ID: 1109213849

View in Genome Browser
Species Human (GRCh38)
Location 13:59565291-59565313
Sequence CTGAACAGGACTTTAACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109213849_1109213856 10 Left 1109213849 13:59565291-59565313 CCTGCAGTTAAAGTCCTGTTCAG No data
Right 1109213856 13:59565324-59565346 TGGAAGGGTTTGTTATACACGGG No data
1109213849_1109213850 -10 Left 1109213849 13:59565291-59565313 CCTGCAGTTAAAGTCCTGTTCAG No data
Right 1109213850 13:59565304-59565326 TCCTGTTCAGTCAAGCTGCCTGG No data
1109213849_1109213858 25 Left 1109213849 13:59565291-59565313 CCTGCAGTTAAAGTCCTGTTCAG No data
Right 1109213858 13:59565339-59565361 TACACGGGGCCTCCATTTTCTGG No data
1109213849_1109213853 -5 Left 1109213849 13:59565291-59565313 CCTGCAGTTAAAGTCCTGTTCAG No data
Right 1109213853 13:59565309-59565331 TTCAGTCAAGCTGCCTGGAAGGG No data
1109213849_1109213855 9 Left 1109213849 13:59565291-59565313 CCTGCAGTTAAAGTCCTGTTCAG No data
Right 1109213855 13:59565323-59565345 CTGGAAGGGTTTGTTATACACGG No data
1109213849_1109213852 -6 Left 1109213849 13:59565291-59565313 CCTGCAGTTAAAGTCCTGTTCAG No data
Right 1109213852 13:59565308-59565330 GTTCAGTCAAGCTGCCTGGAAGG No data
1109213849_1109213857 11 Left 1109213849 13:59565291-59565313 CCTGCAGTTAAAGTCCTGTTCAG No data
Right 1109213857 13:59565325-59565347 GGAAGGGTTTGTTATACACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109213849 Original CRISPR CTGAACAGGACTTTAACTGC AGG (reversed) Intergenic
No off target data available for this crispr