ID: 1109213666

View in Genome Browser
Species Human (GRCh38)
Location 13:59563508-59563530
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109213656_1109213666 1 Left 1109213656 13:59563484-59563506 CCTCCCAATGGATCCCTGTGGTG No data
Right 1109213666 13:59563508-59563530 CAGGCAGGAATGGCCTCCTTGGG No data
1109213653_1109213666 12 Left 1109213653 13:59563473-59563495 CCTCTGGTCACCCTCCCAATGGA 0: 5
1: 30
2: 62
3: 100
4: 252
Right 1109213666 13:59563508-59563530 CAGGCAGGAATGGCCTCCTTGGG No data
1109213651_1109213666 19 Left 1109213651 13:59563466-59563488 CCTCACTCCTCTGGTCACCCTCC No data
Right 1109213666 13:59563508-59563530 CAGGCAGGAATGGCCTCCTTGGG No data
1109213658_1109213666 -3 Left 1109213658 13:59563488-59563510 CCAATGGATCCCTGTGGTGCCAG 0: 43
1: 72
2: 63
3: 40
4: 179
Right 1109213666 13:59563508-59563530 CAGGCAGGAATGGCCTCCTTGGG No data
1109213650_1109213666 20 Left 1109213650 13:59563465-59563487 CCCTCACTCCTCTGGTCACCCTC No data
Right 1109213666 13:59563508-59563530 CAGGCAGGAATGGCCTCCTTGGG No data
1109213657_1109213666 -2 Left 1109213657 13:59563487-59563509 CCCAATGGATCCCTGTGGTGCCA No data
Right 1109213666 13:59563508-59563530 CAGGCAGGAATGGCCTCCTTGGG No data
1109213655_1109213666 2 Left 1109213655 13:59563483-59563505 CCCTCCCAATGGATCCCTGTGGT No data
Right 1109213666 13:59563508-59563530 CAGGCAGGAATGGCCTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109213666 Original CRISPR CAGGCAGGAATGGCCTCCTT GGG Intergenic
No off target data available for this crispr