ID: 1109213858

View in Genome Browser
Species Human (GRCh38)
Location 13:59565339-59565361
Sequence TACACGGGGCCTCCATTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109213851_1109213858 11 Left 1109213851 13:59565305-59565327 CCTGTTCAGTCAAGCTGCCTGGA No data
Right 1109213858 13:59565339-59565361 TACACGGGGCCTCCATTTTCTGG No data
1109213854_1109213858 -6 Left 1109213854 13:59565322-59565344 CCTGGAAGGGTTTGTTATACACG No data
Right 1109213858 13:59565339-59565361 TACACGGGGCCTCCATTTTCTGG No data
1109213849_1109213858 25 Left 1109213849 13:59565291-59565313 CCTGCAGTTAAAGTCCTGTTCAG No data
Right 1109213858 13:59565339-59565361 TACACGGGGCCTCCATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109213858 Original CRISPR TACACGGGGCCTCCATTTTC TGG Intergenic
No off target data available for this crispr