ID: 1109237582

View in Genome Browser
Species Human (GRCh38)
Location 13:59843566-59843588
Sequence CTCTTTATGAAATGTCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 307}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109237582_1109237583 8 Left 1109237582 13:59843566-59843588 CCTCACAGACATTTCATAAAGAG 0: 1
1: 0
2: 2
3: 20
4: 307
Right 1109237583 13:59843597-59843619 CTATCTTCAAAAAAATAAAATGG 0: 1
1: 1
2: 42
3: 514
4: 3550
1109237582_1109237584 17 Left 1109237582 13:59843566-59843588 CCTCACAGACATTTCATAAAGAG 0: 1
1: 0
2: 2
3: 20
4: 307
Right 1109237584 13:59843606-59843628 AAAAAATAAAATGGTTCTTGAGG 0: 1
1: 0
2: 7
3: 134
4: 1411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109237582 Original CRISPR CTCTTTATGAAATGTCTGTG AGG (reversed) Intronic
901165507 1:7218769-7218791 CTCTTTATAAAAGTTCTGGGTGG + Intronic
901884035 1:12210231-12210253 CTCTTTATGGAATAAGTGTGGGG - Intergenic
902751954 1:18522108-18522130 TTCTTTATGGAATCTCTATGAGG + Intergenic
903726260 1:25448119-25448141 CTCTTTAGGAATGGTTTGTGAGG + Intronic
904868040 1:33597740-33597762 CTCTTGAGTACATGTCTGTGTGG - Intronic
905007376 1:34720825-34720847 CACTTTCTGAAATGTGTCTGGGG - Intronic
905532627 1:38694066-38694088 CTTTTAATGGAGTGTCTGTGTGG - Intergenic
905719700 1:40186672-40186694 CTCATTCTGAAAGCTCTGTGAGG + Intronic
906817847 1:48897771-48897793 TCCTTTAAGAAATGTCTGTTCGG + Intronic
912065988 1:105743518-105743540 ATATTTATGAAATATTTGTGAGG - Intergenic
916590802 1:166188272-166188294 CTATTCAAGAAATGTCTGTTGGG - Intergenic
917756099 1:178100157-178100179 CTCTTTAAGAATAGTTTGTGTGG + Intronic
918191372 1:182178126-182178148 CTTTTTCTGGTATGTCTGTGAGG - Intergenic
918936088 1:190924345-190924367 CCCTTTATCAAATGACTGTTTGG - Intergenic
919273452 1:195381865-195381887 CTCTTTGTGAAATATCAGTTGGG - Intergenic
920564459 1:206962330-206962352 CTCTCTGTGGAAAGTCTGTGAGG + Exonic
923986676 1:239389149-239389171 ATCTTTATAAATTTTCTGTGTGG + Intronic
924902950 1:248420778-248420800 CTCTTTTTGAAATTTCTCTGAGG - Intergenic
1062794129 10:330117-330139 CTCTTTATTAAATTGCTGTTTGG - Intronic
1064674255 10:17745683-17745705 CTCCTTCTGAAATGTCAGCGTGG + Intergenic
1066621478 10:37356903-37356925 CTCTTAATGAAACGTCCATGTGG + Intronic
1066792981 10:39086647-39086669 CTTTTTTTGGAATATCTGTGAGG + Intergenic
1066928079 10:41722751-41722773 CTCTTTTTGAACAATCTGTGAGG + Intergenic
1067689060 10:48489654-48489676 CTCTTTTTTAATTGTCTGTGTGG + Intronic
1069062808 10:63912101-63912123 CCTTTTAACAAATGTCTGTGAGG - Intergenic
1069327505 10:67249637-67249659 GTCTTTCTTAAATGTATGTGTGG - Intronic
1069626827 10:69873304-69873326 TTCTTAATGAAATGCATGTGGGG + Intronic
1070703614 10:78621272-78621294 CTCTTCATGAAATTATTGTGAGG - Intergenic
1071017419 10:81014254-81014276 ATCCTTATCAAATGTTTGTGAGG + Intergenic
1071341867 10:84656799-84656821 CTCCTTTTGAAATGACTGTGTGG - Intergenic
1071558036 10:86621212-86621234 CTTTTGATGGAATGTCTTTGTGG + Intergenic
1071716453 10:88101163-88101185 TTCCTTATGAAAAGTCTGGGTGG + Intergenic
1071974262 10:90939475-90939497 GTCATTATAAAATGTCTGGGAGG + Intergenic
1073340524 10:102740972-102740994 CTCTTTTGGAAATGTCTGGAAGG + Exonic
1074227151 10:111495611-111495633 TTCTTTCTGAAATGGCTTTGGGG - Intergenic
1074879535 10:117644615-117644637 TTCTTTAAGAAATGTTTGTCTGG + Intergenic
1075269758 10:121038473-121038495 ATCTGTTTGAAATTTCTGTGTGG - Intergenic
1075482790 10:122796859-122796881 CTCTTCATTTACTGTCTGTGAGG + Intergenic
1075630450 10:123997678-123997700 ATGTTTAAGAAATGTCTATGTGG + Intergenic
1076294563 10:129374522-129374544 CTCTTTATGACCTGCATGTGTGG - Intergenic
1076543337 10:131228089-131228111 CCCTTGAGGAAATGTCTGTCAGG - Intronic
1078334764 11:10454914-10454936 CTGTTTATGAAACAGCTGTGAGG + Intronic
1078615935 11:12866333-12866355 CTATTTCTGCACTGTCTGTGTGG + Intronic
1079928530 11:26527423-26527445 CTCTTTATTCTATGTCTTTGTGG + Intronic
1080189365 11:29526082-29526104 CTCTTCATGTTACGTCTGTGGGG + Intergenic
1080700697 11:34641598-34641620 CTCTTTATAAAATGTTGGGGTGG - Intronic
1084969569 11:72763521-72763543 CTATTTATGTTATGTCTCTGTGG - Intronic
1085883893 11:80499898-80499920 CTCTTTATCAAATGATTGTTTGG - Intergenic
1085996063 11:81915512-81915534 TTTTTAATGAAATGTGTGTGGGG + Intergenic
1087490297 11:98817574-98817596 TTCTTTATGAAATGACATTGTGG - Intergenic
1088606565 11:111539339-111539361 CTCTTCATTTAATGTCTGTGTGG - Intergenic
1088999583 11:115040524-115040546 ATCTTGATGAAATATCTCTGGGG - Intergenic
1089183087 11:116596271-116596293 ATCTTCATGACATCTCTGTGAGG - Intergenic
1090703829 11:129318673-129318695 CTATTCATTAAATGTGTGTGAGG + Intergenic
1091215302 11:133897595-133897617 CTCTGTATAACCTGTCTGTGAGG - Intergenic
1093468481 12:19475654-19475676 TTCTTTAAGAAATCTCTGTACGG + Intronic
1094306218 12:29022611-29022633 CTGTTTTTGAAAAGTCTCTGTGG + Intergenic
1094357017 12:29588742-29588764 GTCTTTCTCAAATGTCAGTGAGG - Intronic
1095080364 12:37992631-37992653 CTCTTTTTGAAGAATCTGTGAGG + Intergenic
1095333259 12:40994694-40994716 ATCCTGATGAAATTTCTGTGAGG + Intronic
1095344059 12:41128354-41128376 GTCTTTATGAAATCTCAATGTGG - Intergenic
1097443593 12:59641820-59641842 CTTTTTATAGAATGTCTTTGTGG + Intronic
1097808751 12:63994540-63994562 CTCCATGTGAAATGGCTGTGGGG - Intronic
1097982673 12:65750515-65750537 ATCTTTATGGATTATCTGTGTGG + Intergenic
1098640275 12:72830716-72830738 CTCTTTGTGAAATGTTGCTGAGG - Intergenic
1100075915 12:90783663-90783685 TTTTTTATTAAATGTCTGTAGGG - Intergenic
1100542982 12:95575527-95575549 ATCTTCATAAAATGTCTGAGAGG + Intergenic
1100643148 12:96502065-96502087 TTGTTTGAGAAATGTCTGTGTGG + Intronic
1100825033 12:98467091-98467113 CTCTTTAAGATATGTTTGTGTGG - Intergenic
1101839452 12:108317333-108317355 CTCTTGGTGAAATGTTTGTAGGG - Intronic
1105326423 13:19374342-19374364 CTGTTTATTATATGTCTGGGGGG + Intergenic
1105724218 13:23145425-23145447 GTTTTCATGCAATGTCTGTGTGG - Intergenic
1106789287 13:33138482-33138504 TTCTTTATGGAATGTCTGGTTGG - Intronic
1108872894 13:55008201-55008223 CTCTTGATGCACTGTCTATGGGG + Intergenic
1109059314 13:57593718-57593740 CTCTTTTTGAAGGGGCTGTGTGG - Intergenic
1109237582 13:59843566-59843588 CTCTTTATGAAATGTCTGTGAGG - Intronic
1109448472 13:62476790-62476812 ATCTTTATTAATTGTCTGTCTGG - Intergenic
1109787801 13:67204036-67204058 TGCTTTATGAAATATCTCTGAGG - Intronic
1111300332 13:86341537-86341559 CTTTTTGTGAAATGTATCTGAGG + Intergenic
1111683808 13:91476971-91476993 CTCTGTTTAAAATTTCTGTGTGG - Intronic
1113450135 13:110403148-110403170 CTCTTTATCAAATGTTTGCTTGG + Intronic
1115593481 14:34886581-34886603 ATCTTTATAAAATGTCAGTTTGG - Intergenic
1118981186 14:70718366-70718388 CTCTTTATGAACTGACTTTCTGG - Intergenic
1119139400 14:72252217-72252239 TTCTTTGTCAAATGTATGTGTGG + Intronic
1120550577 14:85867095-85867117 CTGATTATGAAATGTCTGAAAGG + Intergenic
1120825014 14:88946957-88946979 CACTTTTTAAAATGTCTGAGTGG - Intergenic
1123785694 15:23669968-23669990 TTCTATATTAAATGTGTGTGAGG + Intergenic
1124686468 15:31786882-31786904 CTCATTATGAAATGTGTGTGAGG + Intronic
1126901991 15:53323869-53323891 CTGTTTCTGAAATGTCTGTTGGG + Intergenic
1127420037 15:58795997-58796019 CTCTTTATGACTTGGCAGTGTGG + Intronic
1130219019 15:82001634-82001656 GTCCTTATAAAATGTCTTTGGGG - Intergenic
1132182435 15:99768494-99768516 TCCTTTATGACATGGCTGTGAGG + Intergenic
1136295636 16:29300439-29300461 CTCTGTGTGAAAAGGCTGTGGGG + Intergenic
1136713722 16:32260523-32260545 CACTTTATGAAATGTCCTTTTGG + Intergenic
1136754190 16:32668907-32668929 CACTTTATGAAATGTCCTTTTGG - Intergenic
1136813923 16:33201458-33201480 CACTTTATGAAATGTCCTTTTGG + Intronic
1136820399 16:33311538-33311560 CACTTTATGAAATGTCCTTTTGG + Intergenic
1136826962 16:33368077-33368099 CACTTTATGAAATGTCCTTTTGG + Intergenic
1136832028 16:33466848-33466870 CACTTTATGAAATGTCCTTTTGG + Intergenic
1136997401 16:35200102-35200124 CACTTTATGAAATGTCCTTTTGG - Intergenic
1137010145 16:35313351-35313373 CACTTTATGAAATGTCCTTTTGG - Intergenic
1137353223 16:47732900-47732922 CTCTTTAGCACAAGTCTGTGTGG - Intergenic
1137634541 16:49974402-49974424 CTGTTTTTGAAAGGTATGTGTGG - Intergenic
1139042250 16:63011910-63011932 GCCTTTATGATATGCCTGTGAGG + Intergenic
1140801617 16:78493533-78493555 TTCTTTATAAAATATCTTTGGGG + Intronic
1202992499 16_KI270728v1_random:24432-24454 CACTTTATGAAATGTCCTTTTGG + Intergenic
1203056336 16_KI270728v1_random:929239-929261 CACTTTATGAAATGTCCTTTTGG - Intergenic
1144228846 17:13179018-13179040 TTCTTTTTGAAATGTCTTTCTGG + Intergenic
1144842403 17:18195626-18195648 GTCTTGATCCAATGTCTGTGAGG - Intronic
1147861297 17:43525375-43525397 CTCTTTCTGAATTGTCTTTAGGG - Exonic
1151241350 17:72760736-72760758 CTGGTTCTGAGATGTCTGTGGGG - Intronic
1153230521 18:2931056-2931078 CTCTTTATGGAGTGGCTTTGAGG - Intronic
1155880939 18:31147685-31147707 CTCTTTATTAAATGACTGTTGGG - Intronic
1156809327 18:41227334-41227356 CTCTTTGTAAAATATTTGTGAGG - Intergenic
1157306009 18:46518233-46518255 TTCTCTATGAAATGACGGTGTGG - Exonic
1160038936 18:75326950-75326972 ATCATTTTGAAATGCCTGTGAGG - Intergenic
1161298419 19:3531441-3531463 CTCTGTGTGAAATGTCCATGTGG + Intronic
1162883898 19:13681936-13681958 CTCTTGGTGCAATGCCTGTGGGG - Intergenic
1163540998 19:17910125-17910147 ATCTTGATGAAATTGCTGTGTGG + Intergenic
1164294676 19:23899388-23899410 GTCATTTTGAAATGTCTCTGTGG + Intergenic
1164359943 19:27494790-27494812 CTGTTTTTGAAAGATCTGTGTGG + Intergenic
1164397469 19:27878539-27878561 CTCTGTAGGAAATGTCTGATGGG + Intergenic
1167254025 19:48416348-48416370 CTCTTGATGAAATGTCTTCTGGG - Intronic
1168419427 19:56191522-56191544 GACTTCATGAAATGTCTTTGCGG + Intronic
1168423722 19:56222342-56222364 CGCTTTATTAACTGTGTGTGTGG - Intronic
1168503432 19:56912867-56912889 TTCTTTAACAAATGTTTGTGGGG + Intergenic
1168579282 19:57540380-57540402 CTTTTTAAGAACTGTCTGTATGG + Exonic
1168589695 19:57622606-57622628 CTCTTTACCTAATGTCTTTGCGG + Exonic
928565747 2:32546780-32546802 CTCTTTATGAAATTTTTGACTGG + Intronic
928910039 2:36410761-36410783 ATATTTATAAAAGGTCTGTGAGG - Intronic
929295930 2:40246636-40246658 TTCCTTATGAAAGGTCTGTTTGG - Intronic
931200673 2:60094593-60094615 CTATTTATGAAATGGCTGTGAGG - Intergenic
934868971 2:97842378-97842400 CTATTTATTAAGTGTCTATGAGG + Intronic
934938058 2:98479514-98479536 CTATTTATGAACTGACAGTGTGG + Intronic
936044432 2:109175304-109175326 ATCTTGATGAGATGTCTGAGGGG + Intronic
936171849 2:110183746-110183768 ATCTTTATCAATTTTCTGTGTGG - Intronic
936402561 2:112176511-112176533 TTCTGTATGAAATATCTGTGGGG + Intronic
936494079 2:113002683-113002705 CTCTTGAGGAGATGACTGTGGGG + Intergenic
936786936 2:116104814-116104836 CTCTTTCTGAAACTTCTGTATGG + Intergenic
937610436 2:123855181-123855203 CTTTTTATGTAATGTCTTTAGGG - Intergenic
937689555 2:124739637-124739659 GTCTTTAGGAAATGACTGTTTGG - Intronic
941266350 2:163367303-163367325 ATCTTTATGAAATGTAATTGAGG - Intergenic
942086257 2:172446832-172446854 CTCTTTAAGAGATGTCTTAGTGG + Intronic
945170387 2:206989302-206989324 CTCTTCAGGAAATGGCTGTACGG + Intergenic
948652526 2:239457377-239457399 CCCATTATGAAATGCCTGCGTGG + Intergenic
948871163 2:240798968-240798990 CTCTTCATGGAATGTCAGTGTGG - Intronic
1169358375 20:4926778-4926800 TTCTTTGTAAAATGTTTGTGTGG + Intronic
1170107867 20:12771597-12771619 CTCTTTACAAAATTTATGTGGGG - Intergenic
1170233588 20:14077542-14077564 CTCTGTATGCAAAGTATGTGAGG + Intronic
1172206694 20:33167548-33167570 GTCTTTATGAAAACTCTGTAAGG - Intronic
1173939522 20:46898081-46898103 CCCTTTATCAAAAGTCTCTGGGG - Intronic
1174995857 20:55567424-55567446 TTCCTTTTGAAATCTCTGTGTGG - Intergenic
1177173702 21:17681296-17681318 GTCTTTTAGAAATGTCTGTGAGG - Intergenic
1177242364 21:18475623-18475645 CTCTTTTTGAAATGACTGGGAGG - Intronic
1177968155 21:27755483-27755505 ATGTTTTTGAAATGTCTGTTAGG + Intergenic
1178196205 21:30347782-30347804 TTCTTTATAAGATGTCTGTCGGG - Intergenic
1178264857 21:31133469-31133491 CTGTTTATGAGAAGTCGGTGTGG - Intronic
1179148053 21:38786205-38786227 TTTTTTCTGAAATTTCTGTGTGG + Intergenic
1179976210 21:44868660-44868682 CTCTTTATTTCATGTCAGTGTGG - Intronic
1181938671 22:26457858-26457880 CGCTTTATGAAATGACTGTCAGG - Exonic
1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG + Intronic
1185005155 22:48271537-48271559 CTCTTTATTGAATGAATGTGAGG + Intergenic
949104192 3:183621-183643 GCCTTCATGAAATGTCTGTTTGG + Intergenic
949202651 3:1397550-1397572 CCATTTAAGTAATGTCTGTGTGG - Intronic
949322167 3:2823778-2823800 CTCTTGATGAACAGTTTGTGAGG - Intronic
950832345 3:15887316-15887338 CTCCTTATCAAATGTTTGTTTGG - Intergenic
952309184 3:32171894-32171916 CGCTTTATGAAGAATCTGTGTGG + Intergenic
953455401 3:43036718-43036740 CACGTTATGAACTGCCTGTGGGG + Intronic
954963512 3:54588422-54588444 CACTTTGTCAAATGTCAGTGTGG - Intronic
955152645 3:56383277-56383299 CTCTTTGTGAAATTCCAGTGGGG - Intronic
955884205 3:63580062-63580084 CTCAATATGAAATGGCTGCGAGG - Intronic
957239638 3:77641939-77641961 CTCTATCTCAAATTTCTGTGAGG + Intronic
957341864 3:78910019-78910041 GTCTTTATGAAATGTGTCTACGG - Intronic
957515044 3:81239435-81239457 CTCTCTAAAAAATGTCTGTAAGG + Intergenic
957607814 3:82426382-82426404 CTCTTTAAGAAATTTTTGTCTGG + Intergenic
958115764 3:89215942-89215964 TTCCTTATCAAATGGCTGTGGGG + Intronic
959357375 3:105349616-105349638 CTCTTTATGATATCTTGGTGAGG + Intergenic
959712032 3:109395111-109395133 TTCTTGAGGAAATGACTGTGGGG + Intergenic
960334636 3:116401191-116401213 CTCTTTAATAAATCTCTCTGGGG - Intronic
962191487 3:133315525-133315547 CTCTTTATGGAATCTGTGTTTGG - Intronic
962623284 3:137199642-137199664 CTCCTAATGAAATGGCTGAGGGG + Intergenic
964130944 3:153285800-153285822 CTACTTATGAAATGGTTGTGTGG + Intergenic
964519219 3:157544854-157544876 CGCATTAAGAAATGTGTGTGAGG - Intronic
964519692 3:157551428-157551450 CTCTTTGTTAAATTTCTCTGAGG + Intronic
965038597 3:163474964-163474986 GTCTTTATGACATTTCAGTGTGG + Intergenic
965517247 3:169634663-169634685 CTCTTTTTCAAATGTCTGCTTGG + Intronic
965564896 3:170104676-170104698 ATCTTTATAAAATGTAGGTGAGG - Intronic
965602111 3:170465637-170465659 CTATTAATAAAATCTCTGTGAGG - Exonic
967041793 3:185700289-185700311 CTTTTTATGAAATGTCACAGGGG + Intronic
967403927 3:189095401-189095423 ATATTTATGGAATGTCTCTGCGG + Intronic
969857105 4:10008875-10008897 TTCATTATCAAATTTCTGTGCGG + Intronic
970356394 4:15257600-15257622 ATCTTCATAAAATCTCTGTGAGG - Intergenic
970400586 4:15713494-15713516 ATCTTTATGACAATTCTGTGAGG + Intronic
971828358 4:31657891-31657913 GCTTTAATGAAATGTCTGTGAGG + Intergenic
972078223 4:35114503-35114525 CTCTTTCTGAAATTTATTTGGGG + Intergenic
977717108 4:100195213-100195235 CCCTTTGTGAACTGCCTGTGAGG - Intergenic
978215310 4:106193904-106193926 CTTTTTATGAAATGTTTATTTGG + Intronic
978869461 4:113557536-113557558 GTCTTTCTGCAGTGTCTGTGAGG + Intronic
979441993 4:120761173-120761195 CACTATTTGAAATGTGTGTGGGG + Intronic
981317617 4:143356020-143356042 CTATGTATGGAATGTCTGTGTGG + Intronic
981436523 4:144729881-144729903 CTCATTCTGAAATTTTTGTGAGG - Intronic
982002664 4:151035488-151035510 CTATTTACGAAATCTCTTTGTGG + Intergenic
982129847 4:152218674-152218696 CACTTTATAAAATTACTGTGAGG + Intergenic
982174122 4:152689498-152689520 ATCTTTATGAAATATCGGTGTGG + Intronic
982330879 4:154180951-154180973 CTCATTTTGAAATGCCTTTGTGG + Intergenic
982402737 4:154986047-154986069 CTATTTAGGGCATGTCTGTGAGG + Intergenic
983433235 4:167677672-167677694 CCCTTTATTAAATATCAGTGTGG - Intergenic
984901592 4:184591235-184591257 CTCATTTTGAACTGCCTGTGTGG + Intergenic
985312786 4:188620002-188620024 CTCTGCAGGAAATGTCTGCGGGG + Intergenic
986230506 5:5860433-5860455 TTCTGCTTGAAATGTCTGTGTGG - Intergenic
987504658 5:18752059-18752081 TTCTTTTTGAAATGTCTTTGTGG - Intergenic
989598496 5:43180384-43180406 CTCTCTATGAGATTTCTTTGTGG + Intronic
989678680 5:44004563-44004585 CTGTTTCTCAAATGTGTGTGAGG - Intergenic
990818686 5:59813283-59813305 CTCTTTATTACACGTCTTTGAGG + Intronic
991140803 5:63240146-63240168 CTCCATATGAAATCTGTGTGTGG + Intergenic
992415436 5:76548292-76548314 CACTTTCGGAAGTGTCTGTGGGG - Intronic
992582112 5:78190241-78190263 CTTTTTATGAAATTTCAGTTTGG + Intronic
993287625 5:86020114-86020136 TTTTTTCTGAAATGTATGTGCGG + Intergenic
993585122 5:89715202-89715224 CTCAATACAAAATGTCTGTGTGG - Intergenic
994491568 5:100452030-100452052 TTCTTTGAGAAATGTCTGTTCGG - Intergenic
994528785 5:100939611-100939633 CTCTTTATGTAAGGCCTTTGGGG + Intergenic
996085493 5:119300841-119300863 TTCTTTATGGAATCTATGTGAGG + Intronic
998278124 5:140778016-140778038 CACTTTATGAAAAGTTTATGAGG - Intergenic
998287824 5:140881020-140881042 CTCTATAGGAAATGACTGTTGGG - Intronic
998298991 5:141000204-141000226 TTCATTATCAAATGCCTGTGTGG + Intronic
998943159 5:147307318-147307340 CTCTTTAAGAAATTTTTGTCTGG + Intronic
999417527 5:151412121-151412143 CTCTTTCCAAACTGTCTGTGTGG + Intergenic
1000473650 5:161677846-161677868 CTCTTTAAGAAGTGTCTTTTTGG + Intronic
1000882594 5:166714996-166715018 ATATTTCTGAAATGTCTTTGGGG + Intergenic
1001118339 5:168958007-168958029 GTCTTTCTGAAATGTTTTTGAGG + Intronic
1003867793 6:10379593-10379615 CTCTTTATGAAATGGAGTTGAGG - Intergenic
1004191442 6:13467441-13467463 CTCTTTATGGGCTGTGTGTGTGG - Intronic
1005615274 6:27566676-27566698 CTCTTTATGATATTTCGGTGGGG - Intergenic
1006123934 6:31825381-31825403 TTCTCTATGAAATGTCTGGCTGG - Intergenic
1006707360 6:36032371-36032393 AACTTTATGCATTGTCTGTGAGG + Intronic
1007628222 6:43258544-43258566 TTCTTTAAGCAATGTCTGTATGG - Intronic
1009472090 6:64039693-64039715 TTATTTATGAAATGAATGTGTGG + Intronic
1009697059 6:67120012-67120034 CTTTTTAGGAAATGTTTATGAGG - Intergenic
1009963025 6:70546995-70547017 CTCATTATGGAATGTCAGAGTGG - Intronic
1010626522 6:78142557-78142579 CTCTTTGTTAATTTTCTGTGTGG - Intergenic
1010931415 6:81808245-81808267 CTGTTTATAACATTTCTGTGTGG + Intergenic
1011013867 6:82733205-82733227 ATCTTTATAAAATGTATCTGTGG + Intergenic
1011051375 6:83154343-83154365 CTCTTTGTCAAGTGTCAGTGGGG + Intronic
1011405525 6:87011716-87011738 CGCTTTCTGAAATATCTGTGAGG - Intronic
1012020684 6:93915268-93915290 CTCTTTATTAGATTTCTATGGGG + Intergenic
1012287016 6:97402735-97402757 GGCTTTAAGAAATGTCAGTGTGG - Intergenic
1012403907 6:98871432-98871454 GTCTCTATGAATTATCTGTGTGG + Exonic
1012565698 6:100647407-100647429 CTCTTTTTGAAATTGCTCTGAGG - Exonic
1013084736 6:106846725-106846747 TTCTTTATGAATTGTCTTTCTGG + Intergenic
1015581409 6:134729417-134729439 TTCTTAAAGAAATTTCTGTGTGG + Intergenic
1016020410 6:139231147-139231169 GGTTTTATGAAATGTGTGTGTGG - Intergenic
1016698610 6:147028557-147028579 CTCTTTTTTGATTGTCTGTGTGG + Intergenic
1017583133 6:155889162-155889184 CTACTCATGAAATGGCTGTGTGG + Intergenic
1017674527 6:156799237-156799259 CTCTATATGCATTTTCTGTGAGG + Intronic
1019962325 7:4471157-4471179 TTCTTTAAGAAATCTCGGTGGGG - Intergenic
1021008626 7:15433899-15433921 CATTTTATGTAATGTGTGTGTGG + Intronic
1021962082 7:25883319-25883341 CTATTTTTGAAATTTCTATGTGG + Intergenic
1024667916 7:51564495-51564517 TGATTTATGAAAGGTCTGTGAGG + Intergenic
1025525229 7:61799163-61799185 CTCTTTATGTAGAATCTGTGAGG - Intergenic
1026249545 7:68657464-68657486 CTCTTTGTGTAATGTTTTTGAGG - Intergenic
1027970778 7:85078411-85078433 AACTTTGTGTAATGTCTGTGTGG + Intronic
1029058881 7:97776570-97776592 CTCTTTAGGAAATATCTTTCTGG + Intergenic
1029952404 7:104601150-104601172 CCCTTTATGAAACATCTCTGTGG - Intronic
1031845333 7:126798997-126799019 CTCCTTATATAATGTCTCTGAGG - Intronic
1031899020 7:127389985-127390007 TTCTTTATAAAATGTTTGAGTGG - Intronic
1032646722 7:133833384-133833406 CTCTATAAGAAATATCTGGGAGG - Intronic
1034587690 7:152110080-152110102 AACATTATGAAATGTCTGTTGGG + Intronic
1034904086 7:154928832-154928854 CTGTGGATGAAATGTCTCTGAGG + Intronic
1035404937 7:158590484-158590506 CTCTTCATGACAGGTCCGTGAGG + Intergenic
1038697702 8:29820701-29820723 CTGTGTATGAAGTGTGTGTGTGG - Intergenic
1039505406 8:38048672-38048694 TTCTTTCTGAAATGTCTCTATGG + Intronic
1040114376 8:43598731-43598753 CTCTTTTTGTAAAATCTGTGAGG + Intergenic
1040125352 8:43731353-43731375 CTATTTGTGAAATTGCTGTGTGG + Intergenic
1040128615 8:43767739-43767761 CTCTTTTTGAAGAATCTGTGAGG + Intergenic
1040129471 8:43777910-43777932 CTCTTTCTGGAAAATCTGTGAGG + Intergenic
1040130284 8:43787758-43787780 CTCTTTTTGGAAAATCTGTGGGG + Intergenic
1040130963 8:43796074-43796096 CTCTTTATGGACAATCTGTGAGG + Intergenic
1040297158 8:46159036-46159058 CTTTTTATGTAATGTGTGAGTGG - Intergenic
1040912521 8:52534586-52534608 ATTCTTAGGAAATGTCTGTGGGG + Exonic
1041544356 8:59025259-59025281 TTCATTATAATATGTCTGTGTGG + Intronic
1043335276 8:79168561-79168583 CTTCTTATGAAATGTATGTGAGG - Intergenic
1044795864 8:95897015-95897037 CTCATTATGAAATAACTGGGAGG - Intergenic
1045413822 8:101946678-101946700 CACTTTATGAAAAGTTTATGGGG + Intronic
1045462779 8:102440735-102440757 CTCTCTATGTTATATCTGTGAGG - Intergenic
1045838552 8:106552391-106552413 CTCTATATGAATATTCTGTGTGG + Intronic
1045895453 8:107210572-107210594 TGCTTTATGAAATGTTTATGGGG + Intergenic
1046490567 8:114947261-114947283 GCCTTTAAGAAATATCTGTGTGG - Intergenic
1047874127 8:129116423-129116445 CTGTTTCTGATATGTCTGTGAGG + Intergenic
1048439340 8:134448453-134448475 CTCTTCAGGAAAAGCCTGTGAGG - Intergenic
1048856132 8:138688092-138688114 CACCTTAGGAAATGTCTCTGAGG - Intronic
1050464036 9:5901976-5901998 CTCTTTTTGCAATATCTGTCTGG + Intronic
1050466651 9:5932795-5932817 TTCTTTAGGAATTGTCTTTGTGG - Intronic
1050691012 9:8225831-8225853 CTCATTATGATATATATGTGGGG + Intergenic
1050929886 9:11309585-11309607 CTTTTTTTGACATGTCTGTCTGG + Intergenic
1050946362 9:11525189-11525211 TTCTTTATTGAATGTCTGTTTGG - Intergenic
1051227432 9:14916032-14916054 TGCTTTATGAAAAGTTTGTGGGG + Intergenic
1051384058 9:16487825-16487847 CTCTTCCTCGAATGTCTGTGTGG + Intronic
1053395290 9:37768179-37768201 CCCTTTATGAAGAGTGTGTGAGG + Exonic
1055253729 9:74340018-74340040 TTCTCTTTGAAATGTCTGCGCGG - Intergenic
1055981409 9:82006141-82006163 TTGTTTATGAAGGGTCTGTGAGG + Intergenic
1057329236 9:94097102-94097124 AACTTTATTAAATGTCTATGTGG - Intronic
1058972920 9:110099600-110099622 CTATTCATTAAATGTCAGTGAGG - Intronic
1059699308 9:116759887-116759909 GTATTTATGAAATGACTGAGAGG + Intronic
1060364778 9:122999987-123000009 TTGTTTTTAAAATGTCTGTGTGG + Intronic
1060516794 9:124270964-124270986 CTCTGTGTGAAATGTGTGTGTGG - Intronic
1061751466 9:132780419-132780441 TTCTGGAGGAAATGTCTGTGTGG + Intronic
1186575427 X:10760455-10760477 ATGTTTATGAGATGTTTGTGGGG - Intronic
1186655006 X:11602770-11602792 CTCTTTACTAAACCTCTGTGTGG + Intronic
1186983078 X:14979236-14979258 ATCTTTCTGAAATATCAGTGAGG - Intergenic
1187054388 X:15728408-15728430 TTCATCATGAAATCTCTGTGAGG + Intronic
1187204287 X:17167540-17167562 GTCTTTATGGTATGTATGTGTGG + Intergenic
1188305249 X:28554251-28554273 CTCTTACTGAAAAGACTGTGTGG + Intergenic
1188853894 X:35168015-35168037 CTTTTTTTGATATGTCTGTCTGG + Intergenic
1189024056 X:37372263-37372285 GTCTTTGAGAAATGTCTGTCAGG + Intronic
1189140312 X:38598274-38598296 CTCTCTGTGAAATCTCTATGTGG + Intronic
1189195014 X:39145600-39145622 CTGGGTATGAGATGTCTGTGGGG + Intergenic
1189660364 X:43290674-43290696 TGCTTTATGAAAAGTTTGTGGGG - Intergenic
1190467875 X:50745180-50745202 CTCTCTCTGAAATGTCTGGCTGG + Intronic
1191894608 X:65978913-65978935 CTCTTCCTGAAATGTCTAAGGGG + Intergenic
1193586974 X:83335239-83335261 ATATTTATGAAATATTTGTGTGG + Intergenic
1194090647 X:89579584-89579606 CTCCTCATGCTATGTCTGTGGGG - Intergenic
1194951246 X:100129147-100129169 CTCTTTAAAAAATGACTGAGCGG - Intergenic
1194998745 X:100621592-100621614 CACTTTACAAAATGTTTGTGAGG - Intergenic
1195049255 X:101081765-101081787 TTCTTTAGAACATGTCTGTGAGG + Intronic
1195240167 X:102943653-102943675 GTCTTTTTGAAATGTATGTTTGG + Intergenic
1195350895 X:103996187-103996209 GTTTTTATGAACTGGCTGTGTGG - Intergenic
1196687372 X:118523181-118523203 CTCATAATGAAATGGCTTTGAGG + Intronic
1200443299 Y:3235644-3235666 CTCCTCATGCTATGTCTGTGGGG - Intergenic
1202182326 Y:22150167-22150189 CTTTTGTTGACATGTCTGTGTGG - Intergenic
1202209034 Y:22436235-22436257 CTTTTGTTGACATGTCTGTGTGG + Intergenic