ID: 1109220527

View in Genome Browser
Species Human (GRCh38)
Location 13:59636750-59636772
Sequence TTGCACCATCCCTGTAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109220525_1109220527 12 Left 1109220525 13:59636715-59636737 CCTGCACACTTTCTGACACTGGT No data
Right 1109220527 13:59636750-59636772 TTGCACCATCCCTGTAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109220527 Original CRISPR TTGCACCATCCCTGTAGCTC AGG Intergenic
No off target data available for this crispr