTTCCAGGGAAGAACGG - Intronic
1138022487 16:53497229-53497251 CCTGTGGTGCCTGGCACACACGG - Intronic
1138216112 16:55206936-55206958 CCTGTAGGGCCAGGCACAAAGGG - Intergenic
1138591952 16:58005016-58005038 CCTCAGCTGCCAGGCAGGCAAGG - Intronic
1138798066 16:59993644-59993666 CCTGTGGTGCCAGGAAGGAATGG + Intergenic
1138838962 16:60474411-60474433 CCAGTGGTGACAGGCTGGACAGG - Intergenic
1138880924 16:61014428-61014450 CCTGTGAGGCCAGGCAGAAACGG - Intergenic
1139252675 16:65510995-65511017 GCTGTGTTCCCAGGCAGAAAAGG + Intergenic
1139778047 16:69329613-69329635 CCTGTGGTACCACGGGGGAATGG + Intronic
1139988000 16:70916260-70916282 CCTGTGATGCCAGACAGGAATGG + Intronic
1140546955 16:75819909-75819931 CTGGTGGTGAGAGGCAGGAAAGG + Intergenic
1141733945 16:85840017-85840039 GCTGTGGTGCAGGGCAGGCAGGG + Intergenic
1141736495 16:85857642-85857664 CCTGGGGTGGCCGGCAGGAGAGG + Intergenic
1141995768 16:87635602-87635624 CCTGTTCTGCCAGGCTGGCATGG - Intronic
1142368901 16:89666800-89666822 CCTTGGCTGCCAGGCAGGGAAGG - Intronic
1142384326 16:89753166-89753188 CCTCAGCTGCCAGGCAGGGACGG + Intronic
1142415357 16:89938142-89938164 CCTTGGCTGCCAGGCAGGGAAGG - Intergenic
1142559541 17:801889-801911 CCTGTGGTTTCAGGCAGGACAGG + Intronic
1142587449 17:982488-982510 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1142697309 17:1640550-1640572 CCAAAGGTGCCAGGCAGGCAGGG + Exonic
1142841139 17:2631479-2631501 CCTGTGGTGCCAGGCAAGAATGG + Intronic
1143187551 17:5019829-5019851 CCTCTGGTGGCAGGCAGCACGGG - Intronic
1143464494 17:7126978-7127000 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1143891718 17:10107407-10107429 CCAGTGGTGGCAGGCTGGGAAGG + Intronic
1144139770 17:12337009-12337031 TCTGTGGTGCCAGGCAGGAATGG + Intergenic
1145223437 17:21107705-21107727 CCTCAGCTGCCAGGCAGGGAAGG - Intergenic
1145732033 17:27198136-27198158 CCTCAGCTGCCAGGCAGGGAAGG + Intergenic
1146058304 17:29591924-29591946 CCTGTGGTGCCAGGCCCCAGCGG - Intronic
1146103836 17:30012488-30012510 CCTCGGCTGCCAGGCAGGGAAGG + Intronic
1146356073 17:32135329-32135351 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1146583311 17:34059363-34059385 CCTGTAATGCCAGGCAAGAATGG - Intronic
1148401156 17:47362777-47362799 CCTTGGCTGCCAGGCAGGGAAGG + Intronic
1149910664 17:60564127-60564149 CCAGTGGTGGCAGGCTGGACAGG + Intergenic
1150414940 17:64979517-64979539 TCTGTGGTGTCAGGCTGGACTGG - Intergenic
1150538869 17:66076078-66076100 CCTGTGGTACCAGGCAGGAATGG - Intronic
1150796697 17:68244152-68244174 TCTGTGGTGTCAGGCTGGACTGG + Intergenic
1151048309 17:70947772-70947794 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1151478898 17:74358710-74358732 CCGGTGGGGACTGGCAGGAAAGG - Intronic
1151711945 17:75812116-75812138 CCTGTGGTTCTGTGCAGGAATGG - Exonic
1151715040 17:75826998-75827020 CCTGTGGTGACACCCAGGACAGG - Intergenic
1151726201 17:75886128-75886150 CATATGGTGGCAGGCAGGCAAGG - Intronic
1152281144 17:79385472-79385494 CCTGTCCTGCCAGGCAGGAGGGG + Intronic
1152458803 17:80430801-80430823 CCTCTGGGGCAAGGCAGGCAAGG - Intronic
1152494349 17:80660670-80660692 CCTGTGTTGCCAGGCATGCATGG - Intronic
1152682512 17:81676464-81676486 CCTTGGCTGCCAGGCAGGGAAGG + Intergenic
1152874308 17:82777560-82777582 CCTCGGCTGCCAGGCAGGGAAGG - Intronic
1152891266 17:82882941-82882963 CCTGCGCTGCCAGGCTGGAGCGG + Intronic
1153069573 18:1089675-1089697 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1153163073 18:2230471-2230493 CCTTGGCTGCCAGGCAGGGAAGG - Intergenic
1153169055 18:2293936-2293958 CCTATGGTGCCAGGCAGGAATGG + Intergenic
1153232863 18:2956537-2956559 CTTCTGGTACCAGGAAGGAAGGG + Intronic
1153400389 18:4678631-4678653 CCTGTGATGCCAGGAAGGAATGG - Intergenic
1153966027 18:10182564-10182586 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1154093999 18:11393464-11393486 CTTGTGGTGCCAGGCAGGAATGG - Intergenic
1155060204 18:22221848-22221870 CATGTGAGGCCAGACAGGAAAGG + Intergenic
1156011467 18:32501804-32501826 CCAGTGATGCCAGGCAGGAATGG + Intergenic
1156459661 18:37314667-37314689 CCTGGGGCACCAGCCAGGAAGGG - Intronic
1156500220 18:37552786-37552808 CGTGGGAAGCCAGGCAGGAAGGG - Intronic
1156944579 18:42814092-42814114 CCTGTAAGGCCAGGCAGAAATGG - Intronic
1157218524 18:45806741-45806763 CCCGTGAGGCCAGGCAGAAATGG - Intergenic
1157699441 18:49751617-49751639 CCTGTGGGGACAGCCAGGATAGG + Intergenic
1158002529 18:52636216-52636238 CCTGTGGTGCCAAGCAGGAATGG - Intronic
1158331608 18:56368485-56368507 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1158385802 18:56990285-56990307 CCAGTGTTGCCTAGCAGGAAAGG + Intronic
1158756408 18:60331454-60331476 CCTGTGGTGCTAGGCAGGAATGG - Intergenic
1159383374 18:67691029-67691051 CCTGTTGTGCCAGGGAGAAATGG + Intergenic
1159787011 18:72726738-72726760 CCTGTGATGCCAGGCAGGAATGG - Intergenic
1160267684 18:77354164-77354186 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1160337032 18:78051255-78051277 TCTTTGGAGCCAGGCAGGCATGG + Intergenic
1160632652 18:80257591-80257613 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1160820613 19:1056044-1056066 TCTGTGGGGCCATGCAGGCAGGG - Exonic
1161332770 19:3696244-3696266 CCAGCAGTGCCAGGGAGGAAGGG - Intronic
1161446736 19:4322964-4322986 CCTGTGGCGCAGGGCAGGAGGGG - Exonic
1161894050 19:7066927-7066949 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1161990502 19:7681603-7681625 TCCGTGGGGCCAGGCAGGAGGGG - Intronic
1162372739 19:10289031-10289053 CATGTGGTGGCAGCCGGGAAGGG + Intergenic
1162613163 19:11772107-11772129 CCTTGGCTGCCAGGCAGGGAAGG + Intronic
1162729982 19:12712620-12712642 CCTCGGCTGCCAGGCAGGGAAGG + Intronic
1163013552 19:14440345-14440367 CCTGTGGGGGCAGGCAGAAGGGG + Intronic
1163456262 19:17407513-17407535 CCTCGGCTGCCAGGCAGGGAAGG - Intronic
1163471328 19:17498821-17498843 CCTCGGCTGCCAGGCAGGGAAGG - Intronic
1163479354 19:17545625-17545647 CCTCAGCTGCCAGGCAGGGAGGG - Intronic
1163655714 19:18543671-18543693 CCCGCGGGGCCAAGCAGGAAGGG - Intronic
1163881801 19:19930177-19930199 CCTTGGCTGCCAGGCAGGGAAGG - Intronic
1164083468 19:21880524-21880546 CCTCAGCTGCCAGGCAGGGAAGG - Intergenic
1164084622 19:21889794-21889816 CCTCAGCTGCCAGGCAGGGAAGG - Intergenic
1164237757 19:23351914-23351936 CCTGTGGTATCCAGCAGGAATGG - Intronic
1164251645 19:23482678-23482700 CCTGTGGTGCTAGGCAGGAATGG - Intergenic
1164261571 19:23572405-23572427 CCTCAGCTGCCAGGCAGGGAAGG + Intronic
1164267363 19:23632485-23632507 CCTTTGGTGCCAGACAAAAATGG - Intronic
1164288050 19:23839728-23839750 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1164320249 19:24137879-24137901 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1164389062 19:27802102-27802124 CCTTGGCTGCCAGGCAGGGAAGG - Intergenic
1164955169 19:32376880-32376902 CCTCTGCTGCCAGGCAGGGAAGG - Intronic
1165410169 19:35655053-35655075 GCTGTGTTGCCAGGCTGGAAAGG + Intronic
1165671203 19:37680803-37680825 CCTCGGCTGCCAGGCAGGGAAGG - Intronic
1165943194 19:39425438-39425460 CCTGTGGATCAAGGCAAGAAGGG - Exonic
1166407146 19:42529223-42529245 CAGGTGGTGCCAGGAGGGAATGG + Intronic
1166446811 19:42865220-42865242 CCTTGGTTGCCAGGCAGGGAAGG - Intronic
1166449322 19:42884660-42884682 CCTCAGCTGCCAGGCAGGGAAGG - Intronic
1166466000 19:43031450-43031472 CCTTGGCTGCCAGGCAGGGAAGG - Intronic
1166472134 19:43087519-43087541 CCTTGGCTGCCAGGCAGGGAAGG - Intronic
1166485746 19:43210558-43210580 CCTTGGCTGCCAGGCAGGGAAGG - Intergenic
1166492906 19:43274504-43274526 CCTCAGCTTCCAGGCAGGAAAGG - Intergenic
1166604350 19:44127158-44127180 CCTGTGATGCCAGGCAAGAATGG + Intronic
1166694895 19:44846735-44846757 TCTGTGGGGCCAGCCAGGAAGGG - Intronic
1166838905 19:45684226-45684248 CCTGAGAAGGCAGGCAGGAATGG + Intergenic
1166952491 19:46438859-46438881 CCCGTGGTGCCTGGCAGCAGAGG + Intergenic
1166952686 19:46440273-46440295 CCCGTGGTGCCTGGCAGCAGAGG + Intergenic
1166976282 19:46606957-46606979 TCTGCGGTGGGAGGCAGGAACGG + Intronic
1167017263 19:46849441-46849463 GCAGGGGTCCCAGGCAGGAAGGG + Intronic
1167301684 19:48681382-48681404 CCAGTGCTGCCAGGAAGGAGAGG - Intergenic
1167370065 19:49075433-49075455 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1167400750 19:49266939-49266961 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1167472817 19:49684900-49684922 CCTGGGGAGGCAGGCAGGGAGGG - Exonic
1167519066 19:49941597-49941619 CCTTGGCTGCCAGGCAGGGAAGG + Intronic
1167719576 19:51169085-51169107 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1167970272 19:53184897-53184919 CCTCGGCTGCCAGGCAGGGAAGG - Intronic
1167971367 19:53189481-53189503 CCTCGGCTGCCAGGCAGGGAAGG - Intronic
1167979135 19:53258302-53258324 CCTTGGCTGCCAGGCAGGGAAGG + Exonic
1167990960 19:53360286-53360308 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1168045243 19:53789746-53789768 CCTGTGGTGCCAGCTACTAAGGG - Intergenic
1168131473 19:54322654-54322676 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1168215088 19:54919411-54919433 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1168443976 19:56395927-56395949 CCTCGGCTGCCAGGCAGGAAAGG - Intergenic
1168458487 19:56534229-56534251 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1168480895 19:56718797-56718819 CCTTGGCTGCCAGGCAGGGAAGG - Intergenic
1168680299 19:58310524-58310546 CCTCGGCTGCCAGGCAGGGAAGG - Intronic
1202676642 1_KI270711v1_random:12964-12986 CCTGATGAGCCAGGCAGGACAGG + Intergenic
925099449 2:1232961-1232983 CCTGTGGTAACAGAGAGGAAAGG - Intronic
925124982 2:1448063-1448085 CCTGTGCTGTCAGGCAGGAGGGG - Intronic
925343217 2:3151024-3151046 CTTGTGTTGCCACGTAGGAATGG - Intergenic
925785458 2:7428193-7428215 CCTGTCTTTCCAGGCAGGGATGG - Intergenic
926699423 2:15793316-15793338 CCTGAGATGCCAGGTGGGAATGG + Intergenic
926916094 2:17893541-17893563 CCCGTGGTGCCAGGCAGGAATGG + Intronic
927018670 2:18995332-18995354 CCAGTGGTGGCAGGCTGGACAGG + Intergenic
928088234 2:28358927-28358949 CCTGTGCTGCCAGCCAGGTAGGG - Intergenic
928365528 2:30697800-30697822 CCTCGGCTGCCAGGCAGGGAGGG + Intergenic
928733655 2:34261261-34261283 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
929805924 2:45145065-45145087 CCTGTGATGCTGGGCAGGAACGG - Intergenic
930331622 2:49992527-49992549 ACTCTGTTGCTAGGCAGGAAGGG - Intronic
931160443 2:59684392-59684414 CCTCTGCTGTCAGGCAGCAATGG + Intergenic
931233666 2:60395338-60395360 CCTGTGGAGCCAGGCACCAGGGG + Intergenic
931790876 2:65663091-65663113 CCTGTGGTTGCTGGAAGGAAAGG + Intergenic
932100803 2:68897397-68897419 CCTGTGGTTCCAGAGAGGAATGG + Intergenic
932270298 2:70403339-70403361 CCTGTGGTGCCAGGCAGAAATGG - Intergenic
932673009 2:73754467-73754489 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
932682936 2:73842233-73842255 ACAGTGGCCCCAGGCAGGAATGG - Intronic
932954727 2:76337764-76337786 CCTGTGATGCCAGGCAGGAATGG + Intergenic
933121290 2:78541664-78541686 CCTGTGATGCCAGGCAGGAATGG - Intergenic
933154347 2:78955712-78955734 CCAGTTGTGCCAGGCAAGAGCGG + Intergenic
933207916 2:79530549-79530571 CCATTGTTTCCAGGCAGGAAAGG + Intronic
934210177 2:89968965-89968987 CCTGAAGTGCCAGGCATTAATGG - Intergenic
934543217 2:95193509-95193531 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
934766407 2:96882541-96882563 TCTGTAGTGCCAGCCAGGACAGG - Intronic
935881879 2:107573453-107573475 CCTCGGTTGCCAGGCAGGGAAGG + Intergenic
936019511 2:108984207-108984229 GCTGAGGTGCAGGGCAGGAAGGG - Intronic
936144150 2:109967950-109967972 CAGAGGGTGCCAGGCAGGAAAGG + Intergenic
936180832 2:110265911-110265933 CAGAGGGTGCCAGGCAGGAAAGG + Intergenic
936200538 2:110403519-110403541 CAGAGGGTGCCAGGCAGGAAAGG - Intronic
937057769 2:118953939-118953961 CCTGTGGTGCCAGCCAGGAGTGG - Intronic
937069345 2:119050760-119050782 CCTGTGGTTCCAGGCAGGAATGG + Intergenic
937375823 2:121335070-121335092 TCAGTGGCTCCAGGCAGGAACGG - Intergenic
937485539 2:122311174-122311196 CCTGTGGTCCTAGTCAGGCATGG - Intergenic
937521697 2:122720508-122720530 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
937529200 2:122808416-122808438 CCTGTGGTGCCAAGCAGGAATGG - Intergenic
937723133 2:125126668-125126690 CCTGTGGGGCAAGGCAGAAATGG + Intergenic
938038236 2:128054143-128054165 CCTATGGTGCCAGGCAGGAAAGG + Intergenic
938598359 2:132811889-132811911 CCTGTGGTGCCAGGCAGGAAGGG + Intronic
938998446 2:136705716-136705738 TTTGGGGTGGCAGGCAGGAAGGG - Intergenic
939345703 2:140964114-140964136 CCTCGGCTGCCAGGCAGGGAAGG - Intronic
939522435 2:143247370-143247392 CCAGTGGTGCCAGGCTGGACAGG - Intronic
939769489 2:146298406-146298428 TCTGTGGTGCCAGGCAGGAATGG - Intergenic
940034797 2:149302201-149302223 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
940172459 2:150843500-150843522 CCTGTGGTGCCAAACAGGAATGG + Intergenic
940217446 2:151315375-151315397 CCTGTGAGGCAAGGCAGAAATGG - Intergenic
940618773 2:156084250-156084272 CCTATGGTGTCAGGCAGGAATGG + Intergenic
940709476 2:157144433-157144455 CCTGTGGTGCCAGGTAGGAATGG + Intergenic
941627349 2:167844618-167844640 CTTGTGGTGCCCAGCAGGAAGGG - Intergenic
941631709 2:167891567-167891589 CCTGTGTGGCCAGGCAAAAACGG + Intergenic
941690320 2:168494716-168494738 CCAGTGGTGGCAGGCTGGACAGG + Intronic
941721966 2:168821824-168821846 CAAGTGGTGCCTGGCAGGAAGGG + Intronic
941928236 2:170916671-170916693 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
943621237 2:190150334-190150356 TCTGTGGTGCCAGGCAGGAATGG + Intronic
944528972 2:200649218-200649240 CCTGTGTTGTTAGGCAGGAATGG + Intronic
944874132 2:203944261-203944283 CCTGTGGTGCCTGGCAAGAATGG + Intronic
945132185 2:206584857-206584879 CCTATGGTGCTAGGCAGGAATGG + Intronic
945482662 2:210361284-210361306 CCTGTGTTACCAGGCAGGAATGG + Intergenic
945779572 2:214152801-214152823 CCTTGGCTGCCAGGCAGGGAAGG - Intronic
945864447 2:215161237-215161259 CTTGTGGTGTCAGGCAGGAATGG - Intergenic
946020917 2:216639407-216639429 CCTATGATGCCTGGCAGGATAGG + Intronic
946235905 2:218324125-218324147 CCCCTGGGGCCAGGAAGGAAGGG - Intronic
947141372 2:227022098-227022120 CCTGGGGCGCCAGGCATGAGAGG - Exonic
947457166 2:230265559-230265581 CCTGTGGTGCCAGGCAGGAATGG + Intronic
947500394 2:230667031-230667053 CCTCTGGGGCCAGGCAGGCCTGG + Intergenic
947606574 2:231489819-231489841 CCTTGGCTGCCAGGCAGGGAAGG - Intergenic
947722996 2:232380584-232380606 CCTGTGGTGACTGGCAGGCTGGG - Intronic
947727346 2:232408665-232408687 CCTGTGGTGACTGGCAGGCTGGG - Intronic
948110599 2:235452375-235452397 CTTGTGATGCCAGGAAGTAAGGG - Intergenic
948837137 2:240631284-240631306 CGTGTGGTGGGAGGCAGGGAGGG + Intergenic
948931092 2:241132884-241132906 GCTGAGGTGAGAGGCAGGAAAGG + Exonic
949019322 2:241732340-241732362 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
949046712 2:241875564-241875586 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1168906136 20:1405234-1405256 CCAGTGGTGGCAGGCTGGATGGG + Intergenic
1169295501 20:4393900-4393922 CCTCAGCTGCCAGGCAGGGAAGG - Intergenic
1169336290 20:4759937-4759959 CCTGTTATGCCAGGCAGGAATGG + Intergenic
1169401247 20:5282515-5282537 CCTGTGATGCCAGGCAGGAATGG - Intergenic
1169517557 20:6333652-6333674 CCTGTTGTGCCAGGCAGGAATGG + Intergenic
1170245851 20:14220640-14220662 CCTGGGGTGCCAGGCAGGAATGG + Intronic
1170374686 20:15687605-15687627 CCTGTGGTCCCAGGGAGCACTGG - Intronic
1170375909 20:15699872-15699894 CTTGTGGTGCCAGGCAGGAATGG + Intronic
1170721111 20:18879749-18879771 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1170863247 20:20128302-20128324 CCTGTGGTGCCAGGCAGGAATGG + Intronic
1171160396 20:22916867-22916889 CCTGTGATGACAGGCAGGAATGG + Intergenic
1172289462 20:33765716-33765738 CCTTTGGTGCTAGGCACTAAAGG - Intronic
1172358934 20:34298903-34298925 CCTCGGCTGCCAGGCAGGGAAGG + Intronic
1172537747 20:35687441-35687463 CCTTGGCTGCCAGGCAGGGAAGG + Intronic
1173192128 20:40884722-40884744 CCTGTGGTGCCTGGCACATAGGG - Intergenic
1173913646 20:46689602-46689624 CCTGAGGTTCCCTGCAGGAAGGG + Exonic
1174584572 20:51598053-51598075 CCTGTGGTGCCAGGTGAGACAGG - Exonic
1175532030 20:59680345-59680367 CCAGTGGTGGCAGGCTGGACAGG + Intronic
1175550658 20:59815054-59815076 CCTGTGGACCCAGGCTGGACTGG + Intronic
1176076592 20:63251132-63251154 CCTCGGCTGCCAGGCAGGCAAGG - Intronic
1176420297 21:6508659-6508681 CCTTGGCTGCCAGGCAGGGAAGG - Intergenic
1177195682 21:17901309-17901331 TCTGTGGTCCCAGGCAGGAATGG + Intronic
1177847337 21:26306003-26306025 CCGGTAATGCCAGGCAAGAATGG - Intergenic
1177857698 21:26418256-26418278 CCTGTGATCCCAGCCAGGCACGG - Intergenic
1177995438 21:28090407-28090429 TTTGTGTTGCCAGGCAGGAATGG + Intergenic
1178059283 21:28834526-28834548 CCTGTGGTGACAGGCAGGAATGG - Intergenic
1178095698 21:29212604-29212626 ACTGGGGTGTCTGGCAGGAAGGG - Intronic
1178587183 21:33880390-33880412 CCTGTCTTGGCAAGCAGGAAGGG + Intronic
1178801594 21:35800942-35800964 TCTGTGGTGCCAGGCAGGAATGG - Intronic
1178958944 21:37046913-37046935 CCTGCGGTGCCAGGCAGCAATGG - Intergenic
1178969613 21:37161222-37161244 CCTTTGGTGAGAGGAAGGAAGGG - Intronic
1179050223 21:37882661-37882683 ACTGTGGTGGGAGGCAGGCAGGG + Intronic
1179084295 21:38203598-38203620 CCTGTGAGGCAAGGCAGAAATGG + Intronic
1179183692 21:39066963-39066985 CCTGTGGAGAAAGGCAGGAGAGG - Intergenic
1179571835 21:42283066-42283088 CCAGTTGTCCCAGGCAGGATGGG + Intronic
1179655087 21:42839781-42839803 CCAGGGGTGTCTGGCAGGAAGGG + Intergenic
1179695789 21:43116979-43117001 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1179916130 21:44479369-44479391 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1179916313 21:44480429-44480451 CCTGCGGGGCCAGGAAGGATAGG - Intergenic
1179986023 21:44920695-44920717 CCAGGGGTGTCTGGCAGGAAGGG - Intronic
1180201003 21:46224204-46224226 CCTCGGCTGCCAGGCAGGGAAGG + Intronic
1180246652 21:46552995-46553017 CCAGTGGCTCAAGGCAGGAAAGG + Intronic
1180591739 22:16944291-16944313 TGTGTAGTACCAGGCAGGAATGG - Intergenic
1180621622 22:17166447-17166469 CCTGGGGAGTCAGGGAGGAACGG - Intergenic
1180710030 22:17833153-17833175 CCTGTGGAGGGAGGCAGGACAGG + Intronic
1180830773 22:18904926-18904948 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1180945530 22:19690456-19690478 GCGGTGGTGCCAGGAAGCAAGGG - Intergenic
1180947713 22:19705774-19705796 CCACCGGTGCCAGGCAGGCAGGG - Intergenic
1180951117 22:19721093-19721115 CGTGTGGTGCTTGGCAGGTATGG + Intronic
1181371069 22:22417266-22417288 CCTGTGGTGCCAGAAAGGAATGG - Intergenic
1181729871 22:24837275-24837297 CCTCAGCTGCCAGGCAGGGAAGG - Intronic
1181837859 22:25625839-25625861 CCTCGGCTGCCAGGCAGGGAAGG + Intronic
1181864947 22:25847493-25847515 CCTGTGGTGGAAAGCAGGAGTGG + Exonic
1181986059 22:26800555-26800577 CCTCAGGGGCCAGCCAGGAATGG + Intergenic
1182082211 22:27537611-27537633 CCTGGGGAGACAGGAAGGAAGGG - Intergenic
1182116964 22:27762089-27762111 CCGGAGGTGCCAGGCAGGACAGG - Intronic
1182703895 22:32262491-32262513 CCTCAGGGGCCAGGCAGGACAGG + Intergenic
1182930263 22:34167016-34167038 CCAGTGGTGGCAGGCTGGACAGG + Intergenic
1183048541 22:35241541-35241563 CCGGTGGTGCCAGGCAGGAATGG + Intergenic
1183575505 22:38686115-38686137 CCTGTGGTGCCAAGCAGGTCTGG + Exonic
1184136284 22:42551803-42551825 CCTTGGGTGCCAGGCGGGGAAGG - Intergenic
1184176773 22:42793437-42793459 CCTGTGGTACCAGGCAATAAGGG + Intergenic
1184344404 22:43904193-43904215 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1184351614 22:43947768-43947790 CCTCAGCTGCCAGGCAGGGAAGG - Intronic
1184673975 22:46030386-46030408 CCTGTGGTCTGGGGCAGGAAGGG - Intergenic
1185087990 22:48750982-48751004 CCCGGGGTGCCAGGCACGGAAGG + Intronic
1185336670 22:50273930-50273952 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1203280862 22_KI270734v1_random:130197-130219 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
949604132 3:5634812-5634834 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
949814159 3:8040646-8040668 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
949864497 3:8536270-8536292 CCCATGGTGACAGGCCGGAAAGG + Intronic
950401323 3:12771318-12771340 CCTTGGCTGCCAGGCAGGGAAGG + Intergenic
950592480 3:13948254-13948276 CCTGTGGTGTCAGGCAGGAATGG + Intronic
950860711 3:16145318-16145340 GCTGTGGTGGCAGGCAGGACAGG + Intergenic
951967046 3:28398811-28398833 CCTGTGAGGCCAGGCAGATATGG - Intronic
952097283 3:29968461-29968483 CCTGTGGTGCCAGGCAGGAATGG + Intronic
952395739 3:32918995-32919017 CCTTTGGGGCCAGGGAGGAGGGG + Intergenic
953059793 3:39417938-39417960 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
953084614 3:39654419-39654441 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
953284397 3:41592345-41592367 CCTGTGAGGCAAGGCAGAAATGG - Intronic
953294179 3:41696386-41696408 CCTTGGCTGCCAGGCAGGGAAGG + Intronic
953724042 3:45382009-45382031 CCTGTGGTGCTAGGCAGGAATGG + Intergenic
953869232 3:46611967-46611989 CCTCTGGTTCCAGGGAGAAAGGG - Intronic
954144824 3:48629327-48629349 CCTGGGGCGCCAGGTTGGAAGGG - Intronic
955175735 3:56611697-56611719 CCTGTGGTGCCAGGCAGGGATGG + Intronic
955461708 3:59190120-59190142 CTTCTGGTGCCAGAAAGGAATGG + Intergenic
956504221 3:69920592-69920614 CCTCAGCTGCCAGGCAGGGAAGG + Intronic
956950184 3:74273687-74273709 CCTGTGATGCCAGGCAGGAGTGG - Intronic
956995778 3:74824952-74824974 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
957016488 3:75069920-75069942 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
957427824 3:80063489-80063511 TCTGTGGTGCCAGGCAGGAATGG - Intergenic
957971635 3:87390294-87390316 CCTGTGAAGCCAGGCAGAAATGG - Intergenic
957982325 3:87525850-87525872 CCTGTGGAAGCAGCCAGGAAGGG + Intergenic
958647200 3:96888201-96888223 CCTGTGGTGCCAGGCAGGAATGG + Intronic
958657268 3:97018525-97018547 CCTCAGCTGCCAGGCAGGGAAGG - Intronic
958770588 3:98421499-98421521 CCTGTGAGGCCAGGCAGAAATGG - Intergenic
958970028 3:100601086-100601108 CCTGTGGTGCCAGGCAAGAGTGG + Intergenic
959046902 3:101484751-101484773 CCTGTGGTGCCAGGCAGGAATGG - Intronic
959275312 3:104270095-104270117 CCTGTTGTGCCAGATAGGAATGG + Intergenic
959279698 3:104323003-104323025 TCTGTGGTGCCAGGCAGGAATGG - Intergenic
959436071 3:106316921-106316943 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
959715822 3:109431578-109431600 CCTGTGAGGCAAGGCAGAAATGG + Intergenic
959757051 3:109911278-109911300 CCTGTGGTGCCAGGAAGGAATGG + Intergenic
959802595 3:110512775-110512797 CCTGTGATGTCAGGTAGAAATGG + Intergenic
959997178 3:112692999-112693021 CCTGTGATGCCAGGTAGGAATGG - Intergenic
960015681 3:112885253-112885275 CCAGTGGGTGCAGGCAGGAAAGG + Intergenic
960512996 3:118572426-118572448 CCTTTGGTGCCAGACAGGAATGG + Intergenic
960524685 3:118695870-118695892 CCTGTGGTGCCAGGCAGGGATGG - Intergenic
961642458 3:128373259-128373281 AATGTGGAGCCAGGCAGGCAGGG + Intronic
962066083 3:131981702-131981724 ACTGTGGTGCCAGGCAGGAGTGG + Intronic
962220160 3:133558253-133558275 CCAGTGGTGGCAGGCTGGATGGG - Intergenic
962480312 3:135792478-135792500 CCAGTGGTGCCAGGTAGAAGAGG - Intergenic
962872713 3:139512054-139512076 CCCATGGTGCCAGGCAGGAGAGG - Intergenic
962978563 3:140467563-140467585 CCTGGGGCCCCAGGGAGGAAGGG - Intronic
964101428 3:152992614-152992636 CCTGGGCTGCCAGGCAGGGAAGG + Intergenic
964160557 3:153640611-153640633 CCTGGGGTGCCAGGCAGGAATGG - Intergenic
964188911 3:153979946-153979968 ACTGTGATGCCATGCAGAAATGG - Intergenic
964658407 3:159093540-159093562 CCTGGGGAGCCTGGCAGGACAGG + Intronic
964917572 3:161854942-161854964 CCTGTGGTTCCAGGCAGGAATGG + Intergenic
965052780 3:163671725-163671747 CTTGTGGTGCCAGGCAGGAATGG + Intergenic
965439768 3:168698689-168698711 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
965520641 3:169665719-169665741 CCTGGGGTGCCTGGCAGGGAAGG - Intergenic
965644003 3:170860789-170860811 CCTCAGCTGCCAGGCAGGGAAGG + Intergenic
965823198 3:172705558-172705580 CCAGTGGTGGCAGGCAGGGCAGG - Intronic
966020517 3:175203258-175203280 CCTGTGATTCCAGGCAGGAATGG + Intronic
966117768 3:176485591-176485613 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
966686724 3:182703591-182703613 CCTGTGAGGCCAGGAAGGAATGG + Intergenic
966815578 3:183887229-183887251 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
966834596 3:184039187-184039209 CCTGAGGAGCCAGGGAGGTATGG - Exonic
966992094 3:185242978-185243000 TCTGTGATGCTAGGCAGGAATGG + Intronic
967208993 3:187150158-187150180 CCTGTGGTGCCAGGCAGGAATGG - Intronic
967257606 3:187609449-187609471 TCTGTGGTGCCAGGCAGGAATGG + Intergenic
967399852 3:189049010-189049032 GCTGTGGTGCCATGCAGGAATGG - Intronic
968050875 3:195654215-195654237 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
968104949 3:195994123-195994145 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
968303244 3:197631710-197631732 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
968350939 3:198051380-198051402 CCTTGGCTGCCAGGCAGGGAAGG + Intergenic
968397810 4:259824-259846 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
968443107 4:634384-634406 CGTGAGGTGCCAGGCAGGGCGGG + Intronic
968685847 4:1958150-1958172 TCTGTGGTGCCTGGCATGGATGG + Intronic
969642399 4:8406671-8406693 CCTCAGCTGCCAGGCAGGGAAGG - Intronic
969643440 4:8412741-8412763 CATGTGGTGGCAGGGAGGCAGGG + Intronic
969781557 4:9408557-9408579 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
970311986 4:14792681-14792703 CCTGTGATTCCAGGCAGCAGTGG - Intergenic
970346669 4:15159213-15159235 CCTGTGGTGTCAGGCAGGAATGG + Intergenic
970658715 4:18260656-18260678 CCTGTGGTGTCAGGCAGGAATGG + Intergenic
970995999 4:22268496-22268518 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
971183219 4:24349920-24349942 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
971901084 4:32658629-32658651 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
972048729 4:34702173-34702195 CCTGTGAGGTGAGGCAGGAATGG - Intergenic
972189149 4:36569058-36569080 TCTTTGATGCCAGGCAGAAATGG + Intergenic
972292057 4:37698462-37698484 CCTGTGGTGCAAGCGTGGAAGGG - Intergenic
972321221 4:37975215-37975237 CCTCGGCTGCCAGGCAGGGAAGG - Intronic
973179685 4:47252135-47252157 CCTGTGGTGCCAGGCAGGAATGG + Intronic
973245245 4:48004170-48004192 CCTCAGCTGCCAGGCAGGAAAGG + Intronic
973782311 4:54300305-54300327 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
974474532 4:62362015-62362037 CCCATGGTGCCAGGCAGGAATGG + Intergenic
974493412 4:62595842-62595864 CCTCCGCTGCCAGGCAGGGAAGG + Intergenic
975033724 4:69656747-69656769 CCTGTGGTGCCAGGCAGGTATGG - Intergenic
975387445 4:73773840-73773862 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
975517177 4:75259861-75259883 CCTGTGGTGTCAGGCAGGAATGG - Intergenic
976551949 4:86406747-86406769 CCAGTGGTGACAGGCTGGACAGG + Intronic
976556101 4:86453123-86453145 CCTGTGAGGCCAGGCAGAAATGG - Intronic
976856390 4:89609797-89609819 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
977020090 4:91747361-91747383 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
977116170 4:93031415-93031437 CTTGTGGTGTCAGGCAGCAGGGG - Intronic
977657226 4:99536301-99536323 CCAGTGCTGGCAGGCTGGAATGG + Intronic
977733134 4:100379518-100379540 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
977746703 4:100558264-100558286 CCTGTGGTGCCAGGCAGGAATGG - Intronic
977852568 4:101847979-101848001 CCTTTGGCGCCAGCGAGGAATGG + Intronic
977904607 4:102461064-102461086 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
978670606 4:111244000-111244022 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
978726783 4:111978085-111978107 CCTGTGGTGTCAGGCAGGAATGG + Intergenic
979498516 4:121411783-121411805 CCTGTGATGCCAGCCAGGAATGG + Intergenic
979625034 4:122835004-122835026 CCTGTGGCCCCACCCAGGAATGG + Intronic
979704761 4:123708878-123708900 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
979794986 4:124834783-124834805 CTGGTGGTACCAGGCAGGAATGG + Intergenic
979995384 4:127425740-127425762 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
980133457 4:128837924-128837946 CATGTTGTGCCATGCATGAAAGG - Intronic
980523451 4:133960442-133960464 CTTGTGATGCCAGGCAGGAATGG - Intergenic
981346547 4:143683544-143683566 CCTGTGATGCCAGGCAGGAATGG - Intronic
981376707 4:144024710-144024732 CCTGTGAGGCAAGGCAGAAATGG - Intergenic
981401054 4:144314017-144314039 CTTGTGGTGCCAGGCAGGAATGG + Intergenic
981461021 4:145013956-145013978 CCTGTGATGCCAGGCAAGAATGG - Intronic
981559643 4:146033108-146033130 CCTATGGTACCAGAGAGGAATGG - Intergenic
981760885 4:148193097-148193119 CCTGTGGTGTCAGGTAGGAGTGG + Intronic
981777828 4:148390452-148390474 TGGGTGGTGGCAGGCAGGAAAGG + Intronic
981831645 4:149008695-149008717 ACTGAGGTGCCAGGAAGAAAAGG - Intergenic
982190021 4:152844035-152844057 CCTGTGGTACCAGGCAGGAATGG + Intronic
982218862 4:153107537-153107559 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
982312237 4:153997806-153997828 CCTGTGGTACCAGGCAGGAATGG + Intergenic
982680241 4:158419498-158419520 CCTGTGGTGCCAGGTAGGAATGG + Intronic
983011318 4:162550949-162550971 CCTCAGCTGCCAGGCAGGAGAGG + Intergenic
983449694 4:167895001-167895023 CCTGTGGTGCCAACCAGGAATGG - Intergenic
983597800 4:169490220-169490242 CCTCTGGTTCCAGGTAGGCACGG - Intronic
984069284 4:175092220-175092242 CCAGTGGTCCCAGGCAGTGAGGG + Intergenic
984266791 4:177505861-177505883 CCTGTGGTGCCAGGCAGGCATGG + Intergenic
984323481 4:178223935-178223957 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
984475067 4:180225157-180225179 CCTGTGAGACCAGGCAGAAATGG + Intergenic
984527640 4:180875865-180875887 CCTGGGGTGCCAGGCAGGAATGG + Intergenic
985091121 4:186363613-186363635 CCTCAGCTGCCAGGCAGGAAAGG + Intergenic
985613286 5:902853-902875 CCTCAGCTGCCAGGCAGGGAAGG - Intronic
986728424 5:10617537-10617559 ACTGTGGGGCCAGGCAGGCAAGG - Intronic
986870163 5:12036418-12036440 CCTGTGAAGCCAGGCAAAAATGG - Intergenic
987359696 5:17095647-17095669 CCTCAGCTGCCAGGCAGGGAAGG - Intronic
987836756 5:23172258-23172280 ACAGTGGTGCCAGGCCTGAATGG - Intergenic
988344520 5:30020654-30020676 CCTGTGGTGCCAGGAAGAAATGG - Intergenic
988712677 5:33794040-33794062 CCTGTGGTGCCCAGCGGGAATGG + Intronic
988723645 5:33903773-33903795 CCTGTGAGGCCAGGCAGAAATGG + Intergenic
988902134 5:35745192-35745214 CCTGTGATGCCCAGCAGGAATGG - Intronic
990712913 5:58604930-58604952 CCTGTGGTGCCAGGCAGGAATGG + Intronic
990776304 5:59309377-59309399 CCTGTGATGCCAGGCATGGATGG + Intronic
991117328 5:62969792-62969814 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
991923786 5:71683950-71683972 CCTGTGATGCCAGGCAGGAATGG - Intergenic
992435450 5:76751618-76751640 CCTGGTGTGCCAGGCCGAAAGGG + Intergenic
993250377 5:85513500-85513522 GGATTGGTGCCAGGCAGGAATGG + Intergenic
993883964 5:93395200-93395222 CCTGTGGTGCTGGGCAAGAATGG + Intergenic
993889303 5:93454254-93454276 CCTCTGTTGCCAGGCTGGAGTGG - Intergenic
993916964 5:93755752-93755774 CCTGTGATGCCAGGCAGGAATGG - Intronic
993964688 5:94346693-94346715 CCTGTGGTGCCAGGCAGGAATGG - Intronic
994222266 5:97209132-97209154 CCTGTGAGGCCAGGCAGAAATGG + Intergenic
994516182 5:100775356-100775378 CCTTGGCTGCCAGGCAGGGAAGG + Intergenic
994568467 5:101483371-101483393 CCTATGGTGCCAGGCAGGAATGG + Intergenic
994875221 5:105413525-105413547 CCTGTTGTGCCAGGCAGGAATGG - Intergenic
994883662 5:105529705-105529727 CCTGTGATGCCAGGCAGGAATGG + Intergenic
995317985 5:110797770-110797792 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
995473105 5:112523739-112523761 CCTGTGGTGTCATGCAGGAATGG + Intergenic
995817720 5:116191166-116191188 CCTGTGGTGTCATGCAGGAATGG - Intronic
996010664 5:118478718-118478740 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
996124240 5:119706565-119706587 CCTGTATTGCTAGGCAGGAATGG + Intergenic
996289027 5:121829467-121829489 CCTGTGTTGCCAGGCAGGAATGG + Intergenic
996295617 5:121912131-121912153 ACTGTGGTGCCAGGCTGGCTTGG + Intergenic
996325341 5:122267086-122267108 CCTGTGGTGCCAGGCAGGAGTGG - Intergenic
996504880 5:124257641-124257663 CCTGTGGTGCCAGGCAGGAGTGG + Intergenic
997106073 5:131020194-131020216 CCTGTGAGGCGAGGCAGAAAGGG + Intergenic
997439059 5:133896476-133896498 CCTTTGATGCCAGGCAGACAAGG + Intergenic
997512370 5:134462400-134462422 CCTGGGGAGCCAGGCAAGGAGGG + Intergenic
997586678 5:135047666-135047688 CCTGAGGTGCCTGGCAGGCTAGG + Intronic
997690498 5:135824716-135824738 CCTGTGTGACCAGCCAGGAAGGG - Intergenic
997760844 5:136446127-136446149 CCCGTGGTGCCAGGCAGAGATGG - Intergenic
997890632 5:137673281-137673303 CCAGTGGTGGCAGGCTGGACAGG - Intronic
997971952 5:138410779-138410801 CCTCGGCTGCCAGGCAGGGAAGG - Intronic
998129013 5:139641841-139641863 CCTTTGGAGCCTGGCAGGTAGGG + Intergenic
998358333 5:141560902-141560924 CCTGAGGTGGAAGCCAGGAAAGG + Intronic
998444719 5:142189748-142189770 CCTGTGGTGCTGGACAGGGAGGG + Intergenic
998539300 5:142965042-142965064 CCTTGGCTGCCAGGCAGGGAAGG - Intronic
998620658 5:143790965-143790987 CCTGTGTGGCAAGGCAGGGAAGG + Intergenic
998777567 5:145619317-145619339 CCTGTGATGTTAGGCAGGAATGG + Intronic
998940756 5:147280133-147280155 CCTGTGGTGCCAGGCAGGAATGG - Intronic
999052275 5:148535199-148535221 CCTGTGAAAGCAGGCAGGAAAGG + Intronic
999287236 5:150401498-150401520 CCTGCGGGGCCAGGCAGGCCTGG - Intergenic
999437836 5:151577892-151577914 CCTGGGGTGGCAGGGAGGGAAGG + Intergenic
999440946 5:151600259-151600281 CCTGGGGTGGCAGGCTGGACTGG - Intergenic
999818416 5:155200548-155200570 CCTGTGGTGCTGGGCAGGAATGG - Intergenic
999903783 5:156117005-156117027 TCTATGGTGGCAAGCAGGAAAGG - Intronic
1000779567 5:165464573-165464595 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1002813754 6:659731-659753 CCTGTGGTGCCAGGCAGGAATGG - Intronic
1002868824 6:1147526-1147548 TCTGTGCTGACAGGCTGGAAAGG + Intergenic
1003029522 6:2589702-2589724 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1003063062 6:2877252-2877274 CCTGTGGTGCCAGACAGGAATGG - Intergenic
1003450792 6:6229966-6229988 TCTGTGGTGCCAGGCAGGGATGG - Intronic
1003581846 6:7347465-7347487 CCTGTGGGGCCAGGCAGGAAGGG - Intronic
1003712009 6:8602819-8602841 CCTGTGGTTCCAGGCAGGAATGG + Intergenic
1003909199 6:10728011-10728033 CCTGTGGTGACAGGGAGCATGGG - Intronic
1005072409 6:21874196-21874218 TCTGTGATGCCAGGCAGGAATGG - Intergenic
1005709761 6:28491759-28491781 CCTCAGCTGCCAGGCAGGGAAGG + Intergenic
1005896951 6:30186411-30186433 CCTGGGGTGCTAGGCAGCAAGGG - Exonic
1006054570 6:31373941-31373963 CCTTGGCTGCCAGGCAGGGAAGG - Intergenic
1006465916 6:34194978-34195000 CCTGGGATTCCAGGCAGGGATGG - Intergenic
1006569252 6:34987070-34987092 CCTGTGGTCCTAAGCAGAAACGG + Intronic
1006638198 6:35474975-35474997 CCAGGGGTGCCAGGCAGGTGTGG + Exonic
1006652102 6:35559986-35560008 CCTCAGCTGCCAGGCAGGGAAGG - Intergenic
1007738571 6:43997526-43997548 CCTGTTGTGCCAGCCAGGTAGGG + Intergenic
1008121546 6:47622457-47622479 CCTGTGGTGCCAGGCAGGAATGG + Intronic
1008216609 6:48797600-48797622 CCTTGGCTGCCAGGCAGGGAAGG - Intergenic
1008305241 6:49891968-49891990 TCTGTGGTGCCAGGCAAGAATGG - Intergenic
1008528710 6:52434297-52434319 CCTGTGAAGCAAGGCAGAAATGG + Intronic
1008606454 6:53144667-53144689 CCTGTGGTCCCAGGTAGGCAGGG + Intronic
1008775486 6:55032439-55032461 CCTGTGAGGCAAGGCAGAAATGG + Intergenic
1009384214 6:63069097-63069119 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1009453081 6:63824778-63824800 CCTGTGGTGCCAGGCAGGAATGG - Intronic
1009505314 6:64469985-64470007 CCTTGGCTGCCAGGCAGGGAAGG + Intronic
1009798431 6:68502467-68502489 CCTGTGAGGCTAGGCAGAAATGG - Intergenic
1009968688 6:70604216-70604238 CCTGTGGTGCCAGGTGGGAATGG - Intergenic
1010009041 6:71028660-71028682 CCTGTGGTGCTATGCAGGAATGG + Intergenic
1010076450 6:71803827-71803849 TGTGCGATGCCAGGCAGGAATGG + Intergenic
1010165190 6:72906514-72906536 CCCATGGTGCCAGGCAGTGATGG + Intronic
1010262333 6:73831160-73831182 GCTTTGGTGCCAGGCAGGCCTGG + Intergenic
1010663461 6:78598499-78598521 TCTGTGGAGCCAGGCAGGGTAGG + Intergenic
1010679239 6:78780832-78780854 CCTGTTGTGCTAGGCAGGAATGG - Intergenic
1011133240 6:84073201-84073223 CCTATGGTGCTAGGCAGGAATGG + Intronic
1011168543 6:84479034-84479056 CCTGTGATGCCAGGCAGGAATGG - Intergenic
1011191919 6:84738439-84738461 CCTGAGTTTCTAGGCAGGAACGG + Intronic
1011233244 6:85187498-85187520 CATGTGGTACCAGGCAGGAACGG - Intergenic
1011328296 6:86174918-86174940 CCTTGGCTGCCAGGCAGGGAAGG - Intergenic
1011329151 6:86184304-86184326 CCCATGGTGCCAGGCAGGAATGG + Intergenic
1011789833 6:90885937-90885959 TCTATGGTGTCAAGCAGGAATGG + Intergenic
1011893397 6:92194518-92194540 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1012155880 6:95819506-95819528 CTTGTGGTGCCAGGCAGGAATGG - Intergenic
1012793655 6:103733916-103733938 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1012806700 6:103903742-103903764 CTGTTGGTGCCAGGAAGGAATGG + Intergenic
1012922596 6:105235010-105235032 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1013589512 6:111608380-111608402 CCTTGGCTGCCAGGCAGGGAAGG + Intergenic
1013852721 6:114535049-114535071 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1013877785 6:114855491-114855513 CCTGTGGTGCCTGGCAGGAACGG - Intergenic
1013901080 6:115156623-115156645 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1014057471 6:117033085-117033107 TCTATGTTGCCAGGCAGGAAAGG + Intergenic
1014234831 6:118941714-118941736 ACTGTGTTGCCAGGCTGGAGTGG - Intergenic
1014304904 6:119727936-119727958 CCTGTGGTGCCAGGCATGAATGG + Intergenic
1014336753 6:120147081-120147103 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1014427052 6:121320983-121321005 CCTGAGATGCCAGGCAGGATAGG + Intronic
1014603808 6:123448110-123448132 CCTGTGGTGCCAGGCAGGAATGG - Intronic
1014738684 6:125123977-125123999 CCTGTGGTGCCAGGCAGGAATGG - Intronic
1015362455 6:132355266-132355288 CCTGTGGTACCAAGCAGGGATGG + Intronic
1015501376 6:133937056-133937078 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1015849880 6:137560582-137560604 CCTGTGAGGCCAGGCAGGAATGG + Intergenic
1016116419 6:140290955-140290977 CCAGTGGTGATAGGCTGGAAAGG - Intergenic
1017190572 6:151648808-151648830 CTTGTGATGCCAGGCAGGAGTGG + Intergenic
1017763263 6:157587476-157587498 CCTGGGGTGCCAGGCAGATGTGG + Intronic
1018009312 6:159655330-159655352 CTGGTGGTGCCAGGCAGGAATGG - Intergenic
1018551757 6:165006527-165006549 CCTGTGGTGCTTTGCAGGTAAGG - Intergenic
1018814053 6:167317742-167317764 CCCGTGGTGCAAGGCAGGAAAGG - Intergenic
1019109368 6:169697706-169697728 CCTTGGCTGCCAGGCAGGGAAGG + Intronic
1019412431 7:912140-912162 CTGGTGGTACCAGGCAGGGATGG - Intronic
1019960909 7:4458667-4458689 CCTATGGGGCCAGGGAGGAATGG + Intergenic
1020101733 7:5397660-5397682 CCTGACGGGCCAGGCGGGAAAGG - Intronic
1020634822 7:10684563-10684585 CCTGTGAGGCCAGGTAGGAATGG - Intergenic
1020860705 7:13489129-13489151 CCTGTGGTGCCAGACAGGAATGG - Intergenic
1020915159 7:14184159-14184181 GGTATGGTGCCAGGCAGGAACGG - Intronic
1021080959 7:16364400-16364422 CCTTTTGTGCCAGGCAGATAAGG + Intronic
1021315855 7:19145907-19145929 CCCTTGATGCCAGGCAGGCAGGG - Intergenic
1022189326 7:28001792-28001814 CCAGTGGTGGCAGGGAGGACTGG + Intronic
1022500816 7:30881473-30881495 CCTGGGGAGCCAGGAGGGAAAGG - Intronic
1022777790 7:33545324-33545346 CCTGTGGTGCCAGGCAGAAATGG + Intronic
1022894941 7:34740519-34740541 CCTGTGAGGCAAGGCAGAAATGG + Intronic
1022947385 7:35301006-35301028 CCAGTGGTGCCGGGCTGGACAGG - Intergenic
1023021771 7:36017596-36017618 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1023074328 7:36468036-36468058 CCTTGGCTGCCAGGCAGGGAAGG + Intergenic
1023159046 7:37279705-37279727 CCTGTGGTGCCAGGTGGTAATGG - Intronic
1023701173 7:42893143-42893165 GCTGTGGTGCCAGGCAGGAATGG - Intergenic
1023827732 7:44020753-44020775 CCTTGGCTGCCAGGCAGGGAAGG + Intergenic
1024669370 7:51577942-51577964 CCTGTGGTGCCAGGCAGAAATGG + Intergenic
1024745453 7:52400402-52400424 CCTGTGGTGCTAGGCAGGAATGG + Intergenic
1024917970 7:54525054-54525076 CCTGTGAGGCCAGGCAAAAATGG + Intergenic
1025772714 7:64528176-64528198 CTTGTGATGCCAGGAAGGAATGG - Intronic
1025872357 7:65446878-65446900 CCTCAGCTGCCAGGCAGGGAAGG - Intergenic
1026786287 7:73303707-73303729 TCGGTGGGGCCAGGCAGGCAGGG + Exonic
1027350541 7:77306806-77306828 CCTGTGGTGCCAGGCAGGAATGG + Intronic
1027417733 7:77990665-77990687 CTGGTGGTGCCAGGTAAGAATGG + Intergenic
1028922257 7:96321764-96321786 CCTGTGCTGCCCGGGAGGAGTGG + Intronic
1028993663 7:97076426-97076448 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1029225238 7:99022258-99022280 CCAGTTGTGCCAGGGAGGAATGG - Intergenic
1029277430 7:99415306-99415328 GCCTTGGTGCCAGGCAGGCAAGG - Intronic
1029284744 7:99457841-99457863 CCTGTGGCTCCAGGCAGGGATGG - Intronic
1029345977 7:99979266-99979288 CCTTGGCTGCCAGGCAGGGAAGG + Intergenic
1029458157 7:100681238-100681260 CCTTGGGGGCCAGGCAGGACAGG + Exonic
1029477192 7:100792103-100792125 CGTCTGGTGACAGGCAGCAAAGG - Exonic
1029562139 7:101309494-101309516 CCTTGGCTGCCAGGCAGGGAAGG - Intergenic
1029699656 7:102237913-102237935 CCTCGGCTGCCAGGCAGGGAAGG - Intronic
1029756034 7:102574175-102574197 CCTCGGCTGCCAGGCAGGGAAGG + Intronic
1029773976 7:102673247-102673269 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1029884272 7:103850470-103850492 CCTGTGGTGCCAGGCAGGAATGG - Intronic
1030325124 7:108211259-108211281 TCTGTGGTGCCAGGCAGGAATGG - Intronic
1030606652 7:111645168-111645190 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1030935900 7:115584922-115584944 CCTGGGATGCCAGGCAGGAATGG - Intergenic
1030967429 7:116010078-116010100 CCTGTGGTGAAAGGAAGCAAGGG + Intronic
1031761333 7:125716431-125716453 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1031879140 7:127176876-127176898 CCTGTGGTGCCAGGCAGGAATGG - Intronic
1032758615 7:134916191-134916213 CCTCTGGAGTCAGGCAGGTAGGG + Intronic
1033574060 7:142663053-142663075 CCTCGGCTGCCAGGCAGGAAAGG + Intergenic
1033785697 7:144727432-144727454 CCTCGGCTGCCAGGCAGGGAAGG + Intronic
1034606374 7:152319847-152319869 CCTCAGCTGCCAGGCAGGGAAGG + Intronic
1034683281 7:152947442-152947464 CCTGTGAGGCCAGGCAGAAATGG + Intergenic
1034897289 7:154885798-154885820 GCTGTGGGGCCACGCAGGCAGGG - Intronic
1035833796 8:2727338-2727360 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1036837866 8:12090173-12090195 TCTGCCGTGCCAGGCAGGAATGG + Intergenic
1036859657 8:12336421-12336443 TCTGCGGTGCCAGGCAGGAATGG + Intergenic
1037719105 8:21427577-21427599 CCTGTGTTCCCAGACAGAAAAGG + Intergenic
1037974029 8:23196821-23196843 TCAGTGGTGCCATGCAGGACAGG + Intronic
1038367299 8:26948864-26948886 CCTGTGGTGCCAGGAAGGAATGG + Intergenic
1038879463 8:31591932-31591954 GCTCTGTTGCCAGGCTGGAATGG + Intergenic
1039083376 8:33755790-33755812 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1039095623 8:33881325-33881347 CCTGTGATGCCAGGCAAGAATGG + Intergenic
1039123486 8:34175213-34175235 CCTGTGGTGCCAGGCTGGAATGG - Intergenic
1039268421 8:35854262-35854284 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1039354050 8:36795499-36795521 CCTGGGGTGCCAGCCTGGGATGG - Intronic
1039641411 8:39227387-39227409 CCTGTGGTGCCAGGCAGGAATGG - Intronic
1039766298 8:40632051-40632073 CCAGTTGGACCAGGCAGGAAAGG - Intronic
1040435554 8:47387453-47387475 ATTGTGGTGCCAGGTGGGAATGG + Intronic
1040711619 8:50195559-50195581 CCTGTTATGCCAGGCAAGAATGG + Intronic
1040800171 8:51331351-51331373 CCTGCAGTGTCAGGCAGGAAAGG - Intronic
1041227679 8:55716724-55716746 CCTGTGGTGCCAGGCAGGACTGG - Intronic
1041364095 8:57083184-57083206 CCTGAGGTGCCAGGCAGGAATGG - Intergenic
1041570647 8:59333541-59333563 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1041637020 8:60156087-60156109 TGTGTGGTACCAAGCAGGAATGG - Intergenic
1041878069 8:62712845-62712867 CCTGTGGTGCCAGGCAGGAATGG + Intronic
1042122959 8:65507836-65507858 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1042304215 8:67314387-67314409 CCTGTGATGCCAGGCAGGAATGG + Intronic
1042467227 8:69141264-69141286 CCTATGGTGCCAGGCAGGCATGG + Intergenic
1042952654 8:74217860-74217882 CCAGTGTTGGCAGACAGGAAAGG - Intergenic
1043040703 8:75259209-75259231 CCTGTGAGGCCAGGCAGGAATGG - Intergenic
1043816968 8:84813031-84813053 CCTGTGGTGCCAGGCAGGAATGG + Intronic
1044227464 8:89736031-89736053 CTTGTGGTGCCAGGTAGGAATGG - Intergenic
1044730808 8:95227103-95227125 CCACTGGAGCCAAGCAGGAATGG - Intergenic
1045779745 8:105849350-105849372 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1046067514 8:109214112-109214134 CCTTGGCTGCCAGGCAGGGAAGG + Intergenic
1046074326 8:109299125-109299147 CCTGTGAGGACAGGCAGAAATGG - Intronic
1047169803 8:122481201-122481223 CCAGTGGTGGCAGGCGGGGATGG - Intergenic
1047325815 8:123834797-123834819 CCTGTGGTCTCAGGAGGGAATGG + Intergenic
1047944282 8:129859181-129859203 CCTTGGCTGCCAGGCAGGGAAGG - Intronic
1048241015 8:132741579-132741601 CCTCGGCTGCCAGGCAGGAAGGG - Intronic
1049331795 8:142058550-142058572 ATTGTGGTGGGAGGCAGGAAAGG - Intergenic
1049458722 8:142710044-142710066 CCTCGGCTGCCAGGCAGGAAAGG - Intergenic
1049510648 8:143025153-143025175 CCTCTGGTGCCAGGCTGTCAGGG - Intergenic
1049516217 8:143058408-143058430 CCTCAGCTGCCAGGCAGGGAAGG - Intronic
1049666248 8:143844533-143844555 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1049810645 8:144567770-144567792 CCTCGGCTGCCAGGCAGGGAAGG + Intronic
1049857219 8:144870255-144870277 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1049880055 8:145055824-145055846 CCTCTGCTGCCAGGCAGGGAAGG + Exonic
1050227402 9:3475487-3475509 CCTTGGCTGCCAGGCAGGGAAGG - Intronic
1051196210 9:14565155-14565177 CCAGTGGTGGGAGGCAGGCATGG + Intergenic
1051362592 9:16294467-16294489 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1051782982 9:20710804-20710826 CCTGTGCTCCCAGGCAGCTAGGG - Intronic
1052246787 9:26346542-26346564 TTTGTGGTGTCAGGCAGGAAAGG + Intergenic
1052269570 9:26613637-26613659 CCTCAGCTGCCAGGCAGGGAAGG - Intergenic
1052537055 9:29761161-29761183 CCTGTGGTGCCAGGCAAGAATGG - Intergenic
1052550233 9:29938417-29938439 CCTGTGAGGCCAGGCAGAAATGG + Intergenic
1052731555 9:32291680-32291702 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1052984020 9:34472450-34472472 CCTGTGTTTCCAGGGAGGAATGG + Intronic
1053056140 9:34994036-34994058 CATGGGGTGGGAGGCAGGAAAGG + Intronic
1055347069 9:75350455-75350477 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1055476276 9:76666548-76666570 CCTTGGCTGCCAGGCAGGGAAGG + Intronic
1056322824 9:85452496-85452518 CCTGTGGTGCCAGGGAGGAATGG + Intergenic
1056405019 9:86265277-86265299 CCTGTGGTGTCAGGGTGGACAGG + Exonic
1057119592 9:92559239-92559261 CCTGTGGTGTCAGGCAGGAATGG + Intronic
1057554493 9:96076852-96076874 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1057698002 9:97341082-97341104 CCTCGGCTGCCAGGCAGGGAAGG + Intronic
1058085128 9:100740188-100740210 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1058156757 9:101524592-101524614 CCTGTGGTGCCAGCCAGGAATGG + Intronic
1058159205 9:101549302-101549324 CCTCGGCTGCCAGGCAGGGAAGG - Intronic
1058308493 9:103471799-103471821 CCTGTGGTTCCAGGCAGGAATGG + Intergenic
1058410319 9:104724581-104724603 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1058623286 9:106906012-106906034 CCTGTGATGCCAGGCAGGAATGG + Intronic
1060048381 9:120359010-120359032 CTGGTGGAGCCAGGGAGGAAGGG + Intergenic
1060405064 9:123368930-123368952 CCTGTGGCTCCTGGCAGGTATGG + Intronic
1060528715 9:124334951-124334973 CCTGTAGGGTCAGACAGGAAGGG + Intronic
1060724237 9:125996734-125996756 CCTGTGGTCCCAGGCACTCAGGG - Intergenic
1061039180 9:128129737-128129759 CCTCCGCTGCCAGGCAGGGAAGG - Intergenic
1061048796 9:128182062-128182084 CCTCGGCTGCCAGGCAGGGAAGG + Intronic
1061115710 9:128610107-128610129 CCAGAGGTGCCAGTCAGGAGAGG + Intronic
1061432075 9:130537348-130537370 CCAGTGGGGCCAGCGAGGAAAGG - Intergenic
1061535404 9:131245308-131245330 CCTCGGCTGCCAGGCAGGGAAGG + Intergenic
1061787842 9:133041480-133041502 CCTCGGCTGCCAGGCAGGTAAGG + Intronic
1061827998 9:133273971-133273993 GCTCTGGTCCTAGGCAGGAAGGG - Intronic
1061835848 9:133329102-133329124 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1061883740 9:133580566-133580588 CTTGTAGAGCCAGGCTGGAAGGG - Intronic
1062112782 9:134791135-134791157 CATGTGGTGCCTGGCAGGTCTGG - Intronic
1062183901 9:135206106-135206128 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1062267780 9:135695291-135695313 CCTGTGGGGCTGGGCAGGGAAGG - Intronic
1062352755 9:136147337-136147359 CCTGTAGGTCCAGGCAGGGAGGG - Intergenic
1062531792 9:137004859-137004881 CCTTGGCTGCCAGGCAGGGAAGG + Intergenic
1062557233 9:137119269-137119291 CCTAGGCTGCCAGGCAGGGAAGG + Intergenic
1062588451 9:137261956-137261978 CCTAGGCTGCCAGGCAGGGAAGG - Intronic
1062639389 9:137510476-137510498 CCTCGGCTGCCAGGCAGGGAAGG + Intronic
1186549362 X:10486468-10486490 TCTGAGGTGCCAGACAGGGAGGG - Intronic
1186994740 X:15107851-15107873 CCTGTGGTTTGAGGCAGGGATGG + Intergenic
1187141739 X:16600594-16600616 GGTGTGGTGCCAGACACGAATGG - Intronic
1187219297 X:17308191-17308213 CCTATGGTACCAGGCAGGAATGG + Intergenic
1187430739 X:19221997-19222019 CCTGTGGTACCAGGCAGGAATGG + Intergenic
1187681333 X:21770591-21770613 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1187748297 X:22433214-22433236 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1187773704 X:22730955-22730977 CCTGTGGTTCCAGGCAGGAATGG + Intergenic
1188045999 X:25426562-25426584 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1188212503 X:27442167-27442189 CCTTGGCTGCCAGGCAGGGAAGG - Intergenic
1189009908 X:37036646-37036668 CTTGTGGGGCAAGCCAGGAAGGG - Intergenic
1189186994 X:39063351-39063373 CCTGTGTGTCCAGTCAGGAAAGG + Intergenic
1189218076 X:39344597-39344619 CCTGTGGGGCCAGGCAGGACTGG - Intergenic
1189603096 X:42648349-42648371 TCTGTGGTACCAGGCAGGAATGG - Intergenic
1189879265 X:45471819-45471841 CCTGTGGTGCCAAGCAGGAATGG + Intergenic
1189962067 X:46333470-46333492 CTTGTGGTGCCAGGCAGGAATGG - Intergenic
1190448838 X:50557626-50557648 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1191692251 X:63952544-63952566 CCTGTGAGGCAAGGCAGAAATGG - Intergenic
1191779962 X:64854403-64854425 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1191903665 X:66064806-66064828 CCTGTGGTCCCAGGCAGGAATGG + Intergenic
1192014802 X:67317649-67317671 CCTGTGGTGCCAAGCAGGAATGG + Intergenic
1192820127 X:74636677-74636699 CCTGTGATTCCAGGCAGGAATGG - Intergenic
1192878155 X:75253939-75253961 CCTGTGAGGCCAGGCAGAGATGG - Intergenic
1192881199 X:75285410-75285432 CCTGTTTTGTCAGGCAGGAATGG + Intronic
1192914600 X:75638707-75638729 CTTGTGGTACCAGGCAGGAATGG + Intergenic
1192968257 X:76202793-76202815 CCTGTGATGCCAGGCAGAAGTGG + Intergenic
1192970342 X:76221787-76221809 TCTGTGGTGCCAGGCAGGAATGG + Intergenic
1192979134 X:76319568-76319590 CCTATGGTGCCAGGCAGGAATGG + Intergenic
1193062675 X:77223063-77223085 CTTGTGGTGCCAGGCAGGAATGG - Intergenic
1193076932 X:77364560-77364582 TCTGTAGTTCCAGGAAGGAATGG - Intergenic
1193101759 X:77622498-77622520 CCTGTGTTGCCAGGCAGGAATGG - Intronic
1193156765 X:78182870-78182892 CCTGCGGTGCCAGGCAGGAATGG - Intergenic
1193253478 X:79319928-79319950 CCTGTGGTGTCAGGCAGGAATGG + Intergenic
1193786091 X:85760932-85760954 CCTGTGGTGCCAATCAGGAGTGG + Intergenic
1193826392 X:86231856-86231878 CCTGTGGTGCCAGGCAGGAATGG + Intronic
1193937537 X:87641413-87641435 CCTGTGGTACCAGGCAGGAATGG - Intronic
1194466280 X:94238131-94238153 CCTGTGATGCCAGGCAAGAATGG + Intergenic
1194605609 X:95974813-95974835 CCTGTGGTGCTAGGCAAGAATGG - Intergenic
1195019555 X:100812872-100812894 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1195075735 X:101325925-101325947 CCTGTAAGGCCAGGCAGAAATGG - Intergenic
1195105555 X:101599325-101599347 CCTGTGGTGGGACCCAGGAAGGG + Intergenic
1195107327 X:101614442-101614464 CCTGTGGTGGGACCCAGGAAGGG - Intergenic
1195176747 X:102320404-102320426 CCTGGGGACCGAGGCAGGAAAGG - Intronic
1195182117 X:102366689-102366711 CCTGGGGACCGAGGCAGGAAAGG + Intronic
1195795364 X:108641762-108641784 CCTGTGGTGCCAGGCAGGAATGG - Intronic
1196218819 X:113087935-113087957 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1196464744 X:115960435-115960457 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1196590577 X:117481982-117482004 CCTGTGGTGCCAATCAGGAATGG + Intergenic
1196675841 X:118419297-118419319 CCTGTGGTGCCAGGCAGGAATGG + Intronic
1197066313 X:122237698-122237720 CCTGTGGTGCCAGGAAGGAATGG + Intergenic
1197077916 X:122375354-122375376 CCTCAGCTGCCAGGCAGGGAAGG - Intergenic
1197132310 X:123019689-123019711 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1197242740 X:124137148-124137170 CCTTGGCTGCCAGGCAGGGAAGG + Intronic
1197363493 X:125536029-125536051 CCTGTGAGGCAAGGCAGAAATGG - Intergenic
1197476388 X:126930056-126930078 CCTGAGAGGCCAGGCAGGAATGG + Intergenic
1197518833 X:127472698-127472720 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1197671744 X:129284843-129284865 CCTGTGGTGCCAGGGAGGGATGG + Intergenic
1197953615 X:131923437-131923459 CCTGTGGTGCCAAGCAGGAATGG - Intergenic
1197992563 X:132333833-132333855 ACTGTGGTTCCAGGGAAGAAAGG - Intergenic
1198344686 X:135747848-135747870 CCTCAGCTGCCAGGCAGGGAAGG - Intergenic
1198998643 X:142606465-142606487 CCTCGGCTGCCAGGCAGGGAAGG - Intergenic
1199057953 X:143319542-143319564 CCTGTGGTGCCAGGCAGGAATGG + Intergenic
1199521596 X:148741759-148741781 CCTGTGGTGTCAGGCAAGAATGG + Intronic
1199606827 X:149585032-149585054 CAGGTGGCCCCAGGCAGGAATGG - Intronic
1199632296 X:149784336-149784358 CAGGTGGCCCCAGGCAGGAATGG + Intronic
1199668429 X:150120808-150120830 CCTGTGGTGCCAGGTAGGAATGG - Intergenic
1199721893 X:150548053-150548075 CAGGTCGTGCCAGGCAGGAAAGG - Intergenic
1200252582 X:154561583-154561605 CCTGTGATGCGAGGGAGGGAAGG + Intronic
1200265185 X:154642833-154642855 CCTGTGATGCGAGGGAGGGAAGG - Intergenic
1201306625 Y:12556220-12556242 CCTGTGGTGCCAGGCAGGAATGG - Intergenic
1201313686 Y:12621681-12621703 CCGGTGATGGCAGGCAGGCACGG - Intergenic
1201315729 Y:12643741-12643763 CCTGTGATGCCAGGCAGGAATGG - Intergenic
1201343887 Y:12961371-12961393 CCTTGGCTGCCAGGCAGGGAAGG - Intergenic
1201408379 Y:13672720-13672742 CCTGTGAGGGCAGGCAGAAATGG - Intergenic
1201614396 Y:15881337-15881359 TATGTGGTGCCAAGCAAGAATGG + Intergenic
1201615972 Y:15898438-15898460 TATGTGGTGCCAAGCAAGAATGG - Intergenic
1201649537 Y:16270244-16270266 CCTCGGTTGCCAGGCAGGGAAGG + Intergenic
1201707604 Y:16954377-16954399 CCTTGGCTGCCAGGCAGGAAAGG + Intergenic
1201748404 Y:17405601-17405623 CCTTGGCTGCCAGGCAGGGAAGG + Intergenic
1201974347 Y:19832097-19832119 CCTCAGCTGCCAGGCAGGCAAGG - Intergenic