ID: 1109232892

View in Genome Browser
Species Human (GRCh38)
Location 13:59780814-59780836
Sequence TTTCCTTTTGGACATGTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 339}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109232892 Original CRISPR TTTCCTTTTGGACATGTTAA TGG Intronic
900019493 1:179035-179057 TTTCCTTCTGGCCATGCTGATGG + Intergenic
900969980 1:5986513-5986535 TTTCCTTTTTGAAATGCAAATGG - Intronic
901519273 1:9770125-9770147 TTTCCTTTTGGATATTTTCATGG - Intronic
903752853 1:25639184-25639206 TTTCCATTTGGACTTTCTAATGG + Intronic
904380489 1:30107341-30107363 TTTCCTTTTGGAGAAGAGAAGGG - Intergenic
904702197 1:32364402-32364424 TTTCCTTTTAGAGATCTTCATGG + Intergenic
906896002 1:49773295-49773317 TTTTCTTTAGGACCTGTTACTGG + Intronic
907340994 1:53736233-53736255 TTTTATTTTGGACATGTTTGGGG + Intergenic
908878359 1:68702987-68703009 TTTGCTTTTGAACATGTTAAGGG - Intergenic
911479520 1:98420212-98420234 TTTAATTTTGGAGATGTCAAAGG + Intergenic
911555895 1:99344052-99344074 TTTCCACTTGGACATCTGAAAGG - Intergenic
912628345 1:111225075-111225097 TTTTCTTTTATACATTTTAAGGG + Intronic
912699224 1:111864095-111864117 TTCCATTTTGGTCATGTTGAGGG + Intronic
917041108 1:170807355-170807377 TTTCTTCTTGCACATTTTAAAGG - Intergenic
918156943 1:181857246-181857268 TTTTCTTATGGATATGTTAAGGG - Intergenic
918296743 1:183164381-183164403 TTTCCTTCTGCTCATTTTAATGG + Intergenic
919128372 1:193424483-193424505 TTTTTTTTTGGTCATATTAATGG + Intergenic
919721262 1:200839038-200839060 TTTTCTTTTGGATATCTCAAAGG - Intronic
920257986 1:204669309-204669331 TTTCCTTTCGGACTTTTTCATGG + Intronic
921353903 1:214266377-214266399 TTTCTTTTGGGAAATGTTACAGG - Intergenic
921586944 1:216958459-216958481 TTTAATTTTGGCCATATTAATGG + Intronic
923316698 1:232787186-232787208 ATTCCCTTTGGCCATGTAAATGG - Intergenic
924955982 1:248927306-248927328 TTTCCTTCTGGCCATGCTGATGG - Intergenic
1062838149 10:649943-649965 TTTCCGTTTTGATGTGTTAATGG - Exonic
1064301366 10:14126075-14126097 TTTCCTTTTGGACAATTGTATGG - Intronic
1065183392 10:23149081-23149103 TTTCCTTATGCACTTCTTAAGGG + Intergenic
1065320018 10:24500568-24500590 TTTCATTTTGGAAATCTGAAGGG + Intronic
1065410016 10:25415539-25415561 ATTCCTGTTGGAAATGTAAATGG + Intronic
1067761314 10:49049154-49049176 TTACCTTTAGGACAGGTGAAGGG + Intronic
1069721815 10:70554600-70554622 TTTCCTTTTGGGCTTGGAAAGGG + Intronic
1069914098 10:71776637-71776659 TTTCCCTTTGGACATGTGAGTGG - Intronic
1071254176 10:83854032-83854054 TTTTCTTTTGGACATAGTAATGG - Intergenic
1072012390 10:91314125-91314147 TTTCCTTTTGTGCAAGTGAAAGG - Intergenic
1072060778 10:91808654-91808676 TTTCCTTCTGGATATTTTAAAGG - Intronic
1072114460 10:92356537-92356559 TTTCCTTTTGAATAAGATAATGG - Intergenic
1072203647 10:93182939-93182961 TTTCCCTTTTGACATTTTATGGG - Intergenic
1072766045 10:98096003-98096025 TTTTCCTTTGGACATCTTAAGGG + Intergenic
1072833625 10:98687243-98687265 CTTTCTTTTGGAGATGCTAAGGG + Intronic
1074487660 10:113902477-113902499 TTTGCTTTTGGTGATGTTGATGG + Exonic
1075497761 10:122941723-122941745 TGTCCTTTTAAACATGCTAATGG - Intronic
1075987253 10:126798633-126798655 TCACCTTTTGGACTTGTTCAAGG - Intergenic
1075993592 10:126858955-126858977 ATTCCTTTTGGAAAAGTTACAGG + Intergenic
1076961615 10:133766712-133766734 TTTCCTCCTGGACATGCTGATGG - Intergenic
1076976096 11:174230-174252 TTTCCTTCTGGCCATGCTGATGG + Intronic
1077772490 11:5235388-5235410 CTTCCTTTTGGATATGCTCATGG - Intergenic
1079960312 11:26915350-26915372 TCTCCTTTTCTAAATGTTAATGG - Intergenic
1081660172 11:44883270-44883292 TGTCCTTTTGGAAATGGAAATGG - Intronic
1087642091 11:100765933-100765955 TTTTATTTTGGAAGTGTTAATGG - Intronic
1087804431 11:102539951-102539973 TGATCTTTTGGAAATGTTAAAGG - Intergenic
1087973921 11:104520353-104520375 TTTTCTTTTAGACATATGAAAGG + Intergenic
1088940092 11:114444976-114444998 TTTTTTGTTGGACATTTTAAAGG + Intronic
1089952118 11:122537581-122537603 GTTCCTTTTGGATCTGTTACTGG - Intergenic
1090212453 11:124931535-124931557 TTTCCTTTTGGCCATCCTATTGG - Intronic
1093263317 12:16968470-16968492 TTTCCTTTTTAAAATGTGAATGG - Intergenic
1093488397 12:19678018-19678040 TTATCTTTTCGACATGTTATTGG + Intronic
1094960090 12:36073504-36073526 TTTCCATGTGGACATTTCAAAGG + Intergenic
1094985380 12:36481849-36481871 TTTCCATGTGGACATTTCAATGG + Intergenic
1095007367 12:36837924-36837946 TTTCCATGTGGACATTTCAAAGG + Intergenic
1095703182 12:45211791-45211813 TTTCCTTTTGCATGTTTTAATGG - Intergenic
1095993765 12:48060242-48060264 TTTGCTTCTGGTCATGATAAAGG - Intronic
1096192313 12:49627944-49627966 TTTCCATTTGGACAATTGAATGG + Intronic
1097347755 12:58513516-58513538 TTACCTTCTTGACATTTTAAAGG - Intergenic
1097576758 12:61403547-61403569 TTTCCTTTAGGGCCTGGTAATGG + Intergenic
1097755653 12:63404170-63404192 TTTTGTTTTGGGCATGGTAAAGG + Intergenic
1097925195 12:65119749-65119771 TTACCTTTTGTACATTTTTATGG - Intronic
1100731527 12:97476018-97476040 TTTCTTTTTGAAGATGTTGATGG + Intergenic
1100904565 12:99282799-99282821 TTTCGTTTTAGACATTTAAAGGG + Intronic
1101672091 12:106884924-106884946 TTTGCTTATGGACATGTTTTTGG + Intronic
1101960180 12:109243175-109243197 TTTCCTTCTGGTCTTTTTAATGG + Intronic
1102072265 12:110030677-110030699 ATTACATTTGGAAATGTTAATGG + Exonic
1102130952 12:110528390-110528412 TTCAGTTTTGGATATGTTAAGGG + Intronic
1102747520 12:115262378-115262400 TTTCTCTTTGGAGATGGTAAAGG - Intergenic
1103023047 12:117551991-117552013 TTTCCTTTGTGACATTTTGAGGG - Intronic
1103750511 12:123155900-123155922 TTTCCTTTTGGCCAGGGTGAAGG + Exonic
1105355884 13:19659190-19659212 TTTCATTTTAGATGTGTTAAGGG + Exonic
1106534272 13:30625090-30625112 TTTCCCTTTGGACTAGTTGAAGG + Intronic
1106762799 13:32883491-32883513 TTTCATTTTAGACAAGTTAAAGG + Intergenic
1107039821 13:35936934-35936956 TTTTCTTTTGGATGTTTTAATGG - Intronic
1109145940 13:58779846-58779868 TTTCCTTTTTATTATGTTAATGG - Intergenic
1109232892 13:59780814-59780836 TTTCCTTTTGGACATGTTAATGG + Intronic
1109258372 13:60111945-60111967 TTAGCTTTTGCTCATGTTAATGG - Intronic
1109810465 13:67507187-67507209 TGGCCTTTTTGACATGTTTATGG - Intergenic
1109880273 13:68464543-68464565 ACTCCTTTTGGAGATGTAAAAGG - Intergenic
1110303688 13:73959032-73959054 TGTCCAGTTGGAGATGTTAAGGG - Intronic
1110985395 13:81960795-81960817 TTTACTTTTTGATATGTTACTGG - Intergenic
1111066512 13:83100954-83100976 TTTCCTATTTGACATATTTAAGG - Intergenic
1111380793 13:87448384-87448406 TTTCATTATTGAGATGTTAAAGG - Intergenic
1111873150 13:93859905-93859927 GATCCTTGTGGCCATGTTAAGGG - Intronic
1112079522 13:95953940-95953962 TTTCCTTTTGAGCATGCTTAGGG - Intronic
1112865417 13:103890252-103890274 TTTCCTAATAGACAAGTTAAGGG + Intergenic
1114128719 14:19763008-19763030 TTTCCTTTTGGCTTTTTTAAAGG - Intronic
1114629247 14:24148549-24148571 TTTCCTTCTGTGAATGTTAAGGG + Intronic
1114832880 14:26165850-26165872 CTTACTTTTGGATATGTTATGGG + Intergenic
1114884007 14:26824806-26824828 TTCAATTTTGGACATGGTAAGGG + Intergenic
1115336270 14:32246715-32246737 TTTTCTTTTGGACATGGAAGTGG - Intergenic
1115709976 14:36039878-36039900 TTTCCTTTTTTATATGTGAATGG + Intergenic
1115805366 14:37044993-37045015 TTTTCTTTTGGAGATGAAAAAGG + Intronic
1116612431 14:47092979-47093001 ATTCCTTGGTGACATGTTAATGG - Intronic
1119639340 14:76303015-76303037 TTTCCTTTTGGAGAGGTGACAGG + Intergenic
1124943410 15:34239642-34239664 TATGCTTTTTGACATTTTAATGG + Intronic
1125417475 15:39468429-39468451 TTTCCTTTGGAACATGTTTAAGG - Intergenic
1125616926 15:41022789-41022811 GTTCCTTTTGGAGAGGATAAAGG - Intronic
1126038325 15:44567768-44567790 TTTCCTGTTGGAAGTGTGAAAGG + Intronic
1126525290 15:49647263-49647285 TTTCTTTGAGGCCATGTTAATGG + Exonic
1128145938 15:65332584-65332606 CTTTCATTTGGACAGGTTAACGG + Intronic
1128959052 15:71981157-71981179 TATCCTTTTGTACATATTGATGG + Intronic
1129572366 15:76701828-76701850 TATCTTTTTAGCCATGTTAAAGG - Exonic
1130426326 15:83804640-83804662 TTTCCTTTAGGAATTGTGAAGGG + Exonic
1134877940 16:17718882-17718904 TTTTTTTTTTGACATCTTAAAGG + Intergenic
1134889409 16:17825774-17825796 TATCTTTTTGGACATATTAAGGG + Intergenic
1136244739 16:28968067-28968089 TATTCTTTTAGACATGTGAAAGG - Intergenic
1136614822 16:31392084-31392106 TTTTCTTTTTCACATTTTAAAGG + Intergenic
1137819701 16:51432228-51432250 TTTCCTTTTGACAATGTTATAGG + Intergenic
1138006202 16:53340206-53340228 ATATCTTTTGGACATCTTAATGG - Intergenic
1138052357 16:53792811-53792833 TCTCCTCTTGGAAATGTCAAGGG + Intronic
1140027164 16:71301234-71301256 TTTCCTTGTGTACTTGTTACTGG + Intergenic
1140824383 16:78692296-78692318 ATTCCTTTTGAACATTTGAAAGG + Intronic
1141497121 16:84418105-84418127 TTTTCTTTTAGACATGGTAGGGG - Intronic
1142265101 16:89060745-89060767 TTTCCTTTTGGAATTGTTGGTGG + Intergenic
1142444163 16:90123438-90123460 TTTCCTTCTGGCCATGCTGATGG - Intergenic
1142463344 17:112040-112062 TTTCCTTCTGGCCATGCTGATGG + Intergenic
1143117800 17:4590561-4590583 TTTCAGTTGGGACATGTTGAGGG - Intronic
1145711587 17:26983322-26983344 CTTCCTTTGGGACATGTTTGTGG - Intergenic
1147356270 17:39900067-39900089 TTTCATTTTGTACTTGTTAGTGG + Intergenic
1150032405 17:61753400-61753422 TTTCCATTTGGATATCTTAAAGG - Intronic
1150330710 17:64292236-64292258 TTTCATTTTGAATATTTTAAAGG - Intergenic
1150696911 17:67413426-67413448 TTTCTTTTTGGAAAAGTTTAAGG + Intronic
1152964684 18:104142-104164 TTTCCTCCTGGACATGCTGATGG + Intergenic
1155412411 18:25561303-25561325 TTTCCTTTTGTAAATGATACAGG - Intergenic
1155500194 18:26479869-26479891 ATTTCTTGTGGACATGTGAATGG + Intronic
1155805368 18:30164290-30164312 TTTCCTAATGGGCATGTTATAGG + Intergenic
1156118268 18:33813383-33813405 TTATCCTTTGGACATTTTAATGG - Intergenic
1156136563 18:34046876-34046898 TTTCCTTTTGTAATTTTTAAGGG + Intronic
1156553837 18:38045442-38045464 TTTCCATTTGGAAATGATTAAGG + Intergenic
1158051232 18:53222748-53222770 TTTCCTATTGGAGATATTAAAGG + Intronic
1159195597 18:65110379-65110401 TTCTCTTTGGGGCATGTTAATGG + Intergenic
1159207945 18:65278510-65278532 TTTCATTTTATACATTTTAAGGG + Intergenic
1159826549 18:73219678-73219700 TTCCCTTTTGGAAATGTTATAGG + Intronic
1160438560 18:78870545-78870567 TTTCCTATTGCAACTGTTAATGG + Intergenic
1160653062 19:244478-244500 TTTCCTTCTGGCCATGCTGATGG + Intergenic
1162668526 19:12235869-12235891 TTCCCTTTTGGAAATTTTATAGG - Intronic
1163209280 19:15828714-15828736 TTCCCTTTTGGAAACGTTACAGG - Intergenic
1164060755 19:21671529-21671551 TTTCCTTTTGGACTTATTTCAGG + Intergenic
1164115299 19:22213895-22213917 TTTCCCTTTGGAAAAGTTATAGG - Intergenic
1164833327 19:31339777-31339799 TTTCCTTTTTGCCATGGGAAGGG - Intronic
1166728658 19:45044927-45044949 TTTCCTCTTCCACATGTGAAAGG + Intronic
1168489181 19:56793674-56793696 TTTCATTTTGGACATTTTGGAGG - Intronic
1168726790 19:58587738-58587760 TTTCCTTCTGGACATGCTGATGG - Intergenic
925555638 2:5128816-5128838 TTTCCTTTTGGACGAGTCATCGG - Intergenic
925839343 2:7976880-7976902 TTTGCTTTCGGAAATCTTAAAGG + Intergenic
927542260 2:23923637-23923659 TTTTTTTTTTGACATGTAAAAGG - Intronic
927929467 2:27034890-27034912 TTTCCTCTTGAACATGTGGAGGG + Intronic
930252553 2:49051363-49051385 TTTAATTTTGGCCATTTTAATGG + Intronic
930509611 2:52327580-52327602 TTTCCTTTGGGATCTGTTACTGG - Intergenic
930988766 2:57624815-57624837 TTTCCTTTTGGCTTTGTGAATGG + Intergenic
931623167 2:64231314-64231336 TTTAGTTTTGATCATGTTAAAGG + Intergenic
932012181 2:67989517-67989539 TTTCCTTTTGGCTTTGTTATGGG - Intergenic
933077105 2:77943046-77943068 ATTCCTTTTGGACATCTTAGGGG + Intergenic
935067413 2:99661704-99661726 TTGCCTTTTTTTCATGTTAATGG - Intronic
936273424 2:111069888-111069910 CTTCCCATTGGACATGGTAAAGG + Intronic
936571765 2:113623468-113623490 TTTCCTTCTGGACATGCTGATGG + Intergenic
936624213 2:114131055-114131077 TTTCCTCAAGGACAAGTTAATGG - Intergenic
936952735 2:117994404-117994426 TTCCATTTTGGAAATGTTAGAGG - Intronic
938223679 2:129596410-129596432 TTTCCTTTTGGGATTGTTCAAGG + Intergenic
938882366 2:135604222-135604244 TTTCCTTTTGGAAATATTTCAGG + Intronic
939757465 2:146131625-146131647 TTTCTTTTCATACATGTTAATGG - Intergenic
940024453 2:149191334-149191356 ATTCTTTTTGGAAATGTTTATGG + Intronic
940173982 2:150858909-150858931 TTTCTGTTTGGACAATTTAAAGG - Intergenic
941230714 2:162908671-162908693 TTTCCTCTGGGATATCTTAAAGG - Intergenic
941314912 2:163980456-163980478 TTTCCTTTTGGCCTCCTTAAGGG - Intergenic
941622492 2:167793809-167793831 TTGCCTTTTGCAAATGTTACAGG + Intergenic
942581226 2:177419951-177419973 TCTCATTTTGTACATGTTATTGG - Intronic
943077025 2:183208261-183208283 TTTCCTTTTGGGCATGGGATAGG + Intergenic
943086039 2:183312407-183312429 AATCCTTTTGGAAATGTTATTGG - Intergenic
944558573 2:200912314-200912336 TTTCCATTTGGAAATCTCAAAGG + Intronic
945571021 2:211467932-211467954 TTTCCTTTTGGAGAAAGTAAAGG + Intronic
945679434 2:212895926-212895948 TTTCCTTTTATACTTTTTAAGGG - Intergenic
946318504 2:218933436-218933458 TTTCATTTTGGCCATTTTGATGG + Intergenic
946758830 2:222973169-222973191 TCTCCATTTGGACATCTGAAAGG - Intergenic
946918300 2:224549766-224549788 GCTACTTTTGGGCATGTTAAGGG - Intronic
947478722 2:230477284-230477306 TTTTCTTTTAGATTTGTTAAGGG + Intronic
948138646 2:235656854-235656876 TTTCCTTTCTGTTATGTTAAAGG - Intronic
948572154 2:238924512-238924534 TTTCCTTTTTTACCTATTAATGG - Intergenic
1169606253 20:7322899-7322921 TTTAGTTTTGGACAGGTTGATGG - Intergenic
1169989406 20:11484236-11484258 TTTAATTTTGGAGATGTTAGAGG - Intergenic
1170393776 20:15903893-15903915 GTCACTTTTGGACACGTTAAAGG + Intronic
1171041877 20:21771678-21771700 TTTCCTAAAAGACATGTTAAGGG - Intergenic
1171075978 20:22123806-22123828 TCTCCTTTTGGATATCTGAAAGG + Intergenic
1172025859 20:31947963-31947985 TGTCCTTTTGGCCATTTTCAAGG + Intronic
1172140029 20:32716204-32716226 TTTCCTTTTAGATATGATAATGG + Intronic
1173312646 20:41912796-41912818 TTTCCTTTTTGTAATCTTAATGG + Intergenic
1173345870 20:42199385-42199407 CTTCCTTTGGGACATGTGCAAGG + Exonic
1174804833 20:53595333-53595355 TTTCATTTTGGATATGCTGAAGG - Intronic
1174864122 20:54119170-54119192 TCTCCTTTTAGACTTGTTCAAGG - Intergenic
1174948978 20:55022761-55022783 TTTCCTTCTGCACAAATTAAAGG + Intergenic
1175699897 20:61129347-61129369 TTTCCCTTTGCACATGTCTAAGG - Intergenic
1178285841 21:31324704-31324726 TTTGCTTTTGGCAATGTTAGGGG - Intronic
1179231639 21:39509161-39509183 TTTCCTTCTCAGCATGTTAAAGG - Intronic
1182314615 22:29436861-29436883 TTCCCTTTGGCACATATTAAAGG - Intergenic
1184850727 22:47118278-47118300 TTTTATTTTGGAAATGTTTATGG - Intronic
1185428431 22:50787421-50787443 TTTCCTTCTGGACATGCTGATGG - Intergenic
951148627 3:19260109-19260131 TTTACCTTTAGACATGTTGATGG - Intronic
951241687 3:20294287-20294309 TTCCCTTTTAGGCATGTTACTGG + Intergenic
951354947 3:21654530-21654552 CTTCCTTTTCTACATGTAAATGG + Intronic
951393823 3:22139913-22139935 TTTCATTTTAGCCATTTTAATGG - Intronic
952795871 3:37238679-37238701 TTTGTTTTTGGAGATGTTGAAGG + Intergenic
952868410 3:37874307-37874329 TTCCCTTTTGGTGATGTTGAGGG + Intronic
953052330 3:39356295-39356317 TGTCCTTTTGCAGATTTTAAAGG - Intergenic
954483159 3:50820669-50820691 TTTTCTTTTGGAAATAGTAATGG + Intronic
955708152 3:61750361-61750383 TTTGCAATTGGACATGCTAATGG - Intronic
955737742 3:62057744-62057766 TTACCTTTTTGGAATGTTAACGG - Intronic
956604271 3:71056454-71056476 TTTCCTTTTGGACATTTTGATGG + Intronic
958110968 3:89144499-89144521 TTTTCTTTTGGAATTATTAATGG + Intronic
959090885 3:101901405-101901427 TTTGGTTTTGGACTTATTAAAGG - Intergenic
959481700 3:106880785-106880807 TTTCTTTTTGGAGATGAGAAGGG + Intergenic
960392553 3:117096376-117096398 TTTCATTTTGGAAATGGAAAGGG - Intronic
960497336 3:118391024-118391046 TTTCTTTTTGAAAATGTTAAAGG - Intergenic
961420703 3:126801028-126801050 TTTTATTTTGGTCATGTTAGAGG - Intronic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
965650888 3:170931760-170931782 TTTCATTTTAGACATCTTACTGG - Intergenic
966288902 3:178331384-178331406 TGACCTTTAGGAAATGTTAAAGG + Intergenic
966395816 3:179501643-179501665 TTTCCTCTTGGACATTTAAGGGG + Intergenic
967117009 3:186351054-186351076 TTTACCTTTGGAGATGTTAGTGG + Intronic
967528986 3:190527701-190527723 TTTGCTTTTGGTCTTGTTATGGG + Intronic
967665846 3:192170989-192171011 GTTCCTTATTTACATGTTAAGGG - Intronic
967842794 3:194020266-194020288 TTTCTCTTTGGACGAGTTAATGG - Intergenic
967926903 3:194657361-194657383 GTTCCTTTTAAATATGTTAATGG - Intronic
968364783 3:198175555-198175577 TTTCCTTCTGGCCATGCTGATGG - Intergenic
971667003 4:29500305-29500327 TTTCCTCTTGGTCATTTTAGTGG + Intergenic
971773619 4:30931241-30931263 TTTTCTTTTGGACATGTCTATGG - Intronic
971843434 4:31886540-31886562 TTTACTTTTGCAAATTTTAAAGG - Intergenic
974731964 4:65878399-65878421 TTTCCTTTGGGTAATGTCAAAGG + Intergenic
974811556 4:66952877-66952899 TTTCCTTTAACACATGTTCACGG - Intergenic
974871615 4:67651049-67651071 TTACTTTTTGGACAGGATAAGGG - Intronic
975407629 4:74009447-74009469 TTGCATTTTGTACATGTTGAAGG + Intergenic
975664431 4:76720960-76720982 TTTCCTTTTTAAAATGTGAAAGG + Intronic
975788622 4:77922856-77922878 GTTCCATTTGGACATCTAAAAGG - Intronic
976368232 4:84255293-84255315 TTTCCTCATGGACATTTTAAAGG - Intergenic
976396755 4:84564356-84564378 TTCTCTTTTGGACTTGTTAATGG + Intergenic
977103223 4:92845497-92845519 ATTCCTTTTGGACATGTAGATGG + Intronic
977437700 4:97020274-97020296 TTCTCTTTTGGAGATGTTATAGG - Intergenic
978018104 4:103773616-103773638 TTCCTTTATGGGCATGTTAAGGG + Intergenic
979051706 4:115943353-115943375 TTTCATTCTGGAGATGTTTAAGG - Intergenic
980347873 4:131646581-131646603 TTTACTTTTGTGCATGTTATAGG - Intergenic
980438469 4:132811856-132811878 TTTTCTTTTAAACACGTTAATGG + Intergenic
980635221 4:135493350-135493372 TTTCCTTTTGCAAATATTTATGG - Intergenic
981063649 4:140456772-140456794 TTTGCTTTTTCCCATGTTAAAGG - Intronic
981635792 4:146877725-146877747 TTTCTTTTTGGCCATGTAAGTGG + Intronic
981673773 4:147316977-147316999 TTTCCTTTTGCATTTGTTTAAGG - Intergenic
982183423 4:152771907-152771929 TTTTCTTTTGGAGAAGTTAGAGG - Intronic
982522681 4:156439147-156439169 TTTGCTTCAGGACAAGTTAAAGG + Intergenic
982625690 4:157763293-157763315 TTTTCTTTTGTTCATATTAAAGG - Intergenic
982795511 4:159639043-159639065 TTTCCTTTTGGACACTTGCATGG - Intergenic
983113769 4:163786085-163786107 ATTCCTTCTGGAGATTTTAAGGG - Intronic
984299015 4:177891184-177891206 TATACATTTGGAGATGTTAATGG - Intronic
985326996 4:188782166-188782188 TTTTCTTTTGTACATGTCTATGG + Intergenic
985460381 4:190100121-190100143 TTTCCTTCTGGCCATGCTGATGG - Intergenic
985464845 4:190184194-190184216 TTTCCTCCTGGACATGCTGATGG - Intronic
986163643 5:5253235-5253257 TTTACTTTTGTACATTTTTAGGG + Intronic
988344815 5:30023100-30023122 TTTCCTGTTGGACAAGCTCAAGG - Intergenic
988460079 5:31427283-31427305 TTTCATTTTGATTATGTTAATGG - Intronic
988806228 5:34743249-34743271 GTTCCTTTTGGACATTCTGAAGG + Intronic
989503348 5:42195395-42195417 ATAACTTTTAGACATGTTAATGG - Intergenic
989856572 5:46302193-46302215 TTTTTTTTTGGATATGTGAAGGG - Intergenic
990132389 5:52602511-52602533 TTTCAATTAAGACATGTTAAGGG - Intergenic
991961423 5:72048452-72048474 TTTGCTTTTGTACATTTTCAAGG - Intergenic
993067781 5:83121454-83121476 TTTCATTTTAGACATTTTAGTGG + Intronic
994248154 5:97504724-97504746 TTTTCTTTTGCACATTTCAATGG - Intergenic
994650608 5:102522246-102522268 TTTCCTTGTGGATGTGCTAAAGG - Intergenic
994839631 5:104906380-104906402 TTTACTTTTGGACTTTTTTATGG - Intergenic
995026528 5:107429869-107429891 TTTCCTTTTGGATTTTTAAAAGG - Intronic
995225738 5:109698771-109698793 TTTTCTTTTAAACATGTAAAAGG + Intronic
995884706 5:116881321-116881343 TTTCCTCCTGAACATATTAAAGG + Intergenic
996069531 5:119119438-119119460 TTGATTTTTGGACATGCTAAAGG + Intronic
996619900 5:125487722-125487744 TTACCCTTTGGACATCTTCATGG - Intergenic
996875689 5:128238247-128238269 TTTCTCTTTGTATATGTTAAAGG + Intergenic
997508916 5:134439718-134439740 TTAACTTTTGTACATTTTAAAGG - Intergenic
997657129 5:135563740-135563762 GTTTCTCTTGGACATTTTAAAGG + Intergenic
997717094 5:136050485-136050507 TTTCCTTTTGGAGATGAGAAAGG + Intronic
998787461 5:145728174-145728196 TTTGCTTTTGTACATCTTTAGGG + Intronic
999961063 5:156756081-156756103 GTTCCTTTTTAACATGTTTAAGG + Intronic
1003022064 6:2518467-2518489 TTTACTTTTGGAGATGTTGTGGG + Intergenic
1003976534 6:11350311-11350333 TGTCCTTTTGGCCATGCTCAAGG + Intronic
1005173082 6:23010887-23010909 TTTCCTTTTTAATATATTAAAGG + Intergenic
1007067563 6:39007396-39007418 TTTCCTTTTGTAGATGTGAGAGG - Intronic
1008227088 6:48934518-48934540 TTTCCTATAGGAAATGCTAAAGG - Intergenic
1009515612 6:64613156-64613178 TTTAATTTTTTACATGTTAATGG + Intronic
1010333156 6:74647544-74647566 TTTCCTTTGGGATCTGTTACTGG - Intergenic
1010965445 6:82201041-82201063 TTTCCTTTTTGGCAGGTTTATGG - Intronic
1011038721 6:83006493-83006515 TTTCCTCCTGCACATGTCAAAGG - Intronic
1011329380 6:86186908-86186930 TTTTCTTTTGGAGATGTTGTGGG - Intergenic
1012502905 6:99909410-99909432 TTTCCTTTTAATCTTGTTAATGG - Intergenic
1012872688 6:104690841-104690863 TTTCCTTTTAGCAATTTTAATGG - Intergenic
1012978278 6:105803140-105803162 TTTCCTTGAGGGCATTTTAAAGG - Intergenic
1013292484 6:108731352-108731374 CTTCTTTTTGGACATTTGAATGG + Intergenic
1013799444 6:113924842-113924864 TTTCTTTTTGAAAATGTTACTGG + Intergenic
1013892865 6:115045870-115045892 TTTCCTTTTAAATATCTTAAAGG + Intergenic
1014478901 6:121911196-121911218 TTTCCTTTTGGGTCTGTTACTGG + Intergenic
1014910985 6:127092547-127092569 TATCCATTTGGAAATGTTCAGGG - Intergenic
1015887052 6:137928255-137928277 TTTCCTTCAGGCCATGGTAAAGG - Intergenic
1017964032 6:159248218-159248240 TTTTCTTTTTCAAATGTTAAAGG + Intronic
1018410501 6:163541032-163541054 TTTACTTGGGGACATTTTAAAGG + Intronic
1019251408 7:15334-15356 TTTCCTTCTGGCCATGCTGATGG + Intergenic
1020372641 7:7450698-7450720 TTTCCTTTTGCACACGTTGGAGG - Intronic
1020380737 7:7542634-7542656 TTTCTTTTATGCCATGTTAAAGG + Intergenic
1021699844 7:23307435-23307457 CTGCCTTTATGACATGTTAATGG - Intronic
1022941308 7:35242660-35242682 TTTCCTTTGGGAAAGGTTACTGG + Intronic
1024633507 7:51268272-51268294 TTTCCTTTTAGACAAATTACTGG - Intronic
1025756790 7:64351840-64351862 TTTACTTTTGGCCAAGTTAGGGG + Exonic
1026478761 7:70761024-70761046 TTTGCTTTTGTGCATGTTATCGG + Intronic
1027357030 7:77367571-77367593 TTAGCTTTTTGACATGTTATTGG + Intronic
1028908819 7:96184844-96184866 TTTCCATCTTGAAATGTTAAAGG - Intronic
1031219698 7:118949972-118949994 TTTCATTTTGGACATGGGACTGG - Intergenic
1031395929 7:121273631-121273653 GTTCCATTTGGTCATATTAAAGG - Intronic
1033129712 7:138735339-138735361 TTTGCTCTGGGACATGTCAAAGG + Intronic
1034682621 7:152940607-152940629 TTTCCATTTGGATATGTCAAAGG - Intergenic
1035512582 8:204194-204216 TTTCCTTCTGGCCATGCTGATGG + Intergenic
1035889570 8:3328967-3328989 TTCCCTTTGGTACATGATAATGG - Intronic
1036114153 8:5940488-5940510 TTTCCTATTAGCCATGGTAAAGG - Intergenic
1037089600 8:14897498-14897520 TTCCCTTTTCAACATGTCAATGG + Intronic
1037148822 8:15610072-15610094 TTTTCTTTTGGAAATTTTTAAGG + Intronic
1037572703 8:20172226-20172248 ATTCATTTGGGACATGATAAAGG + Intronic
1038324367 8:26561454-26561476 TTTCCACTTGGATATCTTAAAGG + Intronic
1038329932 8:26600317-26600339 TTTTTTTTTGGCCATGTTACTGG + Intronic
1038893899 8:31758931-31758953 TTACCTTTTTAATATGTTAAAGG + Intronic
1041876351 8:62691683-62691705 TTTCCTTTTGTACAGGTGAGTGG - Intronic
1043178537 8:77053354-77053376 TTTCCTTTTGGCAGAGTTAATGG + Intergenic
1043585676 8:81766906-81766928 TTTCCTACAGGAAATGTTAAAGG - Intergenic
1045184359 8:99821527-99821549 ATTCATTTTAGACAGGTTAAGGG - Intronic
1045906791 8:107355312-107355334 TTTTCTTCTGGATTTGTTAATGG + Intronic
1046318887 8:112544787-112544809 TTTCCTTTTGGACATCTTAGTGG + Intronic
1047104830 8:121720615-121720637 TTTCCTTCTGGTCTTGTCAAAGG + Intergenic
1047898938 8:129398272-129398294 TTTCCTTTGGGATCTGTTACTGG - Intergenic
1048063357 8:130943439-130943461 ATTCTTTTTGCAGATGTTAAAGG - Exonic
1048102264 8:131366112-131366134 TTTCCTTCTGAACAAATTAAAGG - Intergenic
1048273579 8:133048526-133048548 CTTCCTATTTGATATGTTAAGGG + Intronic
1048672001 8:136732949-136732971 TGTCCTTGTGGACATGGTGAGGG - Intergenic
1050173046 9:2842777-2842799 TTATGTTTTGGACATATTAAGGG - Intronic
1050610166 9:7343776-7343798 TCTCCTTTTGCACATGGAAAGGG + Intergenic
1051250245 9:15151869-15151891 TTTCCTTTTTCAAATGTCAATGG - Intergenic
1051709663 9:19918821-19918843 CTTCCTGTTAGACATGGTAAGGG - Intergenic
1052233822 9:26187327-26187349 TTTCCTTTGGGTAATGTCAAAGG - Intergenic
1054715836 9:68557125-68557147 TTACCTTTTGGAAAGGTGAATGG - Intergenic
1055145989 9:72935521-72935543 TTTACTTTTACACATGTCAAAGG + Intronic
1057372070 9:94482719-94482741 TTTCCTTTTCCACATATAAAAGG - Intergenic
1057520446 9:95755586-95755608 GTTCCTTTAGGACAGGTAAATGG - Intergenic
1057621704 9:96641970-96641992 TTTCCCTTTGGACTAATTAAAGG - Intronic
1060455673 9:123793470-123793492 ATTCCTTTGAGACATGTTAAGGG + Intronic
1062749151 9:138238438-138238460 TTTCCTTCTGGCCATGCTGATGG - Intergenic
1203574873 Un_KI270744v1:168009-168031 TTTCCTTCTGGCCATGCTGATGG - Intergenic
1203624568 Un_KI270750v1:872-894 TTTCCTTTTAGTCATATTTATGG - Intergenic
1186040326 X:5469938-5469960 TTTAATTTTGGACATGTTTAGGG - Intergenic
1187018504 X:15354670-15354692 TTTCCATTTGGTAATCTTAAGGG + Intronic
1189654826 X:43233563-43233585 TTTATGTTTGGACATGGTAATGG - Intergenic
1190032393 X:46986773-46986795 GTTCCTCTTGGACTTGATAATGG + Intronic
1192298654 X:69877775-69877797 TTTCCTTCTGGATATTTTATAGG + Intronic
1192875041 X:75220976-75220998 TGTCCTATAGGAAATGTTAAAGG - Intergenic
1192897029 X:75454658-75454680 TTTGATTTGGGACAAGTTAACGG + Intronic
1193000102 X:76554178-76554200 TTTCCTTTTTGACCTGCTATAGG + Intergenic
1194099822 X:89690035-89690057 TTTCTTTGTGGATATGTAAATGG + Intergenic
1197822567 X:130555830-130555852 TTTACATTTAGAGATGTTAAGGG - Intergenic
1197866141 X:131019375-131019397 TTTCATTTTAGACATTCTAATGG + Intergenic
1198685212 X:139221628-139221650 TTTCCTTTTGCCCATCTTCAAGG - Intronic
1199054335 X:143274910-143274932 TTTACTGTTGGACATAGTAAAGG + Intergenic
1199121689 X:144061551-144061573 TGATCTTTTGGAGATGTTAAAGG - Intergenic
1199137532 X:144270748-144270770 GTCTCTTTTGGACATGTCAAAGG + Intergenic
1199153446 X:144517359-144517381 TTTCCTTTTGGGTCTGTTACTGG - Intergenic
1200452826 Y:3351399-3351421 TTTCTTTGTGGATATGTAAATGG + Intergenic
1201950869 Y:19562443-19562465 GTTACTTTTGGAGACGTTAAGGG + Intergenic