ID: 1109240447

View in Genome Browser
Species Human (GRCh38)
Location 13:59880306-59880328
Sequence TCCCAAATCCCTAGTGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109240447_1109240449 -4 Left 1109240447 13:59880306-59880328 CCAAACACACTAGGGATTTGGGA 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1109240449 13:59880325-59880347 GGGACTTAAAACGCACTGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 60
1109240447_1109240450 -3 Left 1109240447 13:59880306-59880328 CCAAACACACTAGGGATTTGGGA 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1109240450 13:59880326-59880348 GGACTTAAAACGCACTGAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 82
1109240447_1109240448 -5 Left 1109240447 13:59880306-59880328 CCAAACACACTAGGGATTTGGGA 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1109240448 13:59880324-59880346 TGGGACTTAAAACGCACTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 74
1109240447_1109240451 0 Left 1109240447 13:59880306-59880328 CCAAACACACTAGGGATTTGGGA 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1109240451 13:59880329-59880351 CTTAAAACGCACTGAAGGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109240447 Original CRISPR TCCCAAATCCCTAGTGTGTT TGG (reversed) Intronic
906217138 1:44049274-44049296 TCCCTAATCCCAAATGTGGTGGG - Intergenic
909685727 1:78346426-78346448 TCCCACATCCCCAGTGTTATGGG + Intronic
910411227 1:86947360-86947382 TCAGAAATTCTTAGTGTGTTAGG + Intronic
910811396 1:91240948-91240970 TCCCAAATCACTATTTTGTGGGG - Intergenic
911529876 1:99031921-99031943 TCCCAAATCCCCAGTTGGTATGG + Intergenic
917113276 1:171574760-171574782 TCTGAAATCCCTAGGGTCTTAGG + Intronic
920837333 1:209523506-209523528 TCCCCAGTGCCTAGTGTGTCTGG + Intergenic
1063951180 10:11224866-11224888 TCCCTATTTCCTAGTGTGTGGGG - Intronic
1071338055 10:84617946-84617968 TGCCAAATCCCTAGTGCCCTAGG + Intergenic
1072694154 10:97590697-97590719 GCCCAAATCCCTACTTTCTTAGG + Exonic
1076341346 10:129748117-129748139 TCCCCATTCCTAAGTGTGTTAGG - Intronic
1078802064 11:14656476-14656498 TCCCAATTTCCTACTGTCTTTGG + Intronic
1081936268 11:46905949-46905971 TCCCCACTCCCTACTGTGTGTGG - Intronic
1084084062 11:66846734-66846756 CCCCAAAGTCCTAGTGTGGTTGG + Intergenic
1086042536 11:82496004-82496026 TTCCAAATGCCTAGAGAGTTGGG + Intergenic
1089708207 11:120296023-120296045 TTCCAATTCCCTAGTGCATTTGG - Intronic
1091617291 12:2059254-2059276 CCCCAACTCCCTAGGGTGTCTGG + Intronic
1093640517 12:21522296-21522318 TCCCAAAACCTTTGTGTTTTGGG + Intergenic
1096823377 12:54254990-54255012 TCCCAACCCCCAAGTGTATTCGG - Intronic
1097017749 12:55999381-55999403 TCCCAAAGTGCTAGTGTGTCCGG + Intronic
1097957481 12:65501132-65501154 TCCCAAATCCCTGAGGTGTGAGG + Intergenic
1098584888 12:72143198-72143220 GCTCAAATCCCTAGTGGGATAGG - Intronic
1103082712 12:118038091-118038113 TTCCAAATCCCTCCTGTCTTTGG + Intronic
1107844844 13:44501110-44501132 TCCCAAATCACTATTCTTTTCGG - Intronic
1109240447 13:59880306-59880328 TCCCAAATCCCTAGTGTGTTTGG - Intronic
1109641380 13:65195784-65195806 TCCCAAATTCTTTGTGTTTTAGG - Intergenic
1111915632 13:94357255-94357277 TTCCAAACCCTTAGTGGGTTTGG + Intronic
1114337357 14:21704809-21704831 TCTGACATCCCTAGTGAGTTAGG - Intergenic
1116920109 14:50562907-50562929 TACTAAATGCCTACTGTGTTAGG - Intronic
1117186045 14:53241997-53242019 AACCAAATTCCTAGTGGGTTAGG - Intergenic
1118286221 14:64476097-64476119 TCCCAAATCCCTACTCTGACAGG + Intronic
1119136645 14:72227494-72227516 ACCAAAACCCCTAGTGTTTTGGG + Intronic
1119445579 14:74660776-74660798 TCCCAAACCCCTTGTGGGTGAGG + Intronic
1120643896 14:87048968-87048990 TCACAAATGCCTAGTGAGTTAGG - Intergenic
1120644520 14:87057784-87057806 CCACAAATGCCTAGTGAGTTAGG + Intergenic
1123672257 15:22670921-22670943 GCCTAAATCCCCAGTGTGATGGG - Intergenic
1124324304 15:28744212-28744234 GCCTAAATCCCCAGTGTGATGGG - Intergenic
1124407311 15:29404285-29404307 GTCCATATCCCTACTGTGTTTGG - Intronic
1125092536 15:35811165-35811187 TCCCAAATCTACAGTATGTTAGG + Intergenic
1128551940 15:68603546-68603568 GCCCTAACCCCCAGTGTGTTTGG + Intronic
1132695082 16:1198440-1198462 TCCCGCACCCCTAGTGTGATCGG - Intronic
1134162172 16:11900412-11900434 TCACAAATCCATATTGTGTAGGG + Intronic
1135157439 16:20064948-20064970 TCCCAAATCCCTGGTTTCATGGG + Intronic
1135940713 16:26819474-26819496 AGCCAAACCCCTAGTTTGTTGGG - Intergenic
1137541381 16:49364508-49364530 CCCAACATCCCTAGTGCGTTGGG + Intergenic
1138549266 16:57738672-57738694 TCCCAGAGCCCTAGAGTTTTGGG - Intronic
1139413549 16:66786881-66786903 GCCCAAACCCCCAGGGTGTTGGG - Intronic
1139678274 16:68539873-68539895 TCCCATCTCCCAAGGGTGTTTGG + Intronic
1143179553 17:4975618-4975640 ACACAAAGCCCGAGTGTGTTGGG - Intronic
1143289600 17:5818888-5818910 ACCCACATCCCTTCTGTGTTTGG - Intronic
1144732150 17:17534576-17534598 TCCCAAAGTCCCAGAGTGTTGGG - Intronic
1151455128 17:74221486-74221508 TCCCGAATCCCTAGTGCTCTGGG - Intronic
1151823393 17:76509617-76509639 TCCCAAATTACTAGTGAGGTTGG - Intergenic
1155917802 18:31573180-31573202 CCCCATTTCCCAAGTGTGTTGGG + Intergenic
1156416820 18:36903145-36903167 TCCCAAATCATCAGTGTGTGTGG + Intronic
1156527962 18:37785368-37785390 TCCCATAGCTCTTGTGTGTTTGG + Intergenic
1157517982 18:48324533-48324555 ACCCTAATCCCTAGGGTGATGGG + Intronic
1158078855 18:53564771-53564793 TCTCAAAGCCCAAGTGTGCTGGG - Intergenic
1158672191 18:59486508-59486530 TCCTAAATCCATAGGGTGTGGGG - Intronic
1159875304 18:73804078-73804100 TCCCAAATCAGTTGTGAGTTTGG - Intergenic
1163126355 19:15246332-15246354 TCCCAGTTCCCTAGTGTGCAGGG - Intronic
1166852620 19:45767782-45767804 TCCCAAATCCCATCGGTGTTGGG - Intronic
1168013564 19:53554096-53554118 TCCCGAAGCCCCTGTGTGTTTGG + Intronic
925637372 2:5953088-5953110 TCCCCAATTCCTAGTTTGCTGGG + Intergenic
931411978 2:62041646-62041668 TCCCAAAGTGCTAGTGTGTCCGG + Intronic
933795872 2:85919073-85919095 TTCCAACCCCCGAGTGTGTTTGG - Intergenic
936092082 2:109507939-109507961 TCCCAAATGCCAAGAGTGGTGGG + Intergenic
937219270 2:120332448-120332470 TCCCAAGTCCTTACTGGGTTTGG - Intergenic
937895728 2:126975549-126975571 GACCAAACCCCTAGTGTTTTTGG + Intergenic
940174637 2:150864541-150864563 TCCCAAGTCCCTAGTATCCTGGG + Intergenic
941552209 2:166930960-166930982 TCCAGAATCCCAAGTGGGTTTGG + Intronic
945584564 2:211643115-211643137 TTAAAAATCACTAGTGTGTTAGG - Intronic
946589370 2:221226572-221226594 TCACGAATTCCTAGTTTGTTGGG + Intergenic
1170099668 20:12685042-12685064 TCTCAAATCCCTAGGGTTTGAGG + Intergenic
1170295775 20:14823746-14823768 TCCCAAATCCCAAATATATTTGG + Intronic
1170795273 20:19541576-19541598 TCCCAAATCCCTAGCATCTCAGG + Intronic
1173282242 20:41639207-41639229 TCTTAGATCCCTAGTGTGCTGGG - Intergenic
1174124382 20:48292232-48292254 TGCCTAAACCCTAGAGTGTTTGG + Intergenic
1177089755 21:16753213-16753235 TCCCAAATCCTTAGTGTGGGGGG - Intergenic
1178913322 21:36693470-36693492 TCCCAAAGCCCAGGTGTGTGTGG + Intergenic
1180865797 22:19119009-19119031 TGCCAAATCCCTTCTGTGTTTGG - Intronic
1182917574 22:34049225-34049247 TCCCAAAGCCCAGTTGTGTTAGG + Intergenic
1184418748 22:44367090-44367112 TTGGAAAGCCCTAGTGTGTTAGG + Intergenic
949938792 3:9137566-9137588 TGCTAATTCCCTAGTGTGTTGGG - Intronic
951627403 3:24680920-24680942 CCCCAAATCCCAAGTTTCTTTGG - Intergenic
955777525 3:62449575-62449597 TTCCAAAACTCTAGTGGGTTGGG - Intronic
958183467 3:90088285-90088307 TCCAAAATCCCTCATGGGTTGGG - Intergenic
959418834 3:106109539-106109561 ACCCTAATCCCTAATGTGATGGG + Intergenic
959568132 3:107853454-107853476 TTCCAAATACCTAGTGGATTAGG - Intergenic
967521041 3:190433534-190433556 TCCCAAATCTCTACTGTTTGTGG - Intronic
980184203 4:129441339-129441361 TCCTAGTTCTCTAGTGTGTTTGG + Intergenic
980925794 4:139136134-139136156 TCCCCAATCCCTAATGTCTTCGG + Intronic
981194403 4:141901798-141901820 TCCCAAATCCCACGTGTCCTAGG - Intergenic
990576796 5:57131039-57131061 TCCCAAATTGCTAGTGTTATAGG + Intergenic
991973401 5:72162695-72162717 TACCAAGTCCCTACTATGTTGGG - Intronic
992980978 5:82171620-82171642 TCCCAAATTGGAAGTGTGTTTGG + Intronic
993013959 5:82514535-82514557 TCCTAAGTCTCTAGTGTTTTGGG + Intergenic
1004224546 6:13773614-13773636 TCCCAAAGCGCTAGTATGTCTGG - Intergenic
1011736181 6:90313093-90313115 TCTCAAAGCCCTAGTGTGGTAGG + Intergenic
1012000116 6:93644394-93644416 TCCGACATTCCTAGTGGGTTGGG - Intergenic
1015029312 6:128575266-128575288 TCCCAAATCTCCATTGTGATAGG + Intergenic
1019149041 6:169992394-169992416 TCCCAGATCCCTGGTGACTTGGG - Intergenic
1024123228 7:46266442-46266464 TCCCAAATCCTTACTGAGTGTGG - Intergenic
1026913327 7:74105541-74105563 TTCCAAATCCCAGGTATGTTTGG - Intronic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1032744918 7:134776554-134776576 TCCAAATTCTCTATTGTGTTTGG + Intronic
1033287470 7:140054868-140054890 TCACAAAGCCCTATCGTGTTTGG + Intronic
1034876454 7:154728944-154728966 ACCCAAATCCCTAAGGTGATGGG - Intronic
1037168413 8:15859265-15859287 TCCCAAAACTTTAGTGTGTTAGG + Intergenic
1037307137 8:17516858-17516880 TCCCAAATACCTAGAGTGCTTGG - Intronic
1044614300 8:94123515-94123537 TCACCAATCCCTAGTTTATTGGG + Intergenic
1045446710 8:102273654-102273676 GCCCAAATACCTAGTCTGTAAGG + Intronic
1047280930 8:123444866-123444888 TCCCAACTCCTTGGTGTGTCAGG - Intronic
1050867719 9:10524229-10524251 TCCCAAGTGCCTAGTTTCTTTGG - Intronic
1053786057 9:41653764-41653786 TCACAAATGCCTGCTGTGTTCGG + Intergenic
1053894121 9:42726154-42726176 TCCCCAATAACTAGTGTCTTAGG + Intergenic
1057770534 9:97963656-97963678 TTTAAAATACCTAGTGTGTTGGG - Intergenic
1060758809 9:126231798-126231820 ACCCAGATCCCTCCTGTGTTAGG - Intergenic
1185670721 X:1807325-1807347 TCCGCCATCCCTAGTGGGTTGGG + Intergenic
1186337597 X:8607604-8607626 TCACAAATCCCTAGAGAATTAGG + Intronic
1197926344 X:131650590-131650612 TCCAAACTCCCTTGTGGGTTGGG + Intergenic
1201727509 Y:17170196-17170218 TCCCAGATCCCAAGTGTGCCTGG + Intergenic