ID: 1109226491

View in Genome Browser
Species Human (GRCh38)
Location 13:59702271-59702293
Sequence CTCAGTCTTCATTATAAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109226491_1109226493 24 Left 1109226491 13:59702271-59702293 CCTAACTTATAATGAAGACTGAG 0: 1
1: 0
2: 0
3: 19
4: 203
Right 1109226493 13:59702318-59702340 CTTAACTTACAAATTGAATGTGG 0: 1
1: 0
2: 1
3: 8
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109226491 Original CRISPR CTCAGTCTTCATTATAAGTT AGG (reversed) Intronic
901329066 1:8390569-8390591 CTCTGTCTTCACTATTTGTTTGG - Intronic
902145404 1:14394719-14394741 CTCAGTCCTTACTATATGTTGGG + Intergenic
902889184 1:19429509-19429531 CTCAGTCTTCTTTAAAACCTGGG + Intronic
908308550 1:62851605-62851627 TTAAGTCTTTATTGTAAGTTTGG - Intronic
908359511 1:63355019-63355041 CTCAGCATTCATTTTTAGTTTGG + Intergenic
908579512 1:65499819-65499841 CACAGTCTTAAATGTAAGTTAGG - Intronic
910125933 1:83842296-83842318 CTCAGTCTTGTTAATATGTTTGG - Intergenic
910375669 1:86566936-86566958 CCCAAGCTTCATTTTAAGTTTGG - Intronic
911425320 1:97703374-97703396 CTCAGTCTCCTTAATAAGGTGGG + Intronic
911714608 1:101116533-101116555 ATCTATCTTCATTATAAATTGGG + Intergenic
912276887 1:108268304-108268326 TACAGTTTTCATAATAAGTTGGG + Intergenic
912291342 1:108426051-108426073 TACAGTTTTCATAATAAGTTGGG - Intronic
912324483 1:108744940-108744962 CTCCCTTTTCATTTTAAGTTAGG - Intergenic
912540128 1:110408274-110408296 CCCAGTCTTCCTTACGAGTTAGG - Intergenic
913101100 1:115567337-115567359 TTAATTCTTCTTTATAAGTTTGG - Intergenic
913424708 1:118714388-118714410 CTCCAACTTCATGATAAGTTGGG + Intergenic
916114159 1:161473294-161473316 CTCATTTTTCCTTATAATTTGGG + Intergenic
918107323 1:181426008-181426030 CTCTGTTTTCTTTATAAATTTGG - Intronic
919556889 1:199067633-199067655 TTCAGTCTTCATGATATTTTTGG + Intergenic
920131966 1:203739144-203739166 CTCAATCATCTTTTTAAGTTTGG + Intronic
920880703 1:209877795-209877817 TTCAGCCTTCACTATAAATTGGG - Intergenic
921197257 1:212770608-212770630 TTAATTCTTCTTTATAAGTTTGG - Intronic
921300489 1:213746999-213747021 CTGAGTTTTAAATATAAGTTTGG + Intergenic
924526471 1:244855649-244855671 CTAAGTCTTCTGTATAAGTAGGG - Intronic
1062823563 10:552078-552100 CTCAGTCTGCAATCTAAGCTGGG + Intronic
1075208751 10:120472168-120472190 CTCAATGTTCTTTATCAGTTCGG + Intronic
1076216413 10:128697371-128697393 CTCAGACTTAATTATAAAGTAGG - Intergenic
1076371199 10:129955588-129955610 CTCAGTGTTCATCATATGGTGGG - Intronic
1077745565 11:4900619-4900641 CTCAGTGTTCTTTATAGCTTAGG + Intronic
1077748850 11:4940711-4940733 CAAAGTCTGCATTATGAGTTTGG - Intronic
1080152298 11:29067212-29067234 CTAGGTCTTCTTTATATGTTTGG - Intergenic
1080740142 11:35056219-35056241 ATCAGTCTTTTTTAAAAGTTGGG + Intergenic
1080856884 11:36120202-36120224 CTCTGTCTTCATATTTAGTTGGG + Intronic
1084865879 11:72056667-72056689 CTGAGTTTTGATTATCAGTTTGG - Intronic
1085687545 11:78637852-78637874 TTCATTCTTCTTTATAAGTTTGG - Intergenic
1086140290 11:83491538-83491560 CTCAGTCAGCAGTCTAAGTTGGG + Intronic
1086937157 11:92757549-92757571 TTCAGACTTCATAATACGTTAGG - Intronic
1088420170 11:109636332-109636354 CTCAGTCTTGAGTATCAGCTTGG + Intergenic
1088596814 11:111447322-111447344 CGCAGTCTTCTTTATAAACTGGG + Intronic
1088695589 11:112363185-112363207 CTCAGTCTCCATGAAAACTTTGG + Intergenic
1088849225 11:113691256-113691278 CACTGTCCTCATTAGAAGTTGGG - Intronic
1089082718 11:115790496-115790518 TTCATTCATCATCATAAGTTGGG + Intergenic
1090310228 11:125729957-125729979 CTCAGTCTTAAACATAATTTGGG + Intergenic
1090584762 11:128199297-128199319 CTCAGTGTTTATTATATGTCAGG + Intergenic
1090620591 11:128557493-128557515 CCTGGTCTTCAATATAAGTTAGG + Intronic
1091809661 12:3385591-3385613 CTATGTCTTAATTATAACTTAGG + Intronic
1094352267 12:29540318-29540340 CTCATTCAGCATTATAAATTTGG + Intronic
1095354136 12:41251452-41251474 CCCAAGCTTCATTATAAATTTGG + Intronic
1099613120 12:84901184-84901206 TTCATTCTTCTTTAAAAGTTTGG + Intronic
1100117633 12:91327288-91327310 CTCAGTGGTCATTATAACTTTGG - Intergenic
1101220118 12:102630132-102630154 CTCAGTCTTTTTTTTAAATTTGG + Intergenic
1101249539 12:102918202-102918224 CTCAGTCTTCTCTAAAAGTGTGG - Intronic
1101507240 12:105358873-105358895 GTCAGTCTTCCTTCTAAGATTGG + Intronic
1102443544 12:112982752-112982774 TTAATTCTTCTTTATAAGTTTGG + Intronic
1104459793 12:128945907-128945929 ATCAGTCTGCATTTTAAGTGGGG + Intronic
1105939026 13:25130391-25130413 CTGTGTATTTATTATAAGTTGGG - Intergenic
1107162059 13:37241815-37241837 CTCTGTGTTCATTTCAAGTTGGG - Intergenic
1108984207 13:56562158-56562180 CTCAGTCTTCAATTTAAATCAGG - Intergenic
1109226491 13:59702271-59702293 CTCAGTCTTCATTATAAGTTAGG - Intronic
1111443553 13:88313684-88313706 CTATGTGGTCATTATAAGTTTGG + Intergenic
1114049371 14:18909366-18909388 ATCAGTATTCATTATACATTAGG + Intergenic
1114113192 14:19492565-19492587 ATCAGTATTCATTATACATTAGG - Intergenic
1115367436 14:32574141-32574163 CTTAGCTTTTATTATAAGTTCGG + Intronic
1115517182 14:34197607-34197629 CTCAGTGTTCAGTTTGAGTTAGG - Intronic
1116132448 14:40873756-40873778 TTCAGTTTACATAATAAGTTAGG - Intergenic
1117070317 14:52050096-52050118 CTCAATCTGCATGATGAGTTAGG - Intronic
1117865634 14:60146125-60146147 GTCACTCTTTATTATAAGCTGGG - Exonic
1120181509 14:81347485-81347507 TTAATTCTTCTTTATAAGTTTGG - Intronic
1120356497 14:83441204-83441226 CTCAGGCTTCTCTGTAAGTTTGG - Intergenic
1124598015 15:31107133-31107155 TTCATTCTTCTTTACAAGTTTGG + Intronic
1126813312 15:52430305-52430327 CTCAGTCTTCATTACAGGGTGGG + Intronic
1126822104 15:52514549-52514571 TTCAGTCTTCACTTTAAGTGAGG - Intronic
1126991538 15:54383109-54383131 TTCATTCTTCTTTATATGTTTGG - Intronic
1133615392 16:7471581-7471603 CTCAGAATTTATTATAAATTAGG - Intronic
1136779686 16:32889009-32889031 CTCAGCCTTTATTGTACGTTAGG - Intergenic
1136890930 16:33972509-33972531 CTCAGCCTTTATTGTACGTTAGG + Intergenic
1138926531 16:61598358-61598380 CTCTGTCTTCATTTTAAAATTGG + Intergenic
1139141403 16:64267256-64267278 CTCAGCCTTCACCAGAAGTTAGG - Intergenic
1203082103 16_KI270728v1_random:1151097-1151119 CTCAGTCTTTATTGTACGTTAGG - Intergenic
1143690396 17:8558256-8558278 CTCAGTGTTCATCTTAAGTTTGG - Intronic
1144376169 17:14644321-14644343 ATCACCCTTCCTTATAAGTTGGG + Intergenic
1149234511 17:54574219-54574241 CCCAGTCTTCATCATAAGCCAGG + Intergenic
1149744285 17:59080150-59080172 CACAAACTTCATTTTAAGTTAGG + Intronic
1151081493 17:71334394-71334416 GTCAGTCTTCATTTCAAATTAGG + Intergenic
1155609595 18:27650156-27650178 CTCAGTCTTCATAATCACATAGG + Intergenic
1159455470 18:68655515-68655537 CCCAGTGTCCTTTATAAGTTGGG + Intergenic
1160562683 18:79769457-79769479 TTCAGTATTAATTACAAGTTTGG - Intergenic
1165615432 19:37195718-37195740 CTAATTCTTCTTTGTAAGTTTGG - Intronic
925242522 2:2344576-2344598 CTCAGTTCTCATTATAAAATAGG - Intergenic
927007971 2:18870259-18870281 CTCTGTGACCATTATAAGTTTGG - Intergenic
928802707 2:35113618-35113640 ATCAGTCTTCTTTAAATGTTTGG - Intergenic
930163311 2:48179859-48179881 CTCATACTTTATTATCAGTTTGG - Intergenic
931674080 2:64676255-64676277 AAAAGTCTTCATTATGAGTTTGG + Intronic
933859644 2:86452941-86452963 GTCAGTCTTCCTTTTAAGTCAGG - Intronic
934167391 2:89306802-89306824 CTCAGGCTTCATCCTCAGTTTGG - Intergenic
934199884 2:89875642-89875664 CTCAGGCTTCATCCTCAGTTTGG + Intergenic
936516216 2:113183068-113183090 CTGAGTCTTCATTCTCAGGTGGG - Exonic
936930712 2:117785792-117785814 CTCAGTCCTCATTTAAAGTTTGG - Intergenic
937783218 2:125864055-125864077 CTTAGTTTACATCATAAGTTAGG + Intergenic
938373522 2:130789154-130789176 TACAGTATTTATTATAAGTTAGG - Intergenic
938426715 2:131197700-131197722 ATCAGTATTCATTATACATTAGG + Intronic
938622610 2:133072199-133072221 CTCAGCCTTCATGAGAAGCTGGG + Intronic
939371429 2:141306223-141306245 CTCATTCTTCTTTATATGTCTGG + Intronic
939412694 2:141851112-141851134 TTCAGTCTTTATTATAAAGTTGG + Intronic
939678180 2:145097919-145097941 CTGATTCTTCTTTATATGTTAGG + Intergenic
939678442 2:145100969-145100991 CTGATTCTTCTTTATATGTTAGG - Intergenic
944061764 2:195576976-195576998 CTAAGTCATAATTATAACTTGGG - Intronic
945172451 2:207011229-207011251 CTCAGTTTTGATTATAAAATAGG + Intergenic
946585966 2:221188185-221188207 CTCATTCTATAGTATAAGTTTGG - Intergenic
1169717826 20:8640495-8640517 CTCAGTGTTAATTATTACTTTGG - Intronic
1170871304 20:20209029-20209051 TCATGTCTTCATTATAAGTTAGG + Intronic
1170996527 20:21365355-21365377 CTCAGTCTACATGATAAGACAGG + Intronic
1172363836 20:34333825-34333847 CTCTGTCTTGATCAGAAGTTGGG + Intergenic
1173836487 20:46129265-46129287 CTCTGTCTTTAATACAAGTTGGG - Exonic
1173956169 20:47034623-47034645 CTCAGTTTTCCTTTTAACTTTGG - Intronic
1175150056 20:56926477-56926499 ATCATTCTTCATCATCAGTTAGG + Intergenic
1177004792 21:15658126-15658148 TTCAGTCTTAATTATAAATAGGG - Intergenic
1180467854 22:15631742-15631764 ATCAGTATTCATTATACATTAGG + Intergenic
1184882469 22:47318249-47318271 TTCTTTCTTCATTAAAAGTTTGG + Intergenic
949806604 3:7962255-7962277 TTCAGTTTTCAATGTAAGTTAGG + Intergenic
951367637 3:21803707-21803729 CTCAGTCTTCATCATTGTTTAGG + Intronic
955612252 3:60770009-60770031 ATTAGTCTTGATTATCAGTTGGG + Intronic
955736564 3:62044917-62044939 CTCAGTCTTGATTAAAAGGATGG - Intronic
956951492 3:74288592-74288614 ATCAGTCTTTTTTTTAAGTTTGG - Intronic
957140431 3:76348217-76348239 ATCAGTCTTCATAAGAAGTCTGG + Intronic
957715906 3:83929236-83929258 CTCAGTCTTCATTCTTCCTTTGG - Intergenic
957907954 3:86581843-86581865 TTCAACCTTCATTTTAAGTTCGG - Intergenic
959823245 3:110762129-110762151 ATCATTCTTCTTTATAACTTAGG + Intergenic
960924710 3:122783023-122783045 CACAGTCATCATTCTAAGTGAGG + Intronic
962098264 3:132314951-132314973 ATCAGTCTTCATTATCAGGAAGG + Intergenic
962750461 3:138431227-138431249 TTCAGTCTTCTTTTTAATTTAGG + Intergenic
963640036 3:147849451-147849473 CTTAATCTTTATTATAGGTTGGG + Intergenic
964387056 3:156158990-156159012 CTGAGTCTTCATTCTCAGTCAGG - Intronic
964852314 3:161107818-161107840 CTAACTCTTGATTATATGTTCGG - Intronic
965828621 3:172756177-172756199 TTCATTCTTCATTCTAGGTTAGG + Intronic
966122194 3:176535216-176535238 TTCAATCTTCATGATATGTTTGG + Intergenic
967830177 3:193911989-193912011 CTTAGTCTTCACTGTAAGTGGGG - Intergenic
969921993 4:10549039-10549061 CTGTGTCTTCATTATAATGTAGG + Intronic
971826293 4:31627973-31627995 CTCAGTTTTCTTTATAATTATGG - Intergenic
973226786 4:47794194-47794216 CTAAGAATACATTATAAGTTAGG + Intronic
975367177 4:73542829-73542851 TTCAGTCTTCATTCTAAATTAGG - Intergenic
976499304 4:85768995-85769017 CTCATCCTTCATCATAAATTAGG - Intronic
979680727 4:123456612-123456634 CTCAATCTTGATTTTAAGTTAGG - Intergenic
981904175 4:149901929-149901951 ATCTGTCCTCATTATATGTTAGG - Intergenic
983606212 4:169588284-169588306 CTTAGTCTTCACAATAATTTTGG - Intronic
984598171 4:181695601-181695623 CTCAGTCTTCAGCATTAGTTTGG - Intergenic
987497531 5:18667315-18667337 CTCAGTTTTCCTAAAAAGTTTGG + Intergenic
987805578 5:22761214-22761236 TTCAGTCTTCATGAAAAGCTGGG - Intronic
991425191 5:66483632-66483654 GTAAGACTTCATTATATGTTTGG + Intergenic
991488307 5:67160602-67160624 ATCAGTATTCTTTTTAAGTTTGG + Intronic
991511216 5:67378515-67378537 CTGAGTCTTCATTTTAACATAGG - Intergenic
992566711 5:78002962-78002984 CTCAGTGTTTATGATAAGCTGGG + Exonic
992718119 5:79531461-79531483 CTCAGTGTTCATTCTAAAGTAGG - Intergenic
993099271 5:83516931-83516953 CTCAGACTTCCTTTTCAGTTTGG - Intronic
994966606 5:106680500-106680522 CTCAGTTTTCATTTTCACTTTGG - Intergenic
996136483 5:119848485-119848507 TTCATTCTTCATTAAATGTTTGG - Intergenic
997841954 5:137249738-137249760 CTCAGTGTTACTTATAATTTGGG - Intronic
998913437 5:146987231-146987253 CTTAGTATTTATTATAAGTCAGG - Intronic
1000520536 5:162289544-162289566 CTCAATCATCATTATAAATAAGG - Intergenic
1003332261 6:5139335-5139357 CGCAGGCTTCATTCAAAGTTAGG + Intronic
1004191242 6:13465661-13465683 CTCAGGCTTGACTATGAGTTAGG - Intronic
1005717216 6:28561439-28561461 ATCAGTCTACATCATGAGTTTGG - Intergenic
1007431181 6:41778226-41778248 GTCAGTTTTCATTAACAGTTGGG - Intronic
1007539539 6:42628402-42628424 CACAGTCTTCATTTTTAGTTTGG + Intronic
1008712755 6:54248421-54248443 CTCTGTTTTCATTATAACCTGGG + Intronic
1008904451 6:56661013-56661035 CTCTGTATTCATTAAAATTTAGG - Intronic
1009318418 6:62253988-62254010 TTCAGTCTTTGTTAAAAGTTAGG - Intronic
1009500893 6:64412353-64412375 CTCATTCTTCATTATTTGTTTGG - Intronic
1009541488 6:64965524-64965546 TTCATTCTTCATTATAAATGAGG + Intronic
1009955843 6:70451782-70451804 CTCAATCAACATTATAAATTAGG - Intronic
1010713614 6:79204054-79204076 AGCAGTCTTCATTACCAGTTGGG - Intronic
1011880959 6:92026078-92026100 CTCAGTGCTAATTATATGTTAGG - Intergenic
1012371573 6:98513766-98513788 CTGAGTGTTCATTATAAATAGGG - Intergenic
1012641718 6:101625769-101625791 CTCAGTCATCTTTATATATTTGG - Intronic
1012787381 6:103648253-103648275 CTCAGTCTTAATTATAATTGTGG + Intergenic
1016891354 6:149010527-149010549 CTCAGTTTTCATTAGATTTTTGG - Intronic
1018792584 6:167160597-167160619 TTCAGTTTTCATTTAAAGTTAGG - Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1021733105 7:23616523-23616545 CTCATGCTTCATTGTAAGTTTGG + Intronic
1025925322 7:65954474-65954496 GTCAGTCTTCATTTTAAATATGG + Exonic
1026382141 7:69810391-69810413 CTCAGTCTTAATTATGGGCTAGG - Intronic
1028936207 7:96466545-96466567 CTGAGACTTCATTATAATTGTGG + Intergenic
1030962314 7:115941126-115941148 CTCAGACTTTTTTTTAAGTTTGG + Intronic
1033999988 7:147401351-147401373 TTAAGTCTTCATTATATTTTTGG + Intronic
1034026584 7:147711167-147711189 AGCAGTCTTAATTGTAAGTTAGG - Intronic
1034235198 7:149561451-149561473 CTCAGTCTCTATCCTAAGTTAGG - Intergenic
1036913570 8:12782423-12782445 CTCATTCTTCTTTAAATGTTTGG + Intergenic
1037111356 8:15167652-15167674 CTCAGTCCTTTTTATAATTTGGG + Intronic
1037520137 8:19673055-19673077 CTAAGGCTACATTATAAATTAGG - Intronic
1038126192 8:24675480-24675502 CTTAGACTTCATTAAAAGTTCGG - Intergenic
1042394954 8:68281376-68281398 CTAATTCTTCATTAAATGTTTGG + Intergenic
1042469710 8:69171491-69171513 CTGACTCTTCATTAAATGTTGGG + Intergenic
1043233183 8:77828929-77828951 TTCATTATTCTTTATAAGTTTGG + Intergenic
1044183660 8:89225640-89225662 CTCTGTGTTCACTACAAGTTGGG + Intergenic
1045333679 8:101179559-101179581 CTCAGTTTTGGATATAAGTTTGG - Intronic
1045731769 8:105250137-105250159 TTTATTCTTCATTAAAAGTTTGG + Intronic
1045918449 8:107501619-107501641 CTCATTCTTTAGAATAAGTTTGG - Intergenic
1047565899 8:126043202-126043224 TTCATCCTTGATTATAAGTTTGG - Intergenic
1047776573 8:128076314-128076336 CTCACCCTTCACTATATGTTGGG + Intergenic
1049695063 8:143979497-143979519 CTCATTCTTCATTACTAGTTTGG - Intronic
1050407520 9:5326009-5326031 GTCAGACTTCATTATAACTGTGG - Intergenic
1055756349 9:79562625-79562647 CTCAGTCTGGATTACAAATTGGG + Intergenic
1056423983 9:86457810-86457832 CTCCGTCTTCCCTGTAAGTTTGG + Intergenic
1058046121 9:100358920-100358942 CTAAGTTTTCACTAGAAGTTAGG + Intergenic
1186303452 X:8227282-8227304 CTCTGTCTTCATAATAACTTAGG + Intergenic
1186365750 X:8891521-8891543 CTCAGTCCTCATTAAGATTTTGG + Intergenic
1187503788 X:19862495-19862517 CTCAAGCTTCACTATAAGTTTGG + Intronic
1189715176 X:43857766-43857788 TTCATTTTTCATTCTAAGTTAGG + Intronic
1189835517 X:45017389-45017411 CTCAGACTACATTCTAATTTTGG - Intronic
1191964147 X:66738437-66738459 TTCATTCTTCTTTAAAAGTTTGG + Intergenic
1193051589 X:77106035-77106057 CTCAGGATTGATTATATGTTGGG + Intergenic
1193491189 X:82150506-82150528 TTCATTCTTCTTTATAAATTTGG - Intergenic
1193562484 X:83036196-83036218 GTCATTCTTCATTGTAAGTTTGG - Intergenic
1193834075 X:86321409-86321431 CTCAGTCTTCCTAAAAAGTCAGG + Intronic
1194426163 X:93740966-93740988 CTCAGCCTTCATTTTGAGTTAGG - Intergenic
1196050984 X:111303900-111303922 CACATTCTTCATTATTTGTTTGG + Intronic
1196255559 X:113514242-113514264 TTCAGGCTTCATAATAATTTGGG - Intergenic
1196470335 X:116016896-116016918 CTCAGTGCTCAATATAGGTTTGG - Intergenic
1197842243 X:130761246-130761268 GTAATTCTTCTTTATAAGTTTGG + Intronic
1199242423 X:145563237-145563259 CTCAGTTTTCATTAGAAAGTTGG + Intergenic
1199330011 X:146548532-146548554 CACAGGCTTTATGATAAGTTAGG + Intergenic
1199797663 X:151216687-151216709 CTGAGGCTACATTATCAGTTGGG - Intergenic