ID: 1109213856

View in Genome Browser
Species Human (GRCh38)
Location 13:59565324-59565346
Sequence TGGAAGGGTTTGTTATACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109213849_1109213856 10 Left 1109213849 13:59565291-59565313 CCTGCAGTTAAAGTCCTGTTCAG No data
Right 1109213856 13:59565324-59565346 TGGAAGGGTTTGTTATACACGGG No data
1109213851_1109213856 -4 Left 1109213851 13:59565305-59565327 CCTGTTCAGTCAAGCTGCCTGGA No data
Right 1109213856 13:59565324-59565346 TGGAAGGGTTTGTTATACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109213856 Original CRISPR TGGAAGGGTTTGTTATACAC GGG Intergenic
No off target data available for this crispr