ID: 1109213850

View in Genome Browser
Species Human (GRCh38)
Location 13:59565304-59565326
Sequence TCCTGTTCAGTCAAGCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109213849_1109213850 -10 Left 1109213849 13:59565291-59565313 CCTGCAGTTAAAGTCCTGTTCAG No data
Right 1109213850 13:59565304-59565326 TCCTGTTCAGTCAAGCTGCCTGG No data
1109213848_1109213850 27 Left 1109213848 13:59565254-59565276 CCATCAGCATTCATGCTCTTACA No data
Right 1109213850 13:59565304-59565326 TCCTGTTCAGTCAAGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109213850 Original CRISPR TCCTGTTCAGTCAAGCTGCC TGG Intergenic
No off target data available for this crispr