ID: 1109237059

View in Genome Browser
Species Human (GRCh38)
Location 13:59835716-59835738
Sequence CAGTTGTAAGAGTGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109237059 Original CRISPR CAGTTGTAAGAGTGGGAAGT GGG (reversed) Intronic
900957637 1:5897021-5897043 CAGTTTTCAGAGTGAGAAGTCGG - Intronic
901963613 1:12847788-12847810 CAATTCTAAGAGTGGAAAGCGGG - Exonic
901984283 1:13061804-13061826 CAATTCTAAGAGTGGAAAGCGGG + Exonic
901991255 1:13115899-13115921 CAATTCTAAGAGTGGAAAGCGGG - Intergenic
901997527 1:13164966-13164988 CAATTCTAAGAGTGGAAAGCGGG - Exonic
902875938 1:19340856-19340878 CAGTGGAAAGAGTGGGTAGAGGG + Intronic
903360824 1:22775976-22775998 AAGTTGGCAGAGTGGGAGGTGGG + Intronic
903495058 1:23760373-23760395 AAATTGTAAAAGTGGGAGGTGGG - Exonic
906256201 1:44352626-44352648 AAGTGGTAAGAGTTGGAGGTGGG - Intronic
908021791 1:59905577-59905599 GATATGTAAGAGTGGAAAGTGGG + Intronic
908277170 1:62485668-62485690 CAATAGTAAAAGTGGGGAGTAGG + Intronic
908778025 1:67660514-67660536 TAATTCTAAGAGTGGGCAGTGGG - Intergenic
909421800 1:75475587-75475609 CAGTTAAAATAGTGGGAAATGGG - Intronic
910698369 1:90046138-90046160 CAGTTTTTATAGTGGGAAGCAGG + Intergenic
912708715 1:111934162-111934184 CACCTGTAAAAGTGGGAGGTGGG + Intronic
914464281 1:147912239-147912261 CAGCAGTAAGACTGGGAAGAAGG + Intergenic
914682616 1:149949835-149949857 CAGTTGGCAGAGTGGGATGTAGG - Intronic
916916920 1:169417113-169417135 AACTTGTCAGTGTGGGAAGTGGG - Intronic
917788296 1:178483135-178483157 CACTGGTAAGAGTAGGAACTTGG + Intergenic
918645278 1:186897003-186897025 AGGTTGTAAGAGAGAGAAGTTGG + Intronic
918788894 1:188800146-188800168 CACTTGTAAGAGGGCCAAGTGGG + Intergenic
921067146 1:211631157-211631179 CTGTTGAAAGAGTGGGAAGAGGG + Intergenic
923385825 1:233464429-233464451 CAGGTTTAAGCGTGTGAAGTGGG - Intergenic
923462671 1:234220698-234220720 CTGTGGTGAGAGTGTGAAGTAGG + Intronic
923513598 1:234674732-234674754 CACCCGTAAGAGTGGGGAGTGGG + Intergenic
923966905 1:239151836-239151858 TAGTTGTAAGAGTGGTAATCAGG - Intergenic
924016674 1:239733311-239733333 TAGTTGAAAGAGGGGGAAGAAGG + Intronic
1066063218 10:31742726-31742748 AAGTTGTGAGAGAGGCAAGTAGG - Intergenic
1068555335 10:58452605-58452627 CAGTTGCAATACTGGGAAGAGGG + Intergenic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1068875962 10:61997147-61997169 CAGTTGTAGGAGTTGAGAGTAGG + Intronic
1068958899 10:62846588-62846610 TGGCTGTAAGAGTGGGAAGAAGG - Intronic
1069421674 10:68252079-68252101 CAATTGTAATAATGGGAAATTGG + Intergenic
1069431717 10:68341780-68341802 CAGTTGGAAGAATGGGAATGGGG + Exonic
1070107523 10:73449417-73449439 CAGTTCTAAGAGTAGGCAGCTGG + Intronic
1070522671 10:77268048-77268070 CACTTGTGAGAGTGGAAAGGAGG - Intronic
1071310241 10:84336596-84336618 CTGTTCTAGGAGTGGCAAGTAGG + Intronic
1072867985 10:99084824-99084846 CAGTGGTAACAGGGGCAAGTTGG - Intronic
1072913760 10:99524520-99524542 CATTTGTGGGAGTGGGAAGCTGG + Intergenic
1073847307 10:107571831-107571853 CAGGGGTAAGGGTGGGAAGGGGG + Intergenic
1074123723 10:110512045-110512067 TAGTTGCAAGAGTGGAAAGAGGG - Intergenic
1075481581 10:122786973-122786995 CAGTTGTAAGTGTGGGAGCATGG + Intergenic
1075981659 10:126745711-126745733 GAGGTGGAAGAGTGGCAAGTGGG - Intergenic
1076611504 10:131728826-131728848 CCTTTGTCAGAGTGGGAGGTTGG + Intergenic
1077942000 11:6852553-6852575 AAGTTGTAAGAGTAGAAAGAGGG + Intergenic
1078875398 11:15389779-15389801 AAGTGGTAAAAGTGGGAAGTGGG + Intergenic
1079347027 11:19662040-19662062 TAGTTGTGGGAATGGGAAGTGGG + Intronic
1080620186 11:33980803-33980825 CAGTTGTCACAGAAGGAAGTTGG - Intergenic
1080944044 11:36951031-36951053 GAATTGTAAAAGTGGGAAGAGGG + Intergenic
1083383933 11:62293497-62293519 CTGTTAAAAGAGTGTGAAGTGGG - Intergenic
1084005966 11:66323746-66323768 CAGATGTATGAGTGGGTAGAAGG + Intergenic
1084945405 11:72635679-72635701 CACTTGTAAAAGGAGGAAGTTGG - Intronic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1086066879 11:82754958-82754980 CAGTGGAAAGAGTGTGAAGATGG - Intergenic
1086814155 11:91347767-91347789 CAGTTGTGAGAGGTGGGAGTGGG - Intergenic
1087406802 11:97740905-97740927 CTGTTCCAAGAGTGGGAATTAGG + Intergenic
1087466191 11:98509711-98509733 CAGGGGAAAGAGTGGGAAGGAGG - Intergenic
1089093125 11:115895205-115895227 CAGTTGTATGAATGGGAGGAAGG - Intergenic
1090055657 11:123422145-123422167 CATTTGTAGGAGAGGGATGTGGG + Intergenic
1090332214 11:125941250-125941272 CTGTTGTAAGAGCGGGATGGTGG - Intergenic
1090963170 11:131574840-131574862 CAGAGGTAACAGTGGGGAGTGGG - Intronic
1091284779 11:134402521-134402543 CAGGTGTAACAGAGGGAGGTGGG - Intronic
1091357314 11:134947267-134947289 CAGTGGACAGAGTGGGAAGGTGG - Intergenic
1091637128 12:2205663-2205685 GAGTTTTTAGAGTAGGAAGTAGG + Intronic
1093907113 12:24706053-24706075 GATTTGTAAGAGTGAGCAGTGGG + Intergenic
1097361218 12:58660469-58660491 CACTTGTAAAAGTTGGATGTGGG - Intronic
1097922889 12:65095694-65095716 CAGTTGTAATAGAAGGAAATAGG + Intronic
1099069636 12:78029581-78029603 CAGTTGAGGGACTGGGAAGTGGG - Intronic
1100167544 12:91934054-91934076 CTGTTGTAAGAGTTAGAAGAAGG - Intergenic
1105400999 13:20096015-20096037 CATTTGTAAGAGTAGTCAGTGGG - Intergenic
1106223277 13:27765460-27765482 AAGTTGGAATAGTGGGAAGAAGG - Intergenic
1107651600 13:42550578-42550600 CAGCTATTAAAGTGGGAAGTAGG + Intergenic
1107718916 13:43227946-43227968 CAGATGCAGGAGTGGGAGGTGGG - Intronic
1108451322 13:50568021-50568043 CATTTGTATAAGTTGGAAGTAGG - Intronic
1108640730 13:52380331-52380353 CAGTACAAAGAGTGGGCAGTGGG - Intronic
1109237059 13:59835716-59835738 CAGTTGTAAGAGTGGGAAGTGGG - Intronic
1109343213 13:61088266-61088288 CAGTTGGAAGAGGGCCAAGTGGG - Intergenic
1109467607 13:62757812-62757834 CAGTTCTAAGAGTTCTAAGTGGG + Intergenic
1109599353 13:64603407-64603429 CAGTTGTAAGAGTAGAGAATAGG + Intergenic
1111065405 13:83085128-83085150 TACGTGTAAGAGTGAGAAGTGGG - Intergenic
1114673975 14:24429206-24429228 CAGGAGTAAGAGTGGGAGGCAGG - Exonic
1115402496 14:32978260-32978282 CATTTGTAAGATTGGGAGTTGGG + Intronic
1115790261 14:36870148-36870170 CAGATGTAAGAAGGGGAAATGGG + Intronic
1117586258 14:57209614-57209636 CAGTTGTATGGGTGGCATGTTGG - Exonic
1119509003 14:75196604-75196626 CAGTGGTGAGAGTGGGAGGTGGG - Intergenic
1120360093 14:83488947-83488969 CATTTGTAATAGTGAGAAGCTGG + Intergenic
1125409953 15:39395711-39395733 CAGGTGTGAGAGTGAGAAGAAGG + Intergenic
1125499057 15:40226397-40226419 AAGTTGTAATAGTAGGAAGATGG - Intergenic
1126512318 15:49492841-49492863 GAGCTGGAAGAGTGGGATGTTGG + Intronic
1128911568 15:71520184-71520206 CAGAAGTCAGAGTGGAAAGTTGG + Intronic
1132245719 15:100294733-100294755 GAGATGTTAGAGTGGGATGTTGG - Intronic
1133645361 16:7759262-7759284 CAGGTGTAATAGTAGGAATTCGG + Intergenic
1133774058 16:8884303-8884325 CAGCTGTGGGAGTGGGAAGCGGG - Intergenic
1135682654 16:24471641-24471663 CAGAAGAAGGAGTGGGAAGTAGG - Intergenic
1138024170 16:53509937-53509959 CAGTCTTATAAGTGGGAAGTAGG - Intergenic
1138169139 16:54832420-54832442 CAGGGGTAAGGGTGGGAAGAAGG - Intergenic
1140041788 16:71413032-71413054 CATTTGTAGGGGTGGGAACTTGG - Intergenic
1142067518 16:88071352-88071374 CAGTGGATTGAGTGGGAAGTGGG + Intronic
1142945477 17:3422821-3422843 AAGATGTGAGAGTGGGAGGTAGG + Intergenic
1151078141 17:71297721-71297743 GATTCCTAAGAGTGGGAAGTTGG + Intergenic
1152138100 17:78517787-78517809 CAGTTGTAAGAGAGAGAAGCTGG - Intronic
1152176599 17:78792093-78792115 CGGTGGCAAGAGTGGGAATTAGG + Intronic
1152276376 17:79360212-79360234 TCGTTGTAAGGGTGGGAAGCTGG - Intronic
1153170220 18:2307869-2307891 CAGGAGCAAGAGTGGGAAGAAGG - Intergenic
1153741042 18:8127971-8127993 TATTTGTAATAGTGGTAAGTGGG + Intronic
1156153353 18:34269822-34269844 CAGTTGAGAGACTGAGAAGTGGG - Intergenic
1156264776 18:35477684-35477706 GAGCTGAAATAGTGGGAAGTGGG - Intronic
1156885649 18:42132427-42132449 AGGTTAAAAGAGTGGGAAGTGGG - Intergenic
1157828293 18:50832509-50832531 CAGTTGCTAAAGTGGGAAGCAGG + Intergenic
1159493113 18:69163969-69163991 CATTTGAAAAAGTGGGCAGTTGG - Intergenic
1160880688 19:1318697-1318719 GAGCTGGGAGAGTGGGAAGTGGG + Intergenic
1163748085 19:19059865-19059887 CAGTGGAAAGACTGGGAAATGGG - Intronic
1165150921 19:33759630-33759652 CAGTTGGAGGAGAGGGAATTAGG - Intronic
1166034579 19:40158431-40158453 CAGTAGAAAGGGTGGGGAGTGGG - Intergenic
1166587570 19:43963899-43963921 CACTCGGAAGAGTGGGAAGTAGG + Intronic
1166599599 19:44082256-44082278 CAGATGTCAGGGTGGGAAGAGGG - Intronic
925587336 2:5476500-5476522 CAGTTGGAAGGGTGTGAGGTGGG - Intergenic
925623880 2:5822457-5822479 AAGTAGTAAGAGTGGGAAAAAGG - Intergenic
926411232 2:12604784-12604806 CAGATGGAAGTGTGGGAAGAGGG + Intergenic
926434017 2:12819862-12819884 CAGTTGCAAGAATGTGATGTGGG - Intergenic
927042516 2:19243920-19243942 CAGTTGAAAAATTGGGAAGGTGG - Intergenic
927232252 2:20835056-20835078 CACTTGTAAGAGTCAGAAGAAGG + Intergenic
927352795 2:22137554-22137576 CAATAGCAAGAGAGGGAAGTAGG + Intergenic
927842244 2:26453158-26453180 CAGGAGAAAGAGTGGGAAGAAGG - Intronic
928798782 2:35060240-35060262 CAGGTGAAAAAGTGGGAAGGGGG + Intergenic
929745648 2:44655102-44655124 CAGTTTTAAGAGTGGAAAATAGG + Intronic
929849038 2:45565213-45565235 CAGTTTTGAAATTGGGAAGTGGG - Intronic
931792011 2:65672100-65672122 CAGTAGTAAGACTGGGAGCTAGG - Intergenic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
933476784 2:82802050-82802072 CAGTTGTAAGATTGTGATGGGGG - Intergenic
934655113 2:96113289-96113311 CAGTTGGAAGTGTGGAAAGGAGG - Exonic
934922939 2:98360185-98360207 CATTTGTAAGAGAGGGAGGGGGG + Intronic
936158917 2:110069655-110069677 GGGTAGTAAGAGTGGGAAATGGG + Intergenic
936185743 2:110301677-110301699 GGGTAGTAAGAGTGGGAAATGGG - Intergenic
936902715 2:117501947-117501969 CAGATGTAAGAGTGTGTGGTAGG + Intergenic
938768219 2:134478063-134478085 CAGTAGCAAGAGTGGGAACAAGG - Intronic
940281922 2:151997734-151997756 CAGTTGTAGGGGTCAGAAGTTGG - Intronic
940659016 2:156523555-156523577 CATTTGTTATAGTGGGGAGTGGG - Intronic
943977925 2:194507838-194507860 CAGAGGAAAGAGTGGGAAGTGGG + Intergenic
946229813 2:218284302-218284324 CTGTTGTTAGAGGGGGCAGTGGG - Intronic
946362089 2:219225053-219225075 CTATGGTAAGACTGGGAAGTTGG - Exonic
947394824 2:229676015-229676037 AACTTGTGAGAGTGGGAAATGGG - Intronic
948227377 2:236321876-236321898 CCGTTGTATGAGTGTGAAGTTGG - Intergenic
948700602 2:239757389-239757411 CTCATGTGAGAGTGGGAAGTGGG - Intergenic
949077519 2:242070574-242070596 CAGCTGAAAGAGTGAGAAGCAGG - Intergenic
1169326264 20:4679234-4679256 CAGCTGCAAGAGTGAGGAGTTGG + Intergenic
1169603425 20:7288543-7288565 CAGTTGAAGGACCGGGAAGTAGG + Intergenic
1171571251 20:26253605-26253627 AAGTTATAAGATTAGGAAGTAGG - Intergenic
1172716856 20:36970756-36970778 CATTTGGAAGAGGGAGAAGTGGG + Intergenic
1177304083 21:19289913-19289935 CACTTGGAAGGGTGGGAAGGTGG + Intergenic
1179446291 21:41433215-41433237 CAGGTCTAAGAGTGGGAGGAGGG - Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182925806 22:34123611-34123633 CATCTGTAAGATTGGGATGTTGG + Intergenic
1183221010 22:36513171-36513193 CATTTGTAGACGTGGGAAGTTGG + Intronic
1183441565 22:37825713-37825735 CAGTTGGAAGAATGGGCAGAGGG - Intergenic
1184778906 22:46636416-46636438 CAGCTGAAAGTGTGGGAGGTCGG + Intronic
949319947 3:2798071-2798093 GAGTTGAAAGAGTGGGAGGGTGG - Intronic
949321534 3:2816422-2816444 TAGGGGGAAGAGTGGGAAGTGGG + Intronic
951361563 3:21730662-21730684 CAGTTGTTAGACTTGGAAGCAGG - Intronic
951595289 3:24312118-24312140 GAATTGAAATAGTGGGAAGTAGG - Intronic
951990272 3:28668829-28668851 AAGTTGTAACTGTGGGAAGGAGG - Intergenic
953198697 3:40757087-40757109 CAGTTGTAAAATGGGGAACTGGG + Intergenic
953293691 3:41691376-41691398 CAGTTGGAAGAGGGCCAAGTGGG - Intronic
953606987 3:44418756-44418778 CAGTGGCAGGAGTGGGAATTGGG - Intergenic
953745745 3:45572694-45572716 CAGTTGTAAGAGGGTCAAGCAGG - Intronic
954751161 3:52814419-52814441 CAGTAGTCAGGGTGGGGAGTGGG + Intronic
955739000 3:62069388-62069410 AAGCTGTAAGAGTGTGAACTGGG + Intronic
955796755 3:62645194-62645216 CAGGGGAAAGAGTGGGAAGGGGG + Intronic
956422957 3:69103686-69103708 CAGTTGTAACAGTCTGAATTTGG + Intronic
957164895 3:76659805-76659827 CAGTTGTATGAGTGAGAGCTGGG + Intronic
957222589 3:77402850-77402872 CACTTGTAAGAGGGCCAAGTGGG - Intronic
958114777 3:89201586-89201608 CAGTGGTCAGAATGGGTAGTGGG - Intronic
959090374 3:101896148-101896170 CAGAAGTAAGAGTGGGAAGGGGG - Intergenic
964642106 3:158919470-158919492 CAGTTGGAAGAGTGAGGAATTGG + Intergenic
965578754 3:170245134-170245156 CAGTTGTAGGGGTGGGTGGTTGG + Intronic
967724063 3:192844983-192845005 CAGTTGTAAAAGTTCCAAGTGGG - Intronic
967827146 3:193886116-193886138 CAGTTGGAAGAGGGCCAAGTGGG - Intergenic
968157821 3:196397473-196397495 CAGTTGTAAAAGGGAGTAGTGGG + Intronic
969119504 4:4897551-4897573 GAGTTGGAAGAGTTGGAAGCAGG + Intergenic
973288154 4:48442684-48442706 CAGAAGTGAGAGTGAGAAGTGGG + Intergenic
974483721 4:62478828-62478850 CATTTAAAAGAGTGGGAAATGGG - Intergenic
975615419 4:76241694-76241716 CAGTTGTTTAGGTGGGAAGTCGG + Intronic
976352888 4:84080711-84080733 CAGTGGTGTGAGTGGGAGGTAGG - Intergenic
978376720 4:108081722-108081744 CAGTAGTAAGAGTTGGATGAGGG + Intronic
979515116 4:121598784-121598806 GACTTGGAAGGGTGGGAAGTAGG + Intergenic
979573989 4:122265043-122265065 CAAGTGTGAGAGTGGGACGTGGG + Intronic
981127227 4:141120707-141120729 AAGTAGTAAGTGAGGGAAGTGGG + Intronic
981527797 4:145723721-145723743 CAGTTCTAAGACTGGGTAGTGGG + Intronic
982803992 4:159740334-159740356 CAGGGGAAAGGGTGGGAAGTGGG - Intergenic
983219406 4:165030507-165030529 TTGATGGAAGAGTGGGAAGTAGG - Intergenic
983655295 4:170077109-170077131 CAGTTTTGAAATTGGGAAGTGGG + Intronic
983880491 4:172926777-172926799 CAGGTGTTAGGGTGGGAAATGGG - Intronic
984084488 4:175292094-175292116 CATTTGGAAGAGTGTCAAGTGGG + Intergenic
984280529 4:177664834-177664856 TAGTTTTAAAAGTGTGAAGTTGG + Intergenic
988753386 5:34216050-34216072 CAGTTATGAGAGTGAGAAGATGG - Intergenic
989294274 5:39805947-39805969 CAGCTGTAAGAGTGAGATTTGGG + Intergenic
989461685 5:41706916-41706938 CACTTGAAAGAGTGGCAAGTTGG - Intergenic
990535317 5:56715928-56715950 CTGTTGTAAGAGAGGAAAGGAGG + Intergenic
991030537 5:62077743-62077765 CACTTGGAAGAGTGCCAAGTGGG - Intergenic
991287415 5:64993190-64993212 TAGGTGTGAGAGAGGGAAGTGGG + Intronic
991741168 5:69676896-69676918 CAGTTATGAGAGTGAGAAGATGG - Intergenic
991756450 5:69877546-69877568 CAGTTATGAGAGTGAGAAGATGG + Intergenic
991792742 5:70256633-70256655 CAGTTATGAGAGTGAGAAGATGG - Intergenic
991820628 5:70552969-70552991 CAGTTATGAGAGTGAGAAGATGG - Intergenic
991835852 5:70753459-70753481 CAGTTATGAGAGTGAGAAGATGG + Intergenic
991885192 5:71256941-71256963 CAGTTATGAGAGTGAGAAGATGG - Intergenic
992973193 5:82083589-82083611 CAGTTGTATGAGGGGTCAGTTGG - Intronic
993262433 5:85675922-85675944 GAGTTGGAAGAGTATGAAGTGGG - Intergenic
993735982 5:91477273-91477295 CAGTAGGAAGAGGAGGAAGTGGG - Intergenic
995314818 5:110757354-110757376 CAGTTTTAAGTGTAGGAAGGAGG - Intronic
995348667 5:111149989-111150011 CAGCTGTCAGAGGAGGAAGTTGG - Intergenic
997015071 5:129923187-129923209 GAGATGTAGGAGTGGGATGTGGG + Intronic
999492794 5:152068051-152068073 CAGCTGTAAGACTGGGTAGTAGG - Intergenic
1000469742 5:161626685-161626707 GAGATGGTAGAGTGGGAAGTGGG - Intronic
1000604111 5:163310041-163310063 CATTTGTTAGATTGGGAAATTGG - Intergenic
1001820338 5:174705267-174705289 CAGTTGTTAAAGTGAAAAGTTGG - Intergenic
1002214497 5:177620359-177620381 CAGGGGGAAGGGTGGGAAGTGGG + Intergenic
1002692192 5:181058223-181058245 CAGTTGTCACAGTGGGAATGGGG + Intronic
1003442800 6:6159233-6159255 AAGTTGTATGAATGGGATGTGGG + Intronic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004817121 6:19323674-19323696 CAGTTGTAAATGAGGAAAGTAGG - Intergenic
1005551554 6:26922871-26922893 CAGTTATGAGAGTGAGAAGATGG - Intergenic
1005972860 6:30775131-30775153 CAGTTATGAGTCTGGGAAGTGGG - Intergenic
1007135978 6:39522287-39522309 CACTGGAAAGAGTGGGTAGTGGG - Intronic
1009618130 6:66037595-66037617 CAGTTGCAAAAGAGAGAAGTGGG + Intergenic
1010932330 6:81818071-81818093 CTGTTGTAAGAATGGGCAGTAGG - Intergenic
1011337345 6:86275860-86275882 CAGTTGTAATGGTGGTAAGGTGG + Intergenic
1011447742 6:87460626-87460648 CAGTGGAAAGAGTGGGAGGGGGG + Intronic
1013060804 6:106631944-106631966 TAGTAGTAGGGGTGGGAAGTGGG - Intronic
1013544229 6:111140004-111140026 GAGTGGGAAGAGTGGGAAGAGGG + Intronic
1015142434 6:129950258-129950280 AAGGTGAAGGAGTGGGAAGTGGG - Intergenic
1016241181 6:141933057-141933079 CAGCAGTAAGATTGTGAAGTAGG + Intergenic
1016879172 6:148894072-148894094 GAGTTTTAAGAGTGGTAGGTGGG + Intronic
1017907414 6:158766710-158766732 CAGTTGTAATAGTGCCAAGCAGG - Exonic
1018057226 6:160062602-160062624 CCGTTGTCAGAGTGGAAGGTAGG + Exonic
1019481484 7:1268914-1268936 CAGGTGTCAGGGAGGGAAGTGGG - Intergenic
1020713736 7:11642217-11642239 CATTACTAAGAGTGGGAGGTAGG + Intronic
1027209335 7:76132281-76132303 AAGCTGTAAGAGAGGGAAGAAGG + Intergenic
1028060841 7:86313100-86313122 CAGTTATAAGATTGGGTATTTGG - Intergenic
1029910511 7:104141347-104141369 CAGTGGTGAGAGTGGGAATGAGG - Intronic
1032999126 7:137483593-137483615 CTGTTGTAAGGGTGGGAAGAAGG - Intronic
1033648801 7:143324364-143324386 CAGGTGGAAGAGAGGGAGGTGGG - Intronic
1033733734 7:144202247-144202269 TAGTGGTAAGAGTGGTAAGATGG + Intergenic
1033749316 7:144348726-144348748 TAGTGGTAAGAGTGGTAAGATGG - Intergenic
1034213385 7:149384108-149384130 CCCTGGGAAGAGTGGGAAGTTGG - Intergenic
1035536074 8:392459-392481 CAGCTGAAAGAGTGAGAAGCAGG - Intergenic
1037983051 8:23268857-23268879 CAATTTTCAGAGTGGGAAGCGGG + Intergenic
1039021923 8:33217463-33217485 AAGTGGATAGAGTGGGAAGTTGG - Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039766924 8:40638663-40638685 CAGATGTAAAATTGAGAAGTGGG - Intronic
1040786661 8:51174657-51174679 CATCTGTAAGAGTTGGATGTAGG + Intergenic
1041374893 8:57203441-57203463 CAGTTGGAAGAGGGCGAAGCGGG + Intergenic
1041376057 8:57210167-57210189 CAGTTGGAAGAGGGCGAAGCGGG + Intergenic
1041378008 8:57221910-57221932 CAGTTGGAAGAGGGTGTAGTGGG + Intergenic
1041919528 8:63166862-63166884 TAGTTATTAGAGTGGGAACTTGG + Intergenic
1045181667 8:99790896-99790918 GAGCTGCAAGAGGGGGAAGTAGG + Intronic
1045734133 8:105275395-105275417 CTGATGTAGGAGTGGAAAGTGGG - Intronic
1047312057 8:123700275-123700297 GGCTTGTAAGAGTGGGAAGCTGG - Intronic
1047610035 8:126511909-126511931 CAGATTTCAGAGTGGGAAATAGG - Intergenic
1047979393 8:130164606-130164628 CTGTTTTTAGAGTTGGAAGTAGG - Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048557750 8:135497096-135497118 AAGGAGTAAGAGAGGGAAGTTGG + Intronic
1050997369 9:12237291-12237313 TCTTTGTAAGAGAGGGAAGTTGG - Intergenic
1051369994 9:16350673-16350695 CAGATTTAAGAGTGGAAAATTGG - Intergenic
1051663855 9:19450077-19450099 CAGTTGTTAAAGTGAGAAGGTGG + Intronic
1052965123 9:34334637-34334659 CATTTGTTTGAGTGGGAGGTGGG + Intronic
1054709012 9:68492311-68492333 CAGTTTTGAGAGTTGGAATTTGG + Intronic
1055071984 9:72175746-72175768 CTGTTGTAAAAGTAGAAAGTGGG - Intronic
1055262574 9:74455088-74455110 CAGTTATAAGAGTGAGTAGAGGG + Intergenic
1056202704 9:84291710-84291732 CAGTTGTAAGCCTGGGATTTGGG + Intronic
1056897012 9:90560322-90560344 CAGGGGAAAGGGTGGGAAGTGGG + Intergenic
1057097917 9:92329009-92329031 CAGTTGTCAGAGTGGCTAGTAGG - Intronic
1057506741 9:95640246-95640268 CTGTTGTTGGAGTGGGAACTGGG + Intergenic
1059644402 9:116250320-116250342 TTGTTGTCAGAGTGGGAACTAGG + Intronic
1060102777 9:120855518-120855540 CAGTGGTAGGAGTGGCAAGGTGG + Intergenic
1186740254 X:12509579-12509601 CAGAGGAAAGAGTGGGAAGCAGG + Intronic
1187886107 X:23890295-23890317 TAGTTGTTAGAGAGGGAATTAGG - Intronic
1187978489 X:24729613-24729635 CAGTTGTCCTAGTAGGAAGTTGG + Intronic
1193275566 X:79583440-79583462 GACTTGAAAGGGTGGGAAGTTGG + Intergenic
1193365371 X:80625311-80625333 TAGTAGTATGAGTAGGAAGTTGG + Intergenic
1195802286 X:108726387-108726409 CAGTTGGAAGAGTCGGAGGCAGG + Intronic
1195831246 X:109061173-109061195 GAATTGCAAGAGTAGGAAGTGGG + Intergenic
1196131286 X:112159756-112159778 CATTTGGAAGAGTGGGGAGACGG - Intergenic
1198380321 X:136077628-136077650 CAGTTCTTAGAGAGGGAAGTGGG - Intergenic
1198406204 X:136315156-136315178 CAGTGGAAAGTGTGGGCAGTGGG + Intronic
1201671996 Y:16533360-16533382 GAGTTGAAAGGGTGGGAAGGTGG - Intergenic
1202113515 Y:21448877-21448899 CAGTGGTGAGAGTGGAATGTAGG + Intergenic