ID: 1109241010

View in Genome Browser
Species Human (GRCh38)
Location 13:59888251-59888273
Sequence CTGTGTTCTGAGATGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2045
Summary {0: 1, 1: 2, 2: 59, 3: 505, 4: 1478}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109241010_1109241017 29 Left 1109241010 13:59888251-59888273 CCCTCCACCATCTCAGAACACAG 0: 1
1: 2
2: 59
3: 505
4: 1478
Right 1109241017 13:59888303-59888325 AAGTGGGCCCTCACCAGAAATGG 0: 1
1: 4
2: 33
3: 104
4: 362
1109241010_1109241016 13 Left 1109241010 13:59888251-59888273 CCCTCCACCATCTCAGAACACAG 0: 1
1: 2
2: 59
3: 505
4: 1478
Right 1109241016 13:59888287-59888309 TATATGAATCAGAAATAAGTGGG 0: 1
1: 0
2: 1
3: 27
4: 355
1109241010_1109241015 12 Left 1109241010 13:59888251-59888273 CCCTCCACCATCTCAGAACACAG 0: 1
1: 2
2: 59
3: 505
4: 1478
Right 1109241015 13:59888286-59888308 ATATATGAATCAGAAATAAGTGG 0: 1
1: 0
2: 6
3: 56
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109241010 Original CRISPR CTGTGTTCTGAGATGGTGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr