ID: 1109220488

View in Genome Browser
Species Human (GRCh38)
Location 13:59636448-59636470
Sequence CTACTTCAACAGATGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109220484_1109220488 21 Left 1109220484 13:59636404-59636426 CCAGACTTGGCTTCAGTCAAGAA No data
Right 1109220488 13:59636448-59636470 CTACTTCAACAGATGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109220488 Original CRISPR CTACTTCAACAGATGGAGGT TGG Intergenic
No off target data available for this crispr