ID: 1109241010 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:59888251-59888273 |
| Sequence | CTGTGTTCTGAGATGGTGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2045 | |||
| Summary | {0: 1, 1: 2, 2: 59, 3: 505, 4: 1478} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1109241010_1109241017 | 29 | Left | 1109241010 | 13:59888251-59888273 | CCCTCCACCATCTCAGAACACAG | 0: 1 1: 2 2: 59 3: 505 4: 1478 |
||
| Right | 1109241017 | 13:59888303-59888325 | AAGTGGGCCCTCACCAGAAATGG | 0: 1 1: 4 2: 33 3: 104 4: 362 |
||||
| 1109241010_1109241016 | 13 | Left | 1109241010 | 13:59888251-59888273 | CCCTCCACCATCTCAGAACACAG | 0: 1 1: 2 2: 59 3: 505 4: 1478 |
||
| Right | 1109241016 | 13:59888287-59888309 | TATATGAATCAGAAATAAGTGGG | 0: 1 1: 0 2: 1 3: 27 4: 355 |
||||
| 1109241010_1109241015 | 12 | Left | 1109241010 | 13:59888251-59888273 | CCCTCCACCATCTCAGAACACAG | 0: 1 1: 2 2: 59 3: 505 4: 1478 |
||
| Right | 1109241015 | 13:59888286-59888308 | ATATATGAATCAGAAATAAGTGG | 0: 1 1: 0 2: 6 3: 56 4: 559 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1109241010 | Original CRISPR | CTGTGTTCTGAGATGGTGGA GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||