ID: 1109240777

View in Genome Browser
Species Human (GRCh38)
Location 13:59884514-59884536
Sequence CTAATTCTTCAGTTCTCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 224}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109240773_1109240777 12 Left 1109240773 13:59884479-59884501 CCACACTACACTCTCCACTCATA 0: 1
1: 0
2: 1
3: 14
4: 225
Right 1109240777 13:59884514-59884536 CTAATTCTTCAGTTCTCTATGGG 0: 1
1: 0
2: 3
3: 16
4: 224
1109240774_1109240777 -2 Left 1109240774 13:59884493-59884515 CCACTCATACTCTCCTATTAGCT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 1109240777 13:59884514-59884536 CTAATTCTTCAGTTCTCTATGGG 0: 1
1: 0
2: 3
3: 16
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109240777 Original CRISPR CTAATTCTTCAGTTCTCTAT GGG Intronic
903612758 1:24628461-24628483 CAGATTATTCAGTTCTTTATAGG - Intergenic
904059512 1:27697063-27697085 ATACTTCTCCAGCTCTCTATTGG - Intergenic
905491996 1:38351724-38351746 CTAATTCTTCATTTCTTTATGGG + Intergenic
907965818 1:59328417-59328439 CTAACTCTTCAATTCTGTAAAGG - Intronic
909705169 1:78572988-78573010 TTAATGGTTCAGTTCTATATTGG - Intergenic
910200479 1:84693214-84693236 CTAATTCTTCATTTCTATGAAGG + Intergenic
910952793 1:92669063-92669085 TTAATTTTTCAGTTCCCTGTAGG - Intronic
910981708 1:92964825-92964847 CTAATTTTTAAATTTTCTATAGG - Intergenic
911135651 1:94436990-94437012 CTAACTCTTCAGTTCTGTGAAGG + Intronic
911695075 1:100881756-100881778 TTAATTCATTAGTTCTTTATAGG + Intronic
912185206 1:107267098-107267120 TTAATTCTTCAGTTGTGCATTGG + Intronic
912189870 1:107325241-107325263 CTAGTTTTTCAGTTCGTTATAGG - Intronic
916191540 1:162183745-162183767 CTAACTCTTCAATTCTATAAAGG - Intronic
918444880 1:184607516-184607538 TTAATTATTCATTTCTCCATGGG - Intronic
918577474 1:186080019-186080041 CTAATGCTTCAGCTCTTGATTGG + Intronic
919067437 1:192710855-192710877 TTTATTCTTCAATTCTCTCTTGG + Intergenic
919498383 1:198306308-198306330 CTATATTTTCAGTTCTCCATTGG + Intronic
919543352 1:198879304-198879326 CTAACTCTTCAGATTTCTGTGGG + Intergenic
920220586 1:204397020-204397042 CTAATTTTTAAGTTATCTGTAGG - Intergenic
921243259 1:213208999-213209021 CTAGTCCTTCCTTTCTCTATTGG + Intronic
921589947 1:216991557-216991579 CCTATTCTGCAGTTCTCTAATGG - Intronic
922817047 1:228457319-228457341 CTGATCCTGCAGTTCTTTATAGG - Exonic
924304789 1:242676466-242676488 ATAATTCATCACTTCTTTATGGG + Intergenic
1065542826 10:26786977-26786999 CTCCTACTTCAATTCTCTATTGG + Intronic
1067275713 10:44832019-44832041 CTAACTCTTCAGTTCTATAGAGG - Intergenic
1067412325 10:46076063-46076085 CTTGTTCTCCAGTTCTCTAAGGG + Intergenic
1068013468 10:51483517-51483539 CTAATTTGTCAGGTCTTTATAGG + Intronic
1073630614 10:105144819-105144841 ATTATTGTTCAGGTCTCTATTGG + Intronic
1074134416 10:110614462-110614484 CCCATTCCTCATTTCTCTATGGG - Intergenic
1074782194 10:116810025-116810047 CACATTCTTCAGTTCTCCTTCGG - Intergenic
1078324145 11:10365542-10365564 CCAATTCTCCAATTCTCTGTAGG - Intronic
1080094857 11:28393731-28393753 TTACTTCTTCAGTACTCTTTTGG + Intergenic
1081225111 11:40512160-40512182 CTTATTTTTCAGTTATCTATCGG + Intronic
1085775462 11:79362086-79362108 CTATTTCTTCATCTCTCAATTGG - Intronic
1086220413 11:84436613-84436635 CTAATTCTCCAGTGCTTTCTGGG - Intronic
1086778359 11:90869208-90869230 CTAGTTCTTCAGTTCTATGAAGG + Intergenic
1086831433 11:91570168-91570190 CTGTTACTTCATTTCTCTATTGG + Intergenic
1087332662 11:96800510-96800532 CTAATTCTTCGTTTATCTATAGG + Intergenic
1088010163 11:104991058-104991080 CAAATTCTTCTTTTCTCTTTGGG + Intergenic
1090554291 11:127857366-127857388 CTCATTCTTTCTTTCTCTATAGG - Intergenic
1090614605 11:128503697-128503719 CTAATTATTCCCTTCTCTAAGGG + Intronic
1091199221 11:133760295-133760317 CTAACTCTTCAATTCTTTGTAGG + Intergenic
1093424672 12:19015001-19015023 CTAATCCTCCAGTTCTTCATCGG + Intergenic
1095318402 12:40794807-40794829 CTAATTCTTCCTTCCTCAATTGG - Intronic
1095353508 12:41243716-41243738 GTACTTTTTCATTTCTCTATGGG + Intronic
1097757443 12:63422539-63422561 CTAAGTCTTCAGATCTGTCTAGG - Intergenic
1098640939 12:72838343-72838365 CTCATTCCTCTGTTCTCCATGGG - Intergenic
1098698994 12:73598609-73598631 CTAATTCTTCAGTTCTGTCTTGG + Intergenic
1099168961 12:79340766-79340788 CTAAAGCTTTAGATCTCTATGGG - Intronic
1099196675 12:79625181-79625203 CTAGTTTTCCATTTCTCTATAGG + Intronic
1099274802 12:80561213-80561235 CTAATTTTTCAGGTCTCTCCTGG - Intronic
1100285905 12:93166027-93166049 CTATTTCTTAAATCCTCTATAGG - Intergenic
1101203700 12:102463974-102463996 CTAATTTTTCAATTCTGCATTGG + Intronic
1104424111 12:128660543-128660565 CTAATTCCTGCTTTCTCTATGGG + Intronic
1104433382 12:128735454-128735476 CTGATTCTTAATTTCTTTATAGG - Intergenic
1107750509 13:43560656-43560678 CTAATTTTTCATTTGTCTATTGG + Intronic
1109240777 13:59884514-59884536 CTAATTCTTCAGTTCTCTATGGG + Intronic
1110075837 13:71241370-71241392 CTAATTCATCACTTCTCCTTGGG + Intergenic
1110413983 13:75232432-75232454 CTTAATCTTCACCTCTCTATTGG - Intergenic
1111726135 13:92011956-92011978 CTAAATCTTCTGTTCTCAACCGG + Intronic
1112829105 13:103426883-103426905 CTAATTATTCAGTTTTCAAGTGG + Intergenic
1114815410 14:25952129-25952151 CTAACTCTTCAGTTCTATGAAGG - Intergenic
1115966890 14:38900213-38900235 CTATTTTTTAAATTCTCTATTGG + Intergenic
1120299530 14:82689012-82689034 CCATTTCTTCATTTTTCTATAGG + Intergenic
1120969702 14:90197109-90197131 CTCCTTCTTCAGTCCTCTGTGGG + Intergenic
1121756207 14:96404465-96404487 CTAATTCTTCCCTTCTGAATTGG + Intronic
1124942025 15:34227366-34227388 CTATTTCTTCAGTTGTAGATAGG + Intronic
1125900656 15:43343529-43343551 CTCATTATTCAGATCTCAATTGG + Intronic
1127105682 15:55611505-55611527 TTTATTCTTCAGTTTTCTTTTGG - Intergenic
1128044100 15:64602272-64602294 TTAATTCTTTAGTACTGTATGGG + Intronic
1129051574 15:72785656-72785678 CTGACTCTTCAGTTCTCAGTTGG - Intronic
1131462207 15:92625437-92625459 CAAATGTTTCAGTTCTCTCTAGG - Intronic
1131573556 15:93563889-93563911 CTAATTCCTTAGTTTTCTCTTGG + Intergenic
1135583432 16:23647915-23647937 CCAATTCTTCAGTTGGGTATAGG - Intronic
1140423204 16:74838176-74838198 CTATTTCTTCATATCTCTATAGG - Intergenic
1140529458 16:75651359-75651381 CTATTTCTTCATTTGTTTATCGG - Intronic
1143288873 17:5813476-5813498 CTAAAGCTTCAGTTCTCTGCAGG + Intronic
1144530757 17:16036719-16036741 CTAACTCTTCAATTCTCTGAAGG - Intronic
1144885864 17:18460753-18460775 CCAATTCTGCAATTCTCTCTTGG - Intergenic
1145146348 17:20483619-20483641 CCAATTCTGCAATTCTCTCTTGG + Intergenic
1146542379 17:33708613-33708635 CTACTACCTCTGTTCTCTATGGG + Intronic
1156783445 18:40880438-40880460 GAAATTCTTAAATTCTCTATAGG - Intergenic
1156927799 18:42604059-42604081 CTAATTCTTCACTTCACTATTGG + Intergenic
1157848611 18:51027291-51027313 ATAGTTCTTCAGTTCTCTGATGG - Intronic
1158210699 18:55046605-55046627 CCAAATCTTCAGTTCACTAAAGG - Intergenic
1158580257 18:58674531-58674553 TTAATTCTTCTGATCTCCATAGG - Intronic
1165164787 19:33844448-33844470 CTAATTCTTCTGTACTTTAGTGG - Intergenic
926258523 2:11233339-11233361 CTTACTATTCAGTTCTCTAAGGG - Intronic
926359267 2:12070089-12070111 CTATTTCTTCAGTTTTTCATGGG + Intergenic
930766342 2:55089448-55089470 CTACTTCTACAGTTCTTTCTAGG + Intronic
931251481 2:60534688-60534710 CTAATTCCTCAATTCACTAAAGG + Intronic
933425300 2:82103652-82103674 GTAATTCTCCAGTTTTCTATTGG - Intergenic
935860345 2:107322420-107322442 CTAATTCTTCAATCCTCTCATGG + Intergenic
937607490 2:123818940-123818962 TTAATTCTTCAGCTTTCTCTGGG + Intergenic
937621204 2:123989456-123989478 CTAATTTTTCAGTTTTCTAATGG - Intergenic
938110543 2:128561476-128561498 CTAATTCTAAAGTTCACTTTGGG + Intergenic
939359720 2:141154482-141154504 CAAATTTTTCATCTCTCTATGGG + Intronic
940812891 2:158265741-158265763 CCAATTATTCAGCTCTCTGTTGG + Intronic
941497647 2:166226262-166226284 TTAATTATTCAATCCTCTATAGG + Intronic
941957630 2:171220637-171220659 CTAAGTCTGCAGTCCTCTAAAGG - Intronic
942150035 2:173066491-173066513 CTAATTCTTAAATTATTTATAGG - Intergenic
942499840 2:176577981-176578003 CTTATTTCTCAGTTCTCTCTGGG - Intergenic
946431627 2:219629568-219629590 CTATGTCTGCAGTTCTCCATTGG + Exonic
946860804 2:223998768-223998790 CTAAGTCTTCTGTTCTCTCAGGG + Intronic
947198505 2:227593974-227593996 CTTATTATTCAGATCACTATCGG + Intergenic
1169373035 20:5043267-5043289 CAACTGCTTCAGTTCTCTGTCGG + Intergenic
1169513110 20:6286358-6286380 TTAATTCTTCAATTCACTTTTGG - Intergenic
1170033015 20:11961863-11961885 TTAATGCGTCAGGTCTCTATTGG + Intergenic
1170173874 20:13445567-13445589 CTGAGTCTTCAGTTCTCTGTAGG - Intronic
1170352676 20:15459311-15459333 ATAATACTTCAGTACTCTAAAGG - Intronic
1170523981 20:17218275-17218297 CTAATCCTCCAGTACTCTAGGGG + Intergenic
1171288438 20:23964424-23964446 CTAATTCAACAGTTATCTAAAGG - Intergenic
1173266004 20:41482334-41482356 ATAATTCCTCAGAGCTCTATAGG - Intronic
1173519628 20:43689567-43689589 CTCATCCTTCAGTTCTCAGTGGG + Intronic
1177306635 21:19326970-19326992 CTACTTTTTCAGTTTTATATAGG + Intergenic
1178134031 21:29605845-29605867 CTTATTCTTCACTTATATATTGG + Intronic
1178241094 21:30901544-30901566 GTAATTCTTCAGTGCCCTTTGGG - Intergenic
1178334183 21:31729423-31729445 CTAAGTCTTATGTCCTCTATTGG + Intronic
1182262650 22:29086060-29086082 CTAATTCTACGTTTCTCTAATGG - Intronic
949647412 3:6111923-6111945 CTATTTCTTCAGTTTCCTTTTGG + Intergenic
949776945 3:7644418-7644440 CTAATTCCTCAGTTATCTCCTGG + Intronic
949844983 3:8360623-8360645 CTAATTGTTAAGTTCTTTAAAGG - Intergenic
950976272 3:17249043-17249065 CTAACTCTTCAATTCTGTAAAGG - Intronic
951842675 3:27050967-27050989 CTCATTCTGCAGCTCTCTGTGGG + Intergenic
952686163 3:36150831-36150853 CTTTTTCCTCAGTTCTCCATAGG + Intergenic
953258496 3:41313713-41313735 TTATTTCTTCAGTTCTATAGTGG + Intronic
955173775 3:56591229-56591251 CTAATTGTTCAGTTATCTTAGGG + Intronic
957836633 3:85601719-85601741 CTAATTCTATACTTCTCTTTTGG + Intronic
958858559 3:99417403-99417425 ATATTTCTTTAGTTCTCTAATGG - Intergenic
958883064 3:99695435-99695457 AAAATTCTTCAGTTTTCTCTTGG - Intronic
961218248 3:125178385-125178407 ATTTTTCTTCATTTCTCTATAGG + Intronic
963604803 3:147405129-147405151 CTCATTCTCCTGTTCTCTAGAGG + Intronic
966075554 3:175932990-175933012 CTGAAACTTCAGTTCTCTGTTGG - Intergenic
966745591 3:183273364-183273386 ATAATTTTTCAGTTGTTTATTGG - Exonic
967643181 3:191893040-191893062 CTCAGCCTTCAGTTCTCTCTGGG + Intergenic
968259946 3:197313019-197313041 TTAATTCTACAGATCTCTTTGGG + Intergenic
972035693 4:34516609-34516631 TAAAATCTTCATTTCTCTATGGG + Intergenic
972246409 4:37249393-37249415 CTAATTCTTGGGTTCAATATTGG - Intronic
972287158 4:37660174-37660196 CTAAATGTTCATTTCTCTAAAGG + Intronic
975141367 4:70921882-70921904 TTATGTCTTCAATTCTCTATCGG + Intronic
975257972 4:72261248-72261270 CTAATTTTTGTGTTCTCTAGGGG + Intergenic
975690221 4:76955659-76955681 CTAATTCTTCAGGATTCAATAGG + Intronic
977065646 4:92311104-92311126 CTAATTTTGCAGTGTTCTATAGG - Intronic
978695869 4:111577914-111577936 CTTATTCTTCGCTTCTCTATTGG - Intergenic
979198542 4:117949301-117949323 CTAATTCTGCAATTTTCTCTTGG + Intergenic
979625956 4:122845700-122845722 CTAACTCTTCAGTTCTATGAAGG - Intronic
979798223 4:124874151-124874173 CAAATTCCCCAGTTCTCTCTTGG - Intergenic
979846539 4:125520293-125520315 CTGCTTCTCCAGTTCTCTCTCGG + Intergenic
980596700 4:134963916-134963938 TTCTTTCTTTAGTTCTCTATTGG - Intergenic
981413927 4:144465683-144465705 CTAATTCTTTATTTCTAAATAGG + Intergenic
982975485 4:162052630-162052652 CTAATTGTTGAATTCTCCATTGG - Intronic
983416394 4:167460640-167460662 CTACTTTTTGAGTTCTATATGGG + Intergenic
984055361 4:174922338-174922360 CTATGACTTCAGTTCTCTAATGG - Intronic
984244946 4:177263910-177263932 CTATTACTTCAGTTGTCTAAAGG + Intergenic
984515376 4:180732569-180732591 CTAGTTCTTATCTTCTCTATGGG - Intergenic
985383394 4:189419532-189419554 GTGATTCTTCAGTTCTCTTTCGG - Intergenic
985386557 4:189453710-189453732 CTCCTTCTTCAGTGTTCTATTGG - Intergenic
986403510 5:7402315-7402337 CTAATTCTTCAGTCCTTTTTTGG + Intronic
988030363 5:25756087-25756109 CTAATTCAGAAGTTCTCTAAAGG - Intergenic
988164344 5:27564619-27564641 CTGATTCTTCATTTATGTATTGG - Intergenic
988424592 5:31048882-31048904 CTAATTGTTCAGTTCTTTGTGGG + Intergenic
989300466 5:39885331-39885353 CCTATTCATCAGTTTTCTATTGG - Intergenic
989495276 5:42104617-42104639 CTTATTCTTCATATCTCTCTAGG + Intergenic
990887527 5:60611712-60611734 CTAACTCTTCAATTCTATAAAGG + Intronic
991956212 5:71998139-71998161 CTAATTTTTCAGCTCTTTCTGGG - Intergenic
992850647 5:80804341-80804363 CTAATTCTTCAATGCTCACTGGG - Intronic
996487307 5:124052057-124052079 AGAATTCTGCAATTCTCTATGGG + Intergenic
997483973 5:134212881-134212903 CTAATTCTTCAATTCTATAAAGG + Intronic
997721957 5:136085477-136085499 CTACTTCTTCCTTTCTCAATTGG - Intergenic
998550553 5:143073520-143073542 CTAATTATTTATTTCCCTATTGG + Intronic
998831378 5:146163216-146163238 CTAACTCTTCAATTCTGTAAAGG - Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1000478333 5:161740747-161740769 AGAATTCTTCAGTTCTATAATGG + Intergenic
1004661153 6:17710556-17710578 CGAATTTTTCAGCTCTTTATGGG - Intergenic
1005443989 6:25902266-25902288 CTAGTTCCTCATTTCTCTCTTGG + Intergenic
1005836357 6:29712322-29712344 CTCATCCTTCAGCTCTCTAATGG - Intergenic
1008046884 6:46860134-46860156 CTAAGTCTTCAGCTCTCACTGGG + Intronic
1008099935 6:47379645-47379667 AAAATTTTTCAGTTCACTATGGG - Intergenic
1011788431 6:90871469-90871491 ATATTTCTTCAGATCTCCATAGG - Intergenic
1012215911 6:96583549-96583571 CAGATACTTCAGTTCTCTGTTGG - Intronic
1012306364 6:97663067-97663089 CTAATTCATAAATTCTCTAAAGG + Intergenic
1014593486 6:123302813-123302835 CTTATTCATCAGTTCTTGATGGG + Intronic
1014777151 6:125524319-125524341 ATAATTGTTCATTTCTCAATAGG - Intergenic
1015135456 6:129863982-129864004 CTAATACTCCAGCACTCTATTGG + Intergenic
1016200786 6:141405169-141405191 CTAATTCAGCAGTTATCTAAAGG + Intergenic
1016293786 6:142552198-142552220 CTAGTTTTTCAGGTCTCTTTGGG - Intergenic
1016610983 6:145989326-145989348 CTAATTTTTCTCTTCTCTCTTGG + Intergenic
1018150712 6:160934931-160934953 CTAATTCTTTATTTCTTTATAGG + Intergenic
1020413034 7:7914530-7914552 GTCATTCATCAGTTCTTTATTGG + Intronic
1022616619 7:31937526-31937548 CTAGTTCTTCAGGTTTCTTTGGG + Intronic
1023329905 7:39103934-39103956 CTAATTCTTTACTTCCCTTTAGG - Intronic
1024523848 7:50331298-50331320 CAAATTCTTCCTTTCTCTTTTGG - Intronic
1024928072 7:54638873-54638895 CTATTTCTTCTATTCTCTGTGGG + Intergenic
1027336165 7:77152747-77152769 CAAATATTTCAGTTATCTATAGG - Intronic
1028356228 7:89913303-89913325 CCAATTCTTCTTTTCTCTTTTGG - Intergenic
1028980964 7:96967748-96967770 CTATTGCTTCTGTTCTATATAGG - Intergenic
1029779624 7:102718355-102718377 CAAATATTTCAGTTATCTATAGG + Intergenic
1030560219 7:111076046-111076068 ATAATACTTCATTTCTCTCTAGG + Intronic
1030933942 7:115561369-115561391 CTCATACTTCAGTTCTGTACCGG + Intergenic
1033805596 7:144951212-144951234 TTTATTCTTCACTTCTTTATGGG + Intergenic
1033971212 7:147041946-147041968 CTATATTTTCAGATCTCTATTGG - Intronic
1034146765 7:148880360-148880382 ATAATTCATGAGTTCTTTATTGG - Intronic
1035118768 7:156547657-156547679 CTAATTCTTCAAATCAGTATAGG + Intergenic
1035822180 8:2605190-2605212 TTAATTCTTCTGTTCACTAAAGG - Intergenic
1036391179 8:8325549-8325571 CTAATTCTGCAGTAATATATGGG + Intronic
1037403421 8:18516501-18516523 TGAATTCTACTGTTCTCTATAGG - Intergenic
1037506516 8:19535382-19535404 CTAATTTTTCACTGCTCTTTTGG - Intronic
1038071228 8:24015935-24015957 CTTTTTCTTCATTTATCTATTGG - Intergenic
1039450390 8:37669378-37669400 TTACTTCTTCTGTACTCTATTGG - Intergenic
1041111890 8:54490840-54490862 CTAAGTCAACAGTTCTCTTTGGG + Intergenic
1041146323 8:54880259-54880281 CTGAGTCTTCCTTTCTCTATAGG - Intergenic
1041271171 8:56110919-56110941 CTAATTTTGCAGGTCTCTCTGGG + Intergenic
1042099954 8:65264930-65264952 CTAATTCTTCAATTCTATGAAGG - Intergenic
1042439043 8:68803169-68803191 ATAATTCTTCTGTTATGTATTGG - Intronic
1042443740 8:68859594-68859616 CCCCTTCTTCATTTCTCTATTGG + Intergenic
1044075694 8:87819555-87819577 TTAAGTCTTTTGTTCTCTATGGG - Intergenic
1045827802 8:106421405-106421427 ATAATTCTTCACATGTCTATAGG + Intronic
1046847669 8:118936183-118936205 TTATTTCTTCATTTCTCTGTGGG - Intronic
1047810654 8:128405312-128405334 CTACTTCTCCAGTTCTCTGGAGG - Intergenic
1048667995 8:136685990-136686012 CTAATTCTTCATTTCTGACTTGG - Intergenic
1050825785 9:9943709-9943731 CTAATTGTGCAGTTCTCTAGAGG + Intronic
1051690270 9:19705330-19705352 CTTCTTCTTCAGTTCTGTTTGGG - Intronic
1052494072 9:29204512-29204534 TTAATTCTTCAGGTGTTTATTGG - Intergenic
1053282966 9:36833008-36833030 CTACTTCTTCAGTTCCCAAATGG - Intergenic
1055304901 9:74919517-74919539 TTAATTATTCAGTTATCTAAAGG + Intergenic
1055378215 9:75674232-75674254 CTATTTCTTGACTTCTCTTTTGG + Intergenic
1056053229 9:82791968-82791990 CTACTGCTTAAGTTCTCTTTAGG - Intergenic
1058455651 9:105135700-105135722 CACATTCTTCAGTTTCCTATAGG + Intergenic
1058534358 9:105941514-105941536 CAAATTCTTCAGTTTTTTAAAGG - Intergenic
1058546524 9:106066206-106066228 CTTATTTTTTAGTTCTCTCTGGG + Intergenic
1059079819 9:111236664-111236686 TTAATTCTTCACTTTTCTAAGGG - Intergenic
1187057440 X:15754149-15754171 CTAGTTCTTCAGGTTTCTTTGGG + Intronic
1187998545 X:24955953-24955975 CTAACTCCTCTCTTCTCTATCGG + Intronic
1188043280 X:25395615-25395637 CTGATTCTTCTGTTCTTTGTTGG + Intergenic
1188885161 X:35540903-35540925 TTAATAATTCAGTTCTCTGTAGG - Intergenic
1190856349 X:54298714-54298736 CTACTTCTCCAGTTCTCACTAGG - Intronic
1191006831 X:55718278-55718300 CTAAATCTTCAGTACTCTTCAGG - Exonic
1193718111 X:84955309-84955331 CCAATTATTTAGTTCTGTATTGG + Intergenic
1194805720 X:98325325-98325347 CTAATTCATCAGTTCTTTGGAGG - Intergenic
1195733041 X:107984801-107984823 GTCATTCTTCTGTTCTCTAAAGG + Intergenic
1196169453 X:112571617-112571639 TAAATTCTTCAGTTCTCCCTGGG - Intergenic
1197832811 X:130663017-130663039 CAAATATCTCAGTTCTCTATAGG + Intronic
1198199725 X:134403388-134403410 CTAATTCTTCAATTCTATGAAGG + Intronic
1200230773 X:154442909-154442931 CTAATTCTTCTGCTCTGTTTGGG + Exonic