ID: 1109241663

View in Genome Browser
Species Human (GRCh38)
Location 13:59897441-59897463
Sequence ATATAGTTCTTAAGGAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109241663 Original CRISPR ATATAGTTCTTAAGGAAAGT GGG Intronic
900847863 1:5118067-5118089 AGAGAGTTCTTAAGGAGATTCGG - Intergenic
901912807 1:12474171-12474193 ATGGAGTGCTTAAGGAAATTAGG + Intronic
903309450 1:22442842-22442864 ATATAGTTCTTCAATACAGTTGG - Intergenic
905967233 1:42108944-42108966 ATATGGTTCCTAAGTAAAGCGGG + Intergenic
907458307 1:54590175-54590197 ATATATTTGTTGAGGAAAGCTGG + Intronic
908202919 1:61816168-61816190 ATATAATTTTTAAGGCAAGAGGG + Intronic
909461742 1:75923702-75923724 ATATAGTACTTAGGTAAAATGGG + Intronic
912396625 1:109349798-109349820 ATATATTGCTTAAATAAAGTAGG - Intronic
912697229 1:111850475-111850497 ATATTGTTCACAAGGAAAGGAGG - Intronic
912797849 1:112703672-112703694 ATATAGTTCTCAAAGACAGTAGG + Exonic
913699180 1:121357582-121357604 ATTTAGTTCTTACTGAAACTGGG + Intronic
914138365 1:144922463-144922485 ATTTAGTTCTTACTGAAACTGGG - Intronic
916086342 1:161272737-161272759 ATTTACTTCTTAAGGAGAGAGGG + Intronic
916165564 1:161964318-161964340 ATCTATGTCTTCAGGAAAGTGGG + Intergenic
917151005 1:171944732-171944754 CTATAGTGCCTAAGGAATGTTGG + Intronic
917822562 1:178779311-178779333 CTAAAGTTATTAAGGAAAGCAGG - Intronic
918779659 1:188682682-188682704 ATATATTTAATAAGGAAAATAGG + Intergenic
918797184 1:188915688-188915710 ATATAATTCTAAAGAAAAGTTGG + Intergenic
919333818 1:196206698-196206720 ATATAGTCCTTTAGGAGAATAGG + Intergenic
920486590 1:206376294-206376316 ATTTAGTTCTTACTGAAACTGGG + Intronic
921527716 1:216238736-216238758 ATAATGTTTTTTAGGAAAGTGGG + Intronic
922438002 1:225625373-225625395 AGATATTTCTTAAAGAAAATTGG - Intronic
923362718 1:233227690-233227712 AAATAGTTCTTATGAAAAGTAGG + Intronic
923441646 1:234026518-234026540 ATTTAGTTCTGAAGGTAGGTTGG + Intronic
924460414 1:244253880-244253902 ATATAGTGGGTAAGGCAAGTTGG + Intergenic
1065395571 10:25233210-25233232 TTATAGCTCTTCAGGAAAGAGGG + Intronic
1069102872 10:64345149-64345171 ATTTTGTTTTTAAAGAAAGTAGG + Intergenic
1071154368 10:82672355-82672377 ATATTGATTTTAAGGAAAATGGG + Intronic
1071548392 10:86546252-86546274 ATATGGCTATTCAGGAAAGTGGG + Intergenic
1072173685 10:92893945-92893967 GTATTTTTCTTAAAGAAAGTTGG + Intronic
1074888435 10:117713993-117714015 ATATAGATCTTAAAGAACTTGGG - Intergenic
1079464205 11:20713427-20713449 ATATAGTTCACCAGGGAAGTGGG + Intronic
1079524012 11:21362938-21362960 ATATGGTTCATCAGGGAAGTGGG + Intronic
1080258035 11:30314590-30314612 AGACAGTTCTTAAGCATAGTCGG - Intergenic
1080869282 11:36223086-36223108 ATTAAGCTCTTAAGAAAAGTGGG + Intronic
1081183224 11:40010606-40010628 ATATGTTTCTTAATAAAAGTTGG + Intergenic
1083076629 11:60046433-60046455 ATTTTTTTTTTAAGGAAAGTAGG - Intronic
1085843063 11:80036110-80036132 GTATGGTTCTCTAGGAAAGTGGG + Intergenic
1085886370 11:80527172-80527194 ATATAGTTTTTAAGATAAATGGG - Intergenic
1086279220 11:85166467-85166489 AAATAGTTCTTAAGAAATTTGGG - Intronic
1087165392 11:94998124-94998146 CTACAGTTCTCAAGGAAAATGGG + Exonic
1087168392 11:95026300-95026322 CTACAGTTCTCAAGGAAAATGGG + Exonic
1087405203 11:97721848-97721870 GTATAGTTCTCCAGGGAAGTGGG - Intergenic
1088092154 11:106055001-106055023 ATATAGTTCTTTAGGAGAAGGGG + Intronic
1088167868 11:106959629-106959651 AGATAGTTCATTTGGAAAGTGGG + Intronic
1089107372 11:116024019-116024041 ATACAGGTCATCAGGAAAGTGGG - Intergenic
1090952188 11:131483546-131483568 ATTAAGTTCTTAAGGAGAGGCGG + Intronic
1092388852 12:8057329-8057351 ATATGGTTATTAATGAATGTTGG + Intergenic
1093081742 12:14819827-14819849 AAATTGTTCTTAAGGAATATTGG + Intronic
1093469217 12:19482845-19482867 ATATAGTTCACCAGGGAAGTGGG + Intronic
1094021789 12:25922180-25922202 TTATAGTTCTTCAGAAAAGGAGG + Intergenic
1094133461 12:27099321-27099343 ATATACTCCTTGAGTAAAGTAGG + Intergenic
1095147837 12:38751706-38751728 ATATATTTATTTTGGAAAGTTGG + Intronic
1095537942 12:43274222-43274244 CTATAGTTCTTCAGGAAAATTGG - Intergenic
1096436846 12:51598895-51598917 ATGTATTTCTTAAGGAAAAGGGG - Intronic
1097396763 12:59084695-59084717 AAATTGTTCTTCAGGAAAGATGG - Intergenic
1097513322 12:60570830-60570852 ATATAGGTCTTATGAAAAATTGG - Intergenic
1098415047 12:70223939-70223961 ATAAAGTTTTTAAGGACAGAAGG + Intergenic
1098920544 12:76298217-76298239 ATATACATCTTCAGGAAGGTGGG - Intergenic
1099301219 12:80897029-80897051 ATATAGTTCCTAGGAAAACTGGG - Intronic
1099950134 12:89292784-89292806 ATAAAGTACTTAATGAAAGCGGG + Intergenic
1100071084 12:90719127-90719149 ATACATTTCTTAAGGAATATTGG - Intergenic
1101623510 12:106415459-106415481 CTTTAGTTATTAAGGAAACTTGG - Intronic
1101975799 12:109357419-109357441 ATATGGTTCCTAAGGAAAGAAGG + Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104523736 12:129499023-129499045 ATATATTTCTGAAGGAATGAAGG - Intronic
1104618539 12:130291778-130291800 AATTAGTTATGAAGGAAAGTGGG - Intergenic
1106201451 13:27540750-27540772 TTATAGTGCTTAAGGAAACTTGG + Intergenic
1106523171 13:30516316-30516338 CTATAGTCCATAAGGAAAGGAGG - Intronic
1108399261 13:50022807-50022829 ATATAGTTCTACAGCAAAGCCGG - Intergenic
1108508328 13:51133561-51133583 ATATATTTTTTAATTAAAGTTGG + Intergenic
1108764650 13:53611996-53612018 CTATGATCCTTAAGGAAAGTAGG + Intergenic
1109043851 13:57380719-57380741 ATATATTTTTTAATGAATGTAGG - Intergenic
1109241663 13:59897441-59897463 ATATAGTTCTTAAGGAAAGTGGG + Intronic
1109407166 13:61917555-61917577 ATATGGTTCTTGAGAAATGTTGG + Intergenic
1110290728 13:73803941-73803963 ATATTCGTCTTAAGGAAACTGGG - Intronic
1110394049 13:75009404-75009426 GTATATTTTTTATGGAAAGTAGG - Intergenic
1110714140 13:78682889-78682911 ATATTGTCCTCATGGAAAGTTGG - Intergenic
1110796282 13:79642361-79642383 TTATAGTTCTTAAGGCAACATGG - Intergenic
1113489865 13:110682853-110682875 ATATAGTTCAAACGGCAAGTGGG - Intronic
1114731323 14:24995503-24995525 AAATACTTCTTAAAGAAGGTGGG + Intronic
1116114395 14:40629419-40629441 ATATAGTTGGCCAGGAAAGTTGG + Intergenic
1116163181 14:41296471-41296493 AGATAGTTTTTAAGGTAAGCTGG - Intergenic
1117528348 14:56634302-56634324 ATATAGTTCTTATGAACAGCTGG + Intronic
1117713974 14:58561975-58561997 AGATAATTCCCAAGGAAAGTTGG - Intergenic
1117754811 14:58963780-58963802 AGCCAGTTCTTAAGGTAAGTTGG - Intergenic
1117758414 14:59000202-59000224 AAATATTTCTTAACTAAAGTAGG - Intergenic
1118547770 14:66912745-66912767 ATGTACTTTTTAAGGAAAGATGG + Intronic
1119904459 14:78288920-78288942 ATATTGTTCTTATGGCAAGGTGG - Intronic
1121509718 14:94503354-94503376 ACATATTTCTTAAGGAATGAAGG - Intronic
1124524023 15:30431467-30431489 AAATAGTTCCTTAGAAAAGTTGG - Intergenic
1124534643 15:30534749-30534771 AAATAGTTCCTTAGAAAAGTTGG + Intergenic
1124764006 15:32472850-32472872 AAATAGTTCCTTAGAAAAGTTGG - Intergenic
1125034071 15:35103655-35103677 AGATAGTACTTAATGAATGTTGG - Intergenic
1125742361 15:41974147-41974169 ATTTTGCTCTTAAGGAAACTAGG - Intergenic
1126659927 15:51023054-51023076 ATAATGATCTTAAGGAAACTCGG - Intergenic
1127862447 15:63005576-63005598 ATATAACTCTTTAGGAAATTAGG - Intergenic
1128971849 15:72115035-72115057 ATATAGTTCCTGAGGGAAATTGG - Intronic
1136927883 16:34391207-34391229 ATATAATTTTTAAGAAAAATGGG + Intergenic
1136976691 16:35020599-35020621 ATATAATTTTTAAGAAAAATGGG - Intergenic
1138013413 16:53406270-53406292 TAAGAGTTCTTAAGGAAAGGTGG - Intergenic
1140143085 16:72278058-72278080 ATATAGTTTTGAAAGTAAGTAGG + Intergenic
1140189552 16:72803508-72803530 ATATTGTTCTGCAGGAAAATTGG - Intronic
1144552298 17:16251588-16251610 ATCTAGTTCTCAAGAAAAGAAGG + Intronic
1144637178 17:16917622-16917644 ATGTCATTCTTAAGGAGAGTTGG + Intergenic
1147053427 17:37815548-37815570 ATCTAGATCTTAAAGTAAGTTGG - Intergenic
1148173259 17:45541721-45541743 ATAGAAGGCTTAAGGAAAGTGGG - Intergenic
1148276008 17:46303730-46303752 ATAGAAGGCTTAAGGAAAGTGGG + Intronic
1148298123 17:46521305-46521327 ATAGAAGGCTTAAGGAAAGTGGG + Intronic
1148362662 17:47025775-47025797 ATAGAAGGCTTAAGGAAAGTGGG + Intronic
1150404466 17:64888638-64888660 ATAGAAGGCTTAAGGAAAGTGGG - Intronic
1153057140 18:957077-957099 AAATAGTACTTAAAGAATGTAGG - Intergenic
1159534751 18:69701792-69701814 ATATAGTTATTATGAAAAGGTGG + Intronic
926395863 2:12441520-12441542 ACATAGTAGTTAATGAAAGTTGG + Intergenic
926877202 2:17494564-17494586 ATAAATTTCTCAAGGAAACTGGG + Intergenic
926877321 2:17495859-17495881 AAATAGTTGTCAAGGAGAGTAGG - Intergenic
929324352 2:40589718-40589740 ATATAATTTTTAAGGAAGATGGG - Intronic
930332526 2:50003918-50003940 AAATAGTTCTAAATGAGAGTGGG - Intronic
931099532 2:58980684-58980706 ATTTAGCTCTTATGGAAAGAGGG + Intergenic
931967551 2:67550198-67550220 ATTTTGTACATAAGGAAAGTGGG + Intergenic
932679494 2:73812288-73812310 ATATAGATATTAATGAAAATTGG - Intronic
933136782 2:78746093-78746115 AAATTTTTCTTAAGGAAATTAGG - Intergenic
933439169 2:82288525-82288547 CCATAATTCTAAAGGAAAGTAGG - Intergenic
933449498 2:82429036-82429058 ATAAAGTTTTAAAGGTAAGTTGG - Intergenic
934863677 2:97786925-97786947 ATATAGTTCTGAAGGAAAAGGGG - Intronic
936225310 2:110644100-110644122 ATAGAGTATTTAAGGAATGTGGG + Intronic
937818588 2:126281794-126281816 ACATAATTCTTAAGGGATGTAGG - Intergenic
938599400 2:132821752-132821774 ATATAGTTCACCAGGGAAGTGGG - Intronic
938688858 2:133767927-133767949 ATATATTTGTTAAAGAAACTGGG - Intergenic
939084160 2:137697132-137697154 ATATAGTTGTCAGGGAAAGAGGG - Intergenic
939721330 2:145656177-145656199 ATATATGTATAAAGGAAAGTAGG - Intergenic
940387531 2:153090875-153090897 ATATAGTTTGCCAGGAAAGTGGG + Intergenic
940801519 2:158137868-158137890 ATCTAGTTCTAAAGGAAGGAGGG - Intergenic
941854569 2:170217770-170217792 ATATAGTTCTGTAGGCCAGTTGG - Intronic
942509075 2:176676569-176676591 ATTCATTTCTGAAGGAAAGTAGG - Intergenic
942822630 2:180133794-180133816 ATATAGTTCTTGAAGAAGGGTGG - Intergenic
943754388 2:191542616-191542638 ATATGGTTCTTAAAGACATTAGG - Intergenic
945785361 2:214228165-214228187 ACTAAGTTCTTAAGGAAAGTAGG - Intronic
946502394 2:220263433-220263455 ATCCAGTTCTTAAGAAATGTGGG + Intergenic
1170280524 20:14641836-14641858 ACATAGTTCTTAAGGAACCAAGG + Intronic
1170605295 20:17871013-17871035 ATTTAGTTGTCAAGGAAAGATGG + Intergenic
1170616665 20:17958440-17958462 ATACAGTGCTTAAGGAAAAAGGG - Intronic
1170620780 20:17994187-17994209 ATCTATTTCTTAAGTAAAATGGG - Intronic
1170904364 20:20499341-20499363 AATTATTTCTTAAGTAAAGTAGG - Intronic
1173701902 20:45079509-45079531 ACATAGTGCTTAAGAAAAGATGG - Exonic
1174693032 20:52528383-52528405 ATACAGTACTTAAGGAAAATGGG - Intergenic
1175449841 20:59054377-59054399 ATATAGCTCTTATTCAAAGTTGG + Intergenic
1177052034 21:16248373-16248395 ATATAGTTTTAAAGGAATTTAGG - Intergenic
1177055224 21:16293358-16293380 ATGAATTTATTAAGGAAAGTGGG + Intergenic
1179772130 21:43629143-43629165 ATGTAGTTCTTAAAAAAAATAGG - Intronic
1183178704 22:36244119-36244141 ATATAGTTCGCCAGGGAAGTGGG + Intergenic
949612183 3:5714337-5714359 ATGTAATTCTTAAAGAAAATTGG - Intergenic
950210939 3:11122613-11122635 ATAACGTTTTTAAGGAAATTGGG - Intergenic
952037746 3:29222988-29223010 GTAGAGTTCTCCAGGAAAGTAGG - Intergenic
952077675 3:29717531-29717553 ATATAGATATAAAGGAAAGTAGG - Intronic
952984906 3:38770509-38770531 ATAGAGTTCTCCAGGGAAGTGGG + Intronic
955277974 3:57566063-57566085 AAAAAGCTCTTAAGGAGAGTGGG - Exonic
956405145 3:68920858-68920880 ATATTGTTCTTAAAAAAATTAGG + Intronic
956815352 3:72903423-72903445 ATGTAAGTCTTAAGGAAAGGAGG + Intronic
956896276 3:73663591-73663613 ATCTAGTTCTTAAGCCACGTGGG + Intergenic
957244238 3:77697697-77697719 ATATAGCACGTAAGGAAAGTTGG + Intergenic
958819130 3:98952481-98952503 ATATAGTTTTCCAGGGAAGTTGG + Intergenic
960433187 3:117594973-117594995 GTATAGTTCTTAAGGGAGGGTGG + Intergenic
962508965 3:136079348-136079370 ATAATGTGCTTCAGGAAAGTGGG - Intronic
963016459 3:140828617-140828639 CTATAGTTGGTAGGGAAAGTGGG - Intergenic
963306275 3:143656977-143656999 ATACAATTTTTCAGGAAAGTGGG - Intronic
965684277 3:171285013-171285035 ACTTAGTTCTCAAGGAAAGAAGG - Intronic
966557201 3:181276030-181276052 ATATAGTTCATAAGGGAAGGAGG - Intergenic
967611432 3:191510388-191510410 ATAAATTGCTTAAGGAAATTGGG + Intergenic
968787722 4:2635839-2635861 ACATATTTCTTAAGAAGAGTGGG + Intronic
969734660 4:8978949-8978971 ATATTGTTCTTAATGTCAGTAGG - Intergenic
972554537 4:40168658-40168680 ATATATTTATTAAAGCAAGTAGG - Intergenic
974975791 4:68889386-68889408 ATATTGTGTTAAAGGAAAGTAGG + Intergenic
975203082 4:71614723-71614745 ATACAGGTCACAAGGAAAGTGGG - Intergenic
975430909 4:74289729-74289751 ATATAATTTTAAAGGAGAGTTGG + Intronic
977762734 4:100759076-100759098 ATATAGTTCACCAGGGAAGTGGG - Intronic
978699097 4:111621609-111621631 ATATAGATCTTAAAAAAAATTGG + Intergenic
978855013 4:113385067-113385089 ATATAGTTTTTAAGCAGAGGTGG - Intergenic
979767974 4:124485572-124485594 AAATGGTTCTTCAAGAAAGTTGG - Intergenic
979787014 4:124728697-124728719 ATATAGGTTTTAAGGGCAGTAGG - Intergenic
979994845 4:127418915-127418937 ATATAGTTCTTAGTGATATTTGG - Intergenic
980433411 4:132736090-132736112 TTATAATTCTTAAAGAAAATTGG + Intergenic
982414796 4:155117157-155117179 AAACAGTTCATAAGGAAATTTGG + Intergenic
983565605 4:169148141-169148163 ATACACTTTTTAAGCAAAGTTGG + Intronic
984198218 4:176685556-176685578 ATATAATTCTGTAGAAAAGTAGG + Intronic
984744568 4:183201943-183201965 TTATAGTTCTCAAGGGAAGGGGG + Intronic
986617906 5:9638880-9638902 ATATAGTTCACCAGGGAAGTGGG + Intronic
986764910 5:10916639-10916661 ATATGGTTAATGAGGAAAGTTGG + Intergenic
989564714 5:42890540-42890562 ATATATTTCTTAAAGAAACAGGG + Intergenic
990693727 5:58391994-58392016 ATAGAGTTCTGAAGGAGAGTTGG - Intergenic
991772327 5:70051628-70051650 AGATAGTTCTTTAGAAGAGTGGG + Intronic
991851620 5:70927046-70927068 AGATAGTTCTTTAGAAGAGTGGG + Intronic
994924723 5:106099968-106099990 TTATAGGTTTTAAGGTAAGTAGG - Intergenic
995033891 5:107511970-107511992 AGCAAGATCTTAAGGAAAGTAGG - Intronic
995409234 5:111835815-111835837 ATAAAGTTCATAGGGAAATTAGG + Intronic
995434429 5:112119879-112119901 ATACATTTGTTAAGGAATGTAGG + Intergenic
997046589 5:130326385-130326407 ATATACATCTTTAGGAAAGGTGG + Intergenic
998507459 5:142683524-142683546 ATATAGTAATTAAGAAAATTAGG + Intronic
998703510 5:144732320-144732342 ATATAGTTCACCAGAAAAGTGGG + Intergenic
999565360 5:152854182-152854204 ATCTAGTTCTTAGGGAAACATGG + Intergenic
1000813753 5:165894047-165894069 ATTTAGTTCTTCATGAAATTGGG - Intergenic
1002778183 6:346535-346557 AGAGAGTTCTTAGTGAAAGTGGG + Intronic
1002781979 6:373991-374013 AAATAGCTCTTAAGGAAATAAGG - Intergenic
1003639866 6:7867597-7867619 TTCTAGTTCTCCAGGAAAGTTGG + Intronic
1003829018 6:9985341-9985363 AGAAAGTTTTTAAAGAAAGTTGG - Intronic
1004559146 6:16730606-16730628 ACATGGTTCCTAAGGAAGGTGGG - Intronic
1005259486 6:24042780-24042802 ATATAGTTCACCAGGAAAATGGG + Intergenic
1006688248 6:35856030-35856052 ATATAGTTTTAGATGAAAGTTGG + Intronic
1006954390 6:37854603-37854625 ATAGAGTTCTTAAGGAAGAAAGG - Intronic
1007349471 6:41258433-41258455 TTATAGTTCATCAGGGAAGTGGG - Intergenic
1008380270 6:50833336-50833358 TTATGGATCTAAAGGAAAGTTGG + Intronic
1010538895 6:77067150-77067172 ATATAATTCATAATGAAAATGGG - Intergenic
1011674141 6:89714924-89714946 ACACAGTTCCTTAGGAAAGTAGG - Intronic
1011917603 6:92527299-92527321 ATAATGATCTTAAGGAAACTAGG + Intergenic
1012485058 6:99711896-99711918 ATATTGTTCTTATGAAAAGTGGG + Intergenic
1013732160 6:113181069-113181091 ACATAGCTATTAAGTAAAGTTGG + Intergenic
1014808877 6:125863022-125863044 TTTTAGTTTTTAAGTAAAGTAGG - Intronic
1015527216 6:134185174-134185196 CTAAAGTTCTTGAGGAAAGTTGG - Intronic
1016355899 6:143217907-143217929 ATATAGCCCTTCTGGAAAGTAGG - Intronic
1016622664 6:146130376-146130398 ATAAATTTCTTAAGAAAAATAGG + Intronic
1017757773 6:157544159-157544181 ATACAGTTTTGAAGGAAACTAGG - Intronic
1020734525 7:11930906-11930928 ATCCAGTTGTTAAGGACAGTTGG + Intergenic
1025948949 7:66128245-66128267 ACATAGTACTTCAGGAAAGCTGG + Intronic
1028169988 7:87584615-87584637 ACACAGCTCTCAAGGAAAGTGGG - Intronic
1029033807 7:97496959-97496981 ATAAAATACTTGAGGAAAGTAGG + Intergenic
1029902546 7:104056931-104056953 ATCTAGGTCTAAAGGAAAGTTGG + Intergenic
1030010134 7:105157580-105157602 ATATTTTTCTTAAAGAAAGATGG + Intronic
1030226893 7:107162756-107162778 ATATAGTTTTTAAGGAATGCTGG + Intergenic
1030574946 7:111273914-111273936 ATATAGTTCTTAATAAAAAATGG - Intronic
1030603311 7:111612979-111613001 ATTTATTTCTCAAGGATAGTGGG - Intergenic
1031051100 7:116946578-116946600 ATAGAGTAATTAAAGAAAGTGGG + Intergenic
1031264330 7:119565123-119565145 ATATAGTTCTCCAGGTTAGTGGG - Intergenic
1031608069 7:123793273-123793295 AAATTGTTCTTAAGCAAAGAAGG - Intergenic
1032480324 7:132240852-132240874 ATATATTTCTTAAGGGAATTTGG + Intronic
1033108199 7:138550063-138550085 AAATAGTTATTTAAGAAAGTAGG + Intronic
1034108394 7:148511948-148511970 ATCTAGTTCTTAAAGAAACTGGG + Intergenic
1037956295 8:23063040-23063062 ACATGGATCTTAAGGAAAGAAGG - Intronic
1040892648 8:52333720-52333742 CAATAGTTTTTAATGAAAGTAGG - Intronic
1042607961 8:70565496-70565518 ATATAGCTCACCAGGAAAGTGGG - Intergenic
1042851618 8:73222514-73222536 GTATAATTCTTAAGGACCGTAGG + Intergenic
1043537836 8:81225942-81225964 ATATAGTTCACTAGGGAAGTAGG + Intergenic
1043575980 8:81657192-81657214 ATATAGGTTTTTAGAAAAGTTGG + Intergenic
1044173107 8:89081587-89081609 GTATAGTTCTAAGGGAAATTTGG - Intergenic
1044731815 8:95234747-95234769 ATATTTTTCTTAACGAAAATGGG - Intergenic
1044987035 8:97764942-97764964 GTATATTTCCTGAGGAAAGTGGG - Intergenic
1045665117 8:104476589-104476611 AAATAGATGTTAAGGAAAGGGGG - Intergenic
1046072343 8:109272306-109272328 ATACAGTTTTTAAAGATAGTTGG + Intronic
1046996124 8:120525415-120525437 ATATAGTGCTTAATAAATGTTGG - Intronic
1052468449 9:28861444-28861466 ATATAGTTCTCACAGAAATTAGG + Intergenic
1052666872 9:31506740-31506762 ATATAGGTATCATGGAAAGTGGG + Intergenic
1053525596 9:38826956-38826978 ATATATTTCTTATTGAATGTGGG + Intergenic
1053754437 9:41289990-41290012 ATATAATTATTGGGGAAAGTTGG + Intergenic
1054197826 9:62051383-62051405 ATATATTTCTTATTGAATGTGGG + Intergenic
1054259955 9:62854325-62854347 ATATAATTATTGGGGAAAGTTGG + Intergenic
1054331814 9:63765683-63765705 ATATAATTATTGGGGAAAGTTGG - Intergenic
1054640528 9:67536989-67537011 ATATATTTCTTATTGAATGTGGG - Intergenic
1056724650 9:89104041-89104063 AGATGGTTCTCAAGGAGAGTAGG + Intronic
1058089127 9:100784092-100784114 ATTTATTTCTTAAAGAAACTGGG + Intergenic
1059870217 9:118564595-118564617 ATATAGTTCTTTCAGGAAGTGGG - Intergenic
1186766893 X:12779837-12779859 AGATAGTTGTTATGGTAAGTTGG + Intergenic
1188564888 X:31515409-31515431 ATAAAATTCTTAAGGAGATTTGG - Intronic
1189639347 X:43050994-43051016 ATATAGTTCACCAGGGAAGTGGG + Intergenic
1189808348 X:44757644-44757666 ATAGAGTTTTTCAGGAAAGTTGG + Intergenic
1190639818 X:52473503-52473525 TTGAAGTGCTTAAGGAAAGTTGG - Intergenic
1190647854 X:52539363-52539385 TTGAAGTGCTTAAGGAAAGTTGG + Intergenic
1190650898 X:52567641-52567663 TTACAGTACTTAAGGAAAGTTGG + Intergenic
1192779559 X:74280368-74280390 ACATAGTGATTAAGGTAAGTAGG - Intergenic
1193169253 X:78316611-78316633 ATATAGTTCACAAGAGAAGTGGG - Intronic
1193255356 X:79342434-79342456 ATATATTTCATCAGAAAAGTGGG - Intergenic
1194846488 X:98815648-98815670 AAAAAGTTCTTAAAGAAAATTGG - Intergenic
1198691377 X:139288544-139288566 ATGTAGTGCTTAAGAAAAGCAGG + Intergenic
1198797297 X:140410695-140410717 ACACAGTTCATCAGGAAAGTGGG + Intergenic
1201351558 Y:13048763-13048785 ATAAAATTCTTAAAGAAACTGGG + Intergenic