ID: 1109225649

View in Genome Browser
Species Human (GRCh38)
Location 13:59691417-59691439
Sequence ATCTAGGTGTTTAGGAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109225649 Original CRISPR ATCTAGGTGTTTAGGAAATA TGG Intronic
900076168 1:819582-819604 AACTAGTTTTTAAGGAAATATGG + Intergenic
903104042 1:21059154-21059176 ATCTTGGGATTTAGAAAATAAGG - Intronic
908109878 1:60886226-60886248 CTCCAGGTGATTAGGAATTAGGG - Intronic
908136867 1:61142196-61142218 TTTTAGTTGTTTAGGAGATATGG - Intronic
908172833 1:61524699-61524721 AAATAGGTCTTTAGAAAATAGGG + Intergenic
908464644 1:64380530-64380552 ATCTTGCTGTTTTGGAATTATGG - Intergenic
908476783 1:64496822-64496844 ATCTAGGTTTTGAGGAAATTGGG - Intronic
909281505 1:73760760-73760782 ATCTTGGTGCTTAGCACATAAGG - Intergenic
909666454 1:78139320-78139342 AACTAGGTTTTCAGGTAATAGGG - Intergenic
910331972 1:86083896-86083918 ATATATGGATTTAGGAAATATGG - Intronic
911517358 1:98882715-98882737 ATGTATTTGTTTAAGAAATAGGG + Intergenic
911566966 1:99473739-99473761 ATCCAGATGTGTAAGAAATAAGG + Intergenic
911995670 1:104762755-104762777 AGCTTTGTGTTTAGTAAATATGG + Intergenic
912349903 1:109002024-109002046 CTCTAGTTGCTTAGGGAATAAGG + Intronic
913568963 1:120101406-120101428 TTCTAGGTGTTTGGGATCTAAGG + Intergenic
914289772 1:146262397-146262419 TTCTAGGTGTTTGGGATCTAAGG + Intergenic
914550816 1:148713180-148713202 TTCTAGGTGTTTGGGATCTAAGG + Intergenic
916644346 1:166768012-166768034 GTCTAGGAGTTTAGTAAATCAGG + Intergenic
917160315 1:172050009-172050031 AACCAGGAGTTTAGGAAATGAGG - Intronic
921779913 1:219150568-219150590 ACCAAGGTGTTATGGAAATAAGG + Intergenic
921834516 1:219763925-219763947 ATAGAGGTGATGAGGAAATAGGG + Intronic
921980477 1:221252006-221252028 ATCTAGGTGTGTAGTTAATTTGG - Intergenic
1067500310 10:46797797-46797819 AGCTAGGTGTTTAGGTTATCAGG + Intergenic
1067594318 10:47542516-47542538 AGCTAGGTGTTTAGGTTATCAGG - Intronic
1067641427 10:48050631-48050653 AGCTAGGTGTTTAGGTTATCAGG - Intergenic
1070063130 10:73005540-73005562 ATATAAGTGTTTTAGAAATATGG - Intergenic
1070275697 10:75004513-75004535 GTCTAGGTGATGAGGACATAAGG + Intronic
1072622343 10:97088362-97088384 AACTAGGTGTTGAGGATATTGGG + Intronic
1072954114 10:99873892-99873914 ATCTATGTATCTAGGATATATGG - Intergenic
1073859121 10:107717030-107717052 ATCAAGGAGTTTAGGAGACATGG + Intergenic
1074191157 10:111138983-111139005 AGGTAGGTGTTTATGTAATAAGG + Intergenic
1074549994 10:114433834-114433856 ATCAAGGTATTTGGGAAACATGG - Intronic
1075309944 10:121405641-121405663 ATCTGGGGCTTTAGGAAATCAGG - Intergenic
1078684468 11:13515337-13515359 ATTTAAGTGTTTAGGAGCTATGG + Intergenic
1079640200 11:22795577-22795599 ATCTGAGTGTTTGGGAAATAGGG + Intronic
1080231632 11:30022718-30022740 TTATATGTGCTTAGGAAATAGGG + Intergenic
1080805008 11:35644784-35644806 ATCTAAGTTTTGATGAAATATGG + Intergenic
1080831078 11:35893946-35893968 AGCTGGGTGTTGAGGAAAGAAGG - Intergenic
1081322344 11:41706443-41706465 ATCTCGGTGTTTAGGCCATCTGG + Intergenic
1081983569 11:47285331-47285353 ATCCAGGGGCTTAGGAATTACGG + Intronic
1082643548 11:55693228-55693250 AGCTAGGGATTTAGGAACTATGG + Intergenic
1084386434 11:68845575-68845597 CTCTAGGTGTTGAGTAAATATGG + Intergenic
1085869428 11:80331777-80331799 ATCTTAGAGTTAAGGAAATATGG + Intergenic
1087169414 11:95036267-95036289 TTATAGGTTTTTAGAAAATATGG + Intergenic
1087364768 11:97204125-97204147 AGCTATTTGTTGAGGAAATAAGG - Intergenic
1090889542 11:130911252-130911274 ATCTGGGTGTTAAGGAAAGAAGG + Intronic
1091006104 11:131955354-131955376 ATCCATGTGTCTAGGTAATAGGG - Intronic
1091483276 12:856798-856820 ATTTATGTGTTTAGGGAACAAGG + Intronic
1092746705 12:11679165-11679187 ATCTGAGTGTGCAGGAAATAAGG + Intronic
1093056978 12:14565802-14565824 ACCTAGGTGTTAAGGACATCTGG - Intronic
1095352918 12:41236057-41236079 ATCTAGGTGCTCAGTAAACATGG - Intronic
1096934836 12:55260536-55260558 ATTTAGGTGTTTTAGATATATGG + Intergenic
1102777620 12:115534321-115534343 ATCTATTTCTTTAAGAAATAAGG - Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105592711 13:21809645-21809667 AAGGAGGTGTTGAGGAAATATGG - Intergenic
1109225649 13:59691417-59691439 ATCTAGGTGTTTAGGAAATATGG + Intronic
1109717752 13:66238651-66238673 ATCTAGGTTTTTTGAAATTAAGG - Intergenic
1109896606 13:68699960-68699982 ATCCAGCTGTTTATGAAAGAAGG - Intergenic
1110043719 13:70800709-70800731 ATTTATATGTTTAGAAAATATGG + Intergenic
1112656614 13:101458365-101458387 ATGTGGATGTTTGGGAAATAGGG + Intronic
1112770499 13:102789900-102789922 GTCTGGGTGTTTAAAAAATACGG - Intronic
1115664139 14:35529312-35529334 AACTACATGTTTAGGAAACAGGG - Intergenic
1116350389 14:43854900-43854922 TTTTAGGTGTTAGGGAAATAGGG + Intergenic
1116700979 14:48241502-48241524 ATCTAGGAGATTAAGAAATTTGG - Intergenic
1118438253 14:65790578-65790600 CACTAGGTGCTCAGGAAATAAGG - Intergenic
1119684648 14:76621993-76622015 ATCTAGATGTTCAAGCAATAGGG + Intergenic
1120532462 14:85648650-85648672 ACCTAGGTATTTAGGGAAAATGG - Exonic
1124511590 15:30331882-30331904 ATCTCGGTGTCTAGGAAATGGGG - Intergenic
1124731324 15:32198875-32198897 ATCTCGGTGTCTAGGAAATGGGG + Intergenic
1126868319 15:52960257-52960279 ATATAAATGTTAAGGAAATAAGG + Intergenic
1128603200 15:69015270-69015292 ATCTAGGTGGTGAGGGAATAGGG - Intronic
1128863326 15:71092964-71092986 ATCTTTCTGTTTATGAAATATGG - Intergenic
1129408422 15:75335511-75335533 ATCTAGGTGCCTAGCAAAAAGGG - Intergenic
1133670283 16:8011981-8012003 AGCAAGGTGTGAAGGAAATAGGG - Intergenic
1135613001 16:23884893-23884915 ATTTAGTTGTTCAGCAAATATGG + Intronic
1139176126 16:64690223-64690245 ATATAGCTGATTAGGAAATGTGG + Intergenic
1139666066 16:68457429-68457451 ATATTGGTGTTTAGGTAAAATGG - Intergenic
1147355834 17:39895893-39895915 ATGAAGCTGTTTAGAAAATAAGG + Intergenic
1149296836 17:55268475-55268497 ATCTACGTGTTTAGGGAATGAGG - Intronic
1149442942 17:56690522-56690544 ATCCTGGTGTCTAGGAATTAAGG + Intergenic
1151770738 17:76158972-76158994 ATTTAGATGTTTAAGAGATACGG + Intronic
1156569409 18:38236201-38236223 ATCTAGGTGTTCAACAAATTGGG + Intergenic
1159418943 18:68190321-68190343 AGCTAAGTGTTTAGCAAATATGG - Intergenic
1160679298 19:405440-405462 ATAAAGGTGTTTCGGGAATACGG - Exonic
1164663558 19:30003555-30003577 AACAAAGTGTTTTGGAAATAGGG - Intronic
1164777525 19:30864542-30864564 AACTAGGAGTTAAGGAAATCAGG + Intergenic
925778994 2:7362636-7362658 ATCTAGGTTCTTAGGAAGTCTGG - Intergenic
926515111 2:13833884-13833906 AGCTAGGTCTTGAGGAAAAACGG - Intergenic
928086850 2:28351239-28351261 AATTATGTGTTTAGGAAAAAGGG - Intergenic
930960807 2:57259342-57259364 CTCCTGATGTTTAGGAAATAGGG - Intergenic
931049669 2:58396971-58396993 CCCTTGGTGTTTAGGAAGTAGGG + Intergenic
931094528 2:58924265-58924287 TTAAAGGTGTTTAGAAAATAAGG - Intergenic
932543738 2:72685166-72685188 ATCTAGGTGGTAAGTAAATATGG + Intronic
933078075 2:77954481-77954503 ATCAAGGAGTCTAGGAAAGACGG + Intergenic
936465713 2:112747520-112747542 ATGCAGGTGTTTATGAAAGAGGG + Intronic
936614258 2:114032791-114032813 AAGTAGGTGTTTGGGGAATATGG - Intergenic
937215877 2:120313315-120313337 AGCTAGGTGTTTACCAAAAAGGG - Intergenic
939502210 2:143001891-143001913 ATCTAGCTGCTAAGGAAAAATGG - Intronic
939733029 2:145808729-145808751 ATCTATGCATTTAAGAAATAAGG - Intergenic
940431376 2:153593632-153593654 GTGTAGGGGTTTAGGAAAGATGG + Intergenic
941286204 2:163616078-163616100 ATCCAGTTATATAGGAAATATGG - Intronic
941434646 2:165454186-165454208 ATCTTGGTCTCTAGGAAAGATGG - Intergenic
942951340 2:181725637-181725659 ATCTGGATGTTTGGCAAATACGG - Intergenic
943453826 2:188078110-188078132 ATCTAGGTTCTTGGAAAATATGG + Intergenic
944883040 2:204034568-204034590 ATCAAGCAGTTTAGGAAAGAGGG - Intergenic
945342676 2:208675874-208675896 ATCTATCTTTTTAAGAAATAAGG - Intronic
945450600 2:209990889-209990911 ATCACGGTTTTTATGAAATAAGG - Intronic
946504793 2:220287429-220287451 TACTAGGAGTTTAGGAAATATGG - Intergenic
947463482 2:230322631-230322653 ATCTAAGGGTTTAGGAAGTGGGG - Intergenic
1170853944 20:20031432-20031454 ATCTAGGTTTTTAATAAATCTGG - Intronic
950352939 3:12374990-12375012 ATCTATGTGTTAAGGAAAGAAGG - Intronic
951487591 3:23231335-23231357 ATCTAAGTTTTGAGGAAAGAAGG - Intronic
956742321 3:72284934-72284956 ATCTTGGAGATGAGGAAATATGG - Intergenic
957732640 3:84160987-84161009 AGTTAGGTGTTTAAGAAATGTGG - Intergenic
959308658 3:104701560-104701582 AAGTAGGTTTTTAGTAAATAAGG + Intergenic
962977978 3:140462996-140463018 ACCTAGGAGCATAGGAAATAGGG + Intronic
968041367 3:195591995-195592017 ATCTGGGTGTGGAGGAATTAAGG + Intergenic
973126634 4:46593770-46593792 ATCTTTGAGTTTATGAAATAGGG - Intergenic
975292172 4:72689589-72689611 ATCTATGGGGTTAGGAAAGAAGG - Intergenic
976846896 4:89499187-89499209 AACTGGGTTTTTAGAAAATATGG + Intergenic
978362303 4:107944254-107944276 ATATAGGTGTTTAGAACATGGGG + Intronic
979044455 4:115844399-115844421 ATCTGGCTGTTCAGGAAATGAGG + Intergenic
979378791 4:119983505-119983527 TTCTAGGAATTGAGGAAATAGGG - Intergenic
979522098 4:121679370-121679392 AGCTAGGTATTTAGGAATTGTGG - Intronic
979645724 4:123065845-123065867 ATTTTGTTGTTTAGGAGATAGGG + Intronic
981993410 4:150952122-150952144 TTGGAGGTGTTTAGGAAATTTGG - Intronic
982255525 4:153447790-153447812 AGCTTGGTGATCAGGAAATAGGG - Intergenic
982920731 4:161271107-161271129 ATCTAGTTTTCTAAGAAATATGG - Intergenic
983157711 4:164371228-164371250 TTGTAGTTGTTTTGGAAATAGGG - Intronic
984144993 4:176049482-176049504 ATCTCTGTGTTCAAGAAATAAGG + Intergenic
986218874 5:5748570-5748592 ATTCAGCTGTTTAAGAAATATGG - Intergenic
986974876 5:13382522-13382544 ATCTAGGAGCTTAGGAACTGGGG + Intergenic
988009822 5:25467524-25467546 TTCTCAGTGTCTAGGAAATAAGG - Intergenic
989756463 5:44961431-44961453 ATCTTGGAATTTAGAAAATATGG - Intergenic
990219275 5:53569573-53569595 ATCTAGTTGTTGAGGAAGTTTGG + Intronic
991617908 5:68516520-68516542 AGCTAGGTGTTTAGGGATTTAGG - Intergenic
993297244 5:86156722-86156744 CTCTATCTGGTTAGGAAATATGG + Intergenic
993755331 5:91722154-91722176 AACTATGTTGTTAGGAAATAAGG - Intergenic
1001637850 5:173225346-173225368 CACTAGGTGGTTAGGAAATCTGG + Intergenic
1002587391 5:180258388-180258410 TTCCATGTGTTTAAGAAATATGG + Intronic
1003133398 6:3414686-3414708 ATCTTGGCCTTGAGGAAATAAGG - Intronic
1003162146 6:3645286-3645308 ATCCAGGTGCTGAGGCAATAAGG - Intergenic
1005967551 6:30737933-30737955 TGCTAGGTGTTCAGGAAAGAAGG - Intronic
1012858319 6:104528775-104528797 ATCTAGGATTTAAGGAACTATGG + Intergenic
1014344158 6:120246427-120246449 AAATGTGTGTTTAGGAAATAGGG - Intergenic
1015250269 6:131120196-131120218 ATCTGGGTTGTGAGGAAATAGGG + Intergenic
1015413885 6:132926572-132926594 ATATAGGTTTTGAGGTAATACGG + Intergenic
1015647091 6:135404229-135404251 ATTTAGGTGTTGGGAAAATAAGG - Intronic
1016670631 6:146702167-146702189 ATCTAGGAGTCTAGTTAATAGGG + Intronic
1020075653 7:5256740-5256762 AACTAGGTGGTGAGGACATAAGG + Intergenic
1022224787 7:28351919-28351941 ATCAAGCAGTTTAGGAAATTGGG + Intronic
1022552759 7:31257086-31257108 ATTTAGGTGCTTAGCAAATATGG - Intergenic
1024524212 7:50334924-50334946 ATATATGTGTATAGGATATATGG + Intronic
1025295234 7:57771294-57771316 ATCTAGGTGCCTAAGAAACAGGG - Intergenic
1028150755 7:87368494-87368516 CCCTAGGTCTTGAGGAAATAAGG + Intronic
1028773319 7:94652278-94652300 ATTTAGGTGTTTACAGAATATGG + Intronic
1028881241 7:95882413-95882435 ATCCAGGACTTTAAGAAATATGG - Intronic
1030766280 7:113413689-113413711 ATCTACTTTTTTAGGTAATATGG - Intergenic
1031524804 7:122811341-122811363 ATTTTGCTGATTAGGAAATAGGG - Intronic
1031644997 7:124213991-124214013 AACTATGTGTTTTGGAAATTGGG - Intergenic
1035533840 8:376164-376186 AACTAGTTTTTAAGGAAATATGG - Intergenic
1042007085 8:64193175-64193197 TTCCAGGTGCTTAGGATATAAGG - Intergenic
1042007105 8:64193399-64193421 ATCAAGTTGTTTAGTAAAAAAGG - Intergenic
1042455944 8:69002720-69002742 ATCTAGGTGGTAAGCAAATTTGG + Intergenic
1042808231 8:72794958-72794980 ATTTTAGGGTTTAGGAAATATGG + Intronic
1042957990 8:74272189-74272211 ATCTAGTTGATCAGGAAATGAGG - Intronic
1042989786 8:74626298-74626320 ACCTAGGGGTATAGGAAATGAGG - Intronic
1043660429 8:82734597-82734619 ATTTAGGTATTTAGGGAAAATGG - Intergenic
1043977779 8:86602419-86602441 ATCTTTGTGTTCTGGAAATATGG - Intronic
1045569864 8:103357842-103357864 ATCTAGGTGTTTAGGAATGTGGG + Intergenic
1045724357 8:105154524-105154546 ATCTAATTGTTTAGGAAAGATGG + Intronic
1047397662 8:124516934-124516956 ATGTAGATGTTTAGAAAAAAAGG + Intronic
1047925298 8:129676896-129676918 ATCTTGGTATTGAGGAACTATGG + Intergenic
1050100298 9:2111989-2112011 TTCTAAGTCTTCAGGAAATATGG + Intronic
1052379363 9:27753396-27753418 ATCTAGGTGAATAAAAAATAAGG + Intergenic
1054957360 9:70928070-70928092 ATCTGGATATTTAGGTAATAGGG + Intronic
1055687914 9:78797691-78797713 ATCAACCTGTTTAGGCAATAAGG - Intergenic
1055947896 9:81707967-81707989 TTCTAGGTATTGAGGACATAAGG + Intergenic
1058541507 9:106016995-106017017 ATCTAGGTGTCTAGGCAAAGAGG + Intergenic
1061613703 9:131765311-131765333 TTCAAGGTGTATTGGAAATAGGG + Intergenic
1188417783 X:29957156-29957178 ATCAAGGTGTTTAAGAACTCAGG + Intergenic
1190479556 X:50862391-50862413 ATCTAGGTATATAGGAAAAGAGG - Intergenic
1190753007 X:53378860-53378882 ATCTGGGTTGTGAGGAAATAGGG - Exonic
1190867172 X:54394602-54394624 ATGTAGGTTTTTATGAAATGTGG - Intergenic
1191697907 X:64008079-64008101 ATGTATGTGTTTACAAAATAAGG + Intergenic
1195530577 X:105950696-105950718 ATGTAGGTGTTTTGGGACTAAGG + Intronic
1195530636 X:105951780-105951802 ATGTAGGTGTTTTGGGACTACGG + Intronic
1196656827 X:118227314-118227336 ATATAGGGGTTCAGGAAATCTGG + Intergenic
1196990279 X:121321154-121321176 ATCTAAGTGTTGGGGGAATATGG - Intergenic
1197162706 X:123342066-123342088 GTCTAGGTCTTTAGGAAATAAGG - Intronic
1199442730 X:147886800-147886822 ATCTATGTGCTGAGGAAAGATGG + Intergenic