ID: 1109239068

View in Genome Browser
Species Human (GRCh38)
Location 13:59861015-59861037
Sequence TAGGGAGGGACACTGATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109239061_1109239068 17 Left 1109239061 13:59860975-59860997 CCAACAAGTTGGGCAGAGATAGA 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1109239068 13:59861015-59861037 TAGGGAGGGACACTGATTGCTGG 0: 1
1: 0
2: 2
3: 13
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109239068 Original CRISPR TAGGGAGGGACACTGATTGC TGG Intronic
902168577 1:14592626-14592648 TAGGAAGGGACACCGTTTGCAGG + Intergenic
902847575 1:19123963-19123985 CAGGGAGGGACACTGGCAGCAGG + Intronic
902926506 1:19699356-19699378 TAGGTGGGGACACTGAATTCAGG + Intronic
904492512 1:30869812-30869834 GAGGGAGGGACACTGTCTTCAGG + Intronic
912637029 1:111305698-111305720 TAGGAAGGGAGACAGATTCCTGG + Intronic
913165254 1:116179080-116179102 TAGGGAGGCACACTCATGGTAGG - Intergenic
917964744 1:180171360-180171382 CAGGGAGGGGGACTGGTTGCTGG + Intronic
918416993 1:184320250-184320272 AAGGAAGAGACACTGAATGCTGG - Intergenic
922344158 1:224682144-224682166 TAGAAAGGGACACTGAATCCCGG - Intronic
924661432 1:246021989-246022011 TTAAGAGGGACACTGATCGCTGG + Intronic
1063660759 10:8034110-8034132 TAGGGAGGGAGGCTGATCCCGGG + Intergenic
1065494438 10:26314369-26314391 CAGGGAGGAAGAGTGATTGCAGG - Intergenic
1067668132 10:48296004-48296026 CAGGGAGGGAGACTGGTGGCTGG - Intergenic
1067794025 10:49307861-49307883 CAGGGAGGGACCCTTATGGCAGG - Intronic
1070888582 10:79925715-79925737 GAGGGAGGGAGACTGTTTGGAGG - Intergenic
1072997409 10:100257620-100257642 GGGAGAGGGAAACTGATTGCAGG - Intronic
1075535123 10:123264572-123264594 TTGGGAGGGAGAGTGATTTCAGG - Intergenic
1078568755 11:12439615-12439637 GAGGTAGTGACACGGATTGCTGG - Intronic
1082229801 11:49749553-49749575 AAGGGAAGGAGACTGGTTGCAGG + Intergenic
1082773963 11:57231533-57231555 CAGGGAGGGAGACTGAGGGCAGG - Intergenic
1083339797 11:61951744-61951766 TAGAGAGGGACACCGATTGGGGG - Intronic
1084143643 11:67251042-67251064 TGGGGAGGGAGACTGATTTGCGG + Intronic
1084155248 11:67309640-67309662 GAGGGAAGGACACTGAGGGCTGG - Intronic
1084481276 11:69421752-69421774 TGGGGTGGGACACAGATGGCTGG - Intergenic
1084855477 11:71982453-71982475 AAAGGATGGACACTGAATGCAGG + Intronic
1086554804 11:88096431-88096453 GAGGGAGAGACAGTGATTGTTGG - Intergenic
1093056446 12:14560813-14560835 AAGGGAGGAACACCGATTGAAGG + Intronic
1094219108 12:27974445-27974467 TAGGGAGGTAAAATGCTTGCGGG - Intergenic
1095182146 12:39158610-39158632 TAGGAAGGCACAGTGATGGCTGG + Intergenic
1096017370 12:48289453-48289475 TAGGTAGGGAGACAGATTGTTGG + Intergenic
1098126848 12:67305556-67305578 AAGGCATTGACACTGATTGCTGG + Exonic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1102123310 12:110460290-110460312 CAGGGAGGGGAGCTGATTGCTGG + Intronic
1103568383 12:121828611-121828633 AGGGGAGGGACACTGATAACAGG + Intronic
1106137835 13:26987541-26987563 TAGGGAGAGACAATGAAGGCCGG - Intergenic
1108594989 13:51941957-51941979 CAGGAAGGGACACTGCTTGGAGG - Intronic
1109239068 13:59861015-59861037 TAGGGAGGGACACTGATTGCTGG + Intronic
1112284950 13:98096049-98096071 TAGGTAGGGACAGTGAGAGCAGG - Intergenic
1114221280 14:20699679-20699701 TAGTGAAGGTCACAGATTGCAGG + Exonic
1116249274 14:42459324-42459346 TAGGGAGTTACAGTGTTTGCTGG + Intergenic
1116426295 14:44795917-44795939 TAGGGAGGCAAAGGGATTGCTGG + Intergenic
1117951208 14:61083962-61083984 TAGGGAGGGACACCGGTAGCAGG - Intergenic
1120651706 14:87141434-87141456 TATGGAGTGACACTAATTTCAGG - Intergenic
1122775639 14:104115958-104115980 CAGGGAGGGACAGTGACTTCTGG - Intergenic
1127351875 15:58161140-58161162 GAGGTGGGGACACTGATTGGAGG + Intronic
1131707448 15:95013497-95013519 TAGGGAGGCAAGCTGATTGTTGG - Intergenic
1133115181 16:3574448-3574470 GAGGGAGGGACAGTGCTGGCAGG + Intronic
1135434821 16:22419904-22419926 GAGGGAGGGAAACTGAGTGTGGG - Intronic
1137705826 16:50535199-50535221 TAGGGAAGGAATCTGATTGGTGG - Intergenic
1142265252 16:89061480-89061502 CATGGAGGGACAGTGACTGCTGG - Intergenic
1146114235 17:30120039-30120061 TGGGGAGGTAGACTGACTGCAGG - Intronic
1146495543 17:33318878-33318900 TAGGGAAGGAAAGTGATTCCAGG + Intronic
1148067336 17:44881781-44881803 TAGTGAGGGAAAGTGATTGATGG - Intronic
1151744552 17:76004952-76004974 CAGGGAGGAACACTGAGTGGGGG - Intronic
1152642136 17:81453746-81453768 CAGGGAGGGAAACTGAGTCCAGG + Intronic
1153732575 18:8029357-8029379 TAGGGAGGGGCACTGATGGCAGG - Intronic
1155399177 18:25419419-25419441 TAGGAAGGGACACTGAAATCAGG + Intergenic
1161953272 19:7479148-7479170 TAGGGAAAAACACTGATTCCTGG + Intronic
1162949688 19:14063376-14063398 TAGAGATGGACACAGATTGGTGG - Intergenic
1163005808 19:14396072-14396094 TAGGCTGGGACACAGATGGCTGG + Intronic
1165000429 19:32757388-32757410 TAGGGACAGACAGTGATTACTGG - Intronic
1165348609 19:35264707-35264729 TAGGGAGGGAAACTGCTCACTGG - Intronic
926367128 2:12143797-12143819 TAGGGAGGGAAAATGCTTTCTGG + Intergenic
933161150 2:79026436-79026458 TGGGGAGGGACAATGATTGGAGG + Intronic
933174361 2:79159026-79159048 TGGGGAGGGACAATGATTGGAGG - Intronic
935575856 2:104709694-104709716 TTGGAAGGGACAGTGATTGATGG - Intergenic
938199349 2:129360462-129360484 GAGGGAAGCACTCTGATTGCAGG - Intergenic
941521112 2:166544329-166544351 TAGGGGTGGACACTGAATCCAGG - Intergenic
942042928 2:172082887-172082909 TAGGGAGGAGCACTGAGCGCGGG - Intergenic
948466462 2:238154084-238154106 CAGGCAGGGACAGTGGTTGCTGG + Intergenic
1169552740 20:6717823-6717845 TAGGGAGGGACAGTGATTAGGGG + Intergenic
1170916523 20:20631865-20631887 TAGGGAGGGAGAAAGAGTGCTGG - Intronic
1172231793 20:33341717-33341739 TAGTGGGGGACACTGATAACAGG - Intergenic
1176249438 20:64113327-64113349 TGTGGAGGGACACGGACTGCCGG - Intergenic
1184450218 22:44578175-44578197 GAGGGAGGGGCACTGAGTGGGGG - Intergenic
951702768 3:25512620-25512642 TAGGGAGGGAAAGGCATTGCAGG - Intronic
955677427 3:61463310-61463332 TAGGCAGGGACACTGAAAACTGG - Intergenic
957970643 3:87377394-87377416 CAGGGAGGGTAACTGATTGGTGG - Intergenic
962251149 3:133836820-133836842 TAGGGTGGGGCACTGAGTCCTGG + Intronic
962481236 3:135800413-135800435 TAGGCAGGGACTCTGCATGCTGG + Intergenic
969223936 4:5782002-5782024 GAGGGAGGGAAAAGGATTGCAGG + Intronic
969495446 4:7523678-7523700 TGGGCAGGGACACTGAGGGCCGG - Intronic
970239490 4:13993575-13993597 TAGGGAGGCAAACTGAATGTAGG - Intergenic
973225632 4:47780649-47780671 TAGGTGGGGAGACAGATTGCTGG - Intronic
984892548 4:184506612-184506634 TAGGGAGGGATTATGAATGCAGG - Intergenic
990404319 5:55472898-55472920 TAGAGCAGGACACTGATTGCTGG - Intronic
992885031 5:81150065-81150087 AATGGATGGACTCTGATTGCTGG + Intronic
997599335 5:135128554-135128576 TGGGAAGGGACACTGATGGCTGG - Intronic
998441266 5:142164365-142164387 TGGGGAGGCACACTGATGGAGGG - Intergenic
999229287 5:150052291-150052313 TGGGGAGGGCCTCTGACTGCTGG + Exonic
1002436759 5:179236237-179236259 GAGGGAGGGAAAGTGATTTCTGG - Intronic
1006429886 6:33988980-33989002 GAGGGTGGGACACAGATTGGGGG - Intergenic
1006473726 6:34242372-34242394 TTGGGTGGGACACTTAATGCTGG - Intronic
1007172634 6:39874865-39874887 GATGAAGGGAAACTGATTGCAGG - Intronic
1009027753 6:58020439-58020461 TAGCAGGTGACACTGATTGCAGG + Intergenic
1009203286 6:60771917-60771939 TAGCAGGTGACACTGATTGCAGG + Intergenic
1016130035 6:140456822-140456844 TTTGGAGGGACACTTATTGCTGG + Intergenic
1018389055 6:163329351-163329373 TGGGGAGGGATGCTGACTGCAGG - Intergenic
1018389072 6:163329409-163329431 TGGGGAGGGACGCTGAATGCAGG - Intergenic
1018389081 6:163329438-163329460 TGGGGAGGGATTCTGACTGCAGG - Intergenic
1018389099 6:163329496-163329518 TGGGGAGGGATTCTGACTGCAGG - Intergenic
1018389128 6:163329583-163329605 TGGGGAGGGATTCTGACTGCAGG - Intergenic
1018463016 6:164017099-164017121 GAGGGAGGGACATTGAAAGCTGG - Intergenic
1021699904 7:23307911-23307933 AAGGGAAGGACACTGATGACTGG + Exonic
1021897497 7:25250755-25250777 TAGTGAGGGATAATGACTGCTGG + Intergenic
1023770229 7:43550372-43550394 CAGGGAGGCACACTGATTTTAGG - Intronic
1034916315 7:155042793-155042815 TAGGAAGGGACACTGAGTGCGGG - Intergenic
1036034399 8:5003531-5003553 CAGGGAGGGACCCTGTGTGCTGG + Intergenic
1036947239 8:13105872-13105894 TAGAAAGGAACACAGATTGCCGG - Intronic
1039717455 8:40125468-40125490 TGGTGAGAGACACAGATTGCAGG + Intergenic
1039747599 8:40443330-40443352 TAGGCAGTGACAAAGATTGCAGG - Intergenic
1040568454 8:48587536-48587558 TAGGGAGTGACAAGGATTGTGGG + Intergenic
1047809463 8:128392635-128392657 CAGGCAGGGACACTAACTGCAGG + Intergenic
1051585047 9:18718575-18718597 GAGGGAGTGACACTGGCTGCGGG - Intronic
1052147081 9:25062629-25062651 TAGGGAGTGTGACTGATTACTGG + Intergenic
1052570416 9:30214237-30214259 TAGGTAGGGCCACTGAATGCTGG - Intergenic
1056258459 9:84824296-84824318 TAGGGAGAGCCACAGATTGCTGG - Intronic
1057995359 9:99818570-99818592 TAGGAAGGGGGACTGACTGCTGG - Intergenic
1058958420 9:109970356-109970378 TGTGGAGGGACACGGATTGGTGG + Intronic
1059604592 9:115820502-115820524 AAGTGAGGGACACAGATTGGGGG - Intergenic
1188774893 X:34203894-34203916 TAGGGAGTACCAATGATTGCTGG - Intergenic
1189857748 X:45240346-45240368 TAGGGAGATACCCTGATTCCTGG + Intergenic
1198239111 X:134765903-134765925 TAGTCAGGCACACTGATTACTGG - Intergenic
1199613044 X:149633900-149633922 TAGGGTGGGACACTGAGTGAGGG - Intergenic