ID: 1109242045

View in Genome Browser
Species Human (GRCh38)
Location 13:59901435-59901457
Sequence GGTAAGAGTTGAGCAGAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 275}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109242045 Original CRISPR GGTAAGAGTTGAGCAGAAGC CGG (reversed) Intronic
900342963 1:2197341-2197363 GGGCAGAGCCGAGCAGAAGCAGG + Intronic
900721502 1:4178824-4178846 TGGAAGAGTGGAGCAGAAGAAGG + Intergenic
901029287 1:6297518-6297540 GGTAGGAGCTGAGCAGCAGGGGG - Intronic
901713308 1:11133065-11133087 GGTACAAGGTGATCAGAAGCAGG - Exonic
901757828 1:11452075-11452097 GGTAACTGTAGAGCAGAAGCAGG + Intergenic
901844821 1:11975130-11975152 GGTGAGACTTGAGCAGAACAGGG + Exonic
904117625 1:28174249-28174271 GGCAACAGTGGAGCAGGAGCCGG - Intronic
905780481 1:40704600-40704622 GGTAAGTGTTGATGAGAAGTAGG + Intronic
906267216 1:44441650-44441672 GGAAAGAATTGAGGAGCAGCTGG + Intronic
906807664 1:48794932-48794954 GGAAACAGTTCAGGAGAAGCAGG - Intronic
906983792 1:50660809-50660831 AGTAACAGTTGAGCAGAACTAGG - Intronic
907857010 1:58313459-58313481 GGAGAGAGTTGAGGAGAAGAAGG - Intronic
909200314 1:72683810-72683832 AGCAGGAGATGAGCAGAAGCAGG + Intergenic
909214252 1:72866109-72866131 GGAAAGAATGGACCAGAAGCAGG - Intergenic
909602594 1:77476506-77476528 GCTAAAAGTGGAGCTGAAGCTGG - Intronic
909685712 1:78346317-78346339 GGTAGTAGCTGAGCAGAAACTGG + Intronic
911790236 1:102005752-102005774 GGAAAGAGATGATCAGAAGCTGG - Intergenic
912245319 1:107956066-107956088 GGTAAGAGTGAAGGAGAAACTGG + Intronic
913187805 1:116385828-116385850 TGTAAGAGTAGAGAAGAGGCCGG + Intronic
913496491 1:119432735-119432757 GGACAGAGTTGAACTGAAGCAGG + Intergenic
913501325 1:119475261-119475283 GGACAGAATTGAGCGGAAGCAGG + Intergenic
913509225 1:119547304-119547326 GGACAGAGTTGAACTGAAGCGGG + Intergenic
913512373 1:119573524-119573546 GGACAGAGTTGAACTGAAGCAGG + Intergenic
913516654 1:119611032-119611054 GGACAGAGTTGAACTGAAGCAGG + Intergenic
915139738 1:153759885-153759907 AGTAATAGGTGAGGAGAAGCAGG - Intronic
917731471 1:177879245-177879267 TATAAGAGCTGAGCAGAAACAGG + Intergenic
917736588 1:177926757-177926779 TGCAAGACTTGAGGAGAAGCTGG - Intronic
918416508 1:184314084-184314106 GTTGAGAATTGAGCAGAAGGTGG - Intergenic
919966691 1:202533910-202533932 GGTAAAAGTAGAGGAGAAACTGG - Intronic
921116236 1:212093883-212093905 GGGAAGTGTTGGGCAGAAGAAGG - Intronic
922608179 1:226904167-226904189 GGTAAAAGCAGAGCAGCAGCTGG - Intronic
923704630 1:236334017-236334039 GGTTACAGCTGAGCTGAAGCTGG - Intergenic
924092125 1:240511989-240512011 GGCAGAAGTTAAGCAGAAGCAGG + Intronic
1063388791 10:5634939-5634961 GGTAAGACCAGAGGAGAAGCAGG - Intergenic
1065986101 10:30953703-30953725 GACCAGAGGTGAGCAGAAGCTGG + Intronic
1067007680 10:42680312-42680334 GGGAAGATTTGGGTAGAAGCAGG - Intergenic
1067723598 10:48749619-48749641 GGTGAAAGTGGAGCAGAAGCAGG + Intronic
1068705749 10:60073589-60073611 GATATGAGTTGAGCAGAACTAGG + Exonic
1070066601 10:73041185-73041207 TGTAGCATTTGAGCAGAAGCAGG + Intronic
1070662491 10:78317381-78317403 GGTAGGTTTTAAGCAGAAGCAGG - Intergenic
1071310297 10:84336991-84337013 GGTAAGAGCGCAGAAGAAGCAGG + Intronic
1071787299 10:88916041-88916063 GATAAGAGTTGAGAGGAAGAGGG - Intronic
1072010364 10:91298213-91298235 GGTAAGACTTGAGATGAACCGGG + Intergenic
1073455816 10:103636110-103636132 GGAAAGAGTAGAGATGAAGCTGG + Intronic
1077458768 11:2698445-2698467 GATGAGAGTTGATCAGATGCAGG - Intronic
1077812355 11:5651013-5651035 AGTAAGATTTGAGTGGAAGCTGG - Intergenic
1078017271 11:7625642-7625664 GAGAAGAGGTGAGCAGGAGCAGG - Intronic
1079364678 11:19799004-19799026 GAGAAGAGGTGAGCAGAGGCTGG + Intronic
1080654170 11:34245619-34245641 GGCATGAGATGAGCAGGAGCTGG + Intronic
1080661139 11:34296932-34296954 GGTCAGAGCTGTGCAGAAGTTGG - Intronic
1081649854 11:44816636-44816658 GGAATGAGTTGATGAGAAGCTGG + Intronic
1081808081 11:45900815-45900837 GGTGAAAGTGGAGCAGGAGCAGG + Intronic
1082162756 11:48901864-48901886 GGTGAGCGTTGAGAAGACGCAGG - Intergenic
1082260359 11:50073058-50073080 GGTATGAGTTGGGCTGAAACAGG + Intergenic
1085023488 11:73223299-73223321 GATAAGATTTGAGGAGGAGCAGG - Intronic
1085347940 11:75780234-75780256 GGGAGGAGTCCAGCAGAAGCTGG - Intronic
1086505060 11:87496105-87496127 GGTAAGTCTTCAGCAGAAACAGG + Intergenic
1088522980 11:110719221-110719243 GGTAAGAGTTTACTAGGAGCTGG + Intergenic
1089061486 11:115629609-115629631 GCTAAGAGCAGAGCAGAAGTGGG - Intergenic
1091091766 11:132777706-132777728 GGAAAGAGTGGAGCAGGAGGTGG + Intronic
1092233206 12:6789374-6789396 GGAAAAAGTTAAGCAGAATCAGG - Intronic
1093223727 12:16454911-16454933 GGGAAGATTTGAGGAGAACCAGG + Intronic
1093658294 12:21723310-21723332 TGTAAGAGTTGAACAGATGGAGG + Intronic
1093859168 12:24142239-24142261 GGGGAAAGTTGAGGAGAAGCGGG - Intergenic
1094367472 12:29699195-29699217 GGTAACAGTTGTGCAGAGGAAGG + Intronic
1095635513 12:44428771-44428793 GGTGACATTTGAGCAGAATCAGG + Intergenic
1095946819 12:47758515-47758537 GGTCAGGGTTGAGGAGGAGCAGG - Intronic
1095990722 12:48032739-48032761 GGTGACTGTTGAGCAGGAGCAGG + Intergenic
1100774408 12:97958509-97958531 AGTAAGAGAGGAGGAGAAGCAGG + Intergenic
1102243222 12:111338474-111338496 GGTAAGACTTGGGCAGAGGATGG + Exonic
1102936271 12:116899644-116899666 GGTAAGAGTTAGGCAGGTGCCGG + Intergenic
1104013774 12:124949386-124949408 GGCAGGAGGAGAGCAGAAGCAGG + Intronic
1105823499 13:24100842-24100864 GGCAAGAGTTCACCAGAAGGAGG - Intronic
1105828683 13:24144858-24144880 GGAAAGCTTTGAGCAGAAACTGG - Intronic
1106296454 13:28418358-28418380 AGTTAGAGTTGAGCAGAGGATGG - Intronic
1107128858 13:36873564-36873586 AGTAAAAGATGAGCAGCAGCAGG + Intronic
1107359887 13:39606925-39606947 GGTGAAAGGAGAGCAGAAGCAGG - Intergenic
1109024772 13:57143055-57143077 GGGAGGAGTGGAGCAGAAGTGGG - Exonic
1109025759 13:57149625-57149647 GGGAGGAGTGGAGCAGAAGTGGG - Exonic
1109026749 13:57156198-57156220 GGGAGGAGTGGAGCAGAAGTGGG - Exonic
1109027741 13:57162769-57162791 GGGAGGAGTGGAGCAGAAGTGGG - Exonic
1109028727 13:57169334-57169356 GGGAGGAGTGGAGCAGAAGTGGG - Exonic
1109029361 13:57173699-57173721 GGGAGGAGTGGAGCAGAAGTGGG - Intergenic
1109242045 13:59901435-59901457 GGTAAGAGTTGAGCAGAAGCCGG - Intronic
1113337046 13:109386607-109386629 GGAAGGGGTTGAGCAGAGGCAGG + Intergenic
1114472743 14:22974903-22974925 GGGAAGAGATGAGCTGAGGCTGG + Intronic
1116762457 14:49031602-49031624 GTTAAGAATTGAGCAAAACCAGG - Intergenic
1117221381 14:53609967-53609989 AGGAAGAGTTGAGCAGAAATTGG - Intergenic
1118443781 14:65834231-65834253 CGAAAGAGTGGAGCAGAAGTGGG - Intergenic
1119492952 14:75052238-75052260 ATTAAGAGTTGAGCAAAGGCCGG - Intergenic
1119549366 14:75497193-75497215 GGAGGGAGATGAGCAGAAGCAGG + Intergenic
1119788141 14:77327773-77327795 GGCTTGAGCTGAGCAGAAGCAGG + Intronic
1120631800 14:86900670-86900692 GGTAATATTTCAGAAGAAGCCGG + Intergenic
1122218796 14:100222227-100222249 GGTGAGTGATGAGCGGAAGCTGG + Intergenic
1122480532 14:102044372-102044394 GGAAGGTGTTGAGCAGACGCTGG - Exonic
1122539083 14:102486871-102486893 GGGAAGAATAGACCAGAAGCAGG + Intronic
1122910523 14:104825793-104825815 GGGAATATTTGAGCAGAGGCAGG + Intergenic
1126715922 15:51517527-51517549 GGCAAGGGTTGAGAAGAAGTGGG + Intronic
1126798652 15:52280975-52280997 GGTAACAGGGGAGCAGGAGCTGG - Intronic
1129528082 15:76235538-76235560 GGAAAGAGTTGAGCAGCACTGGG + Intronic
1130560915 15:84958294-84958316 GGTGACAGCTGAGCAGCAGCAGG - Intergenic
1133508650 16:6436611-6436633 AGTAAGTGTTGAGAAGAAACTGG - Intronic
1135407049 16:22206269-22206291 GGTCTAGGTTGAGCAGAAGCGGG - Exonic
1135784227 16:25334059-25334081 GGTGAGAGTTGAGTAGAGGCAGG - Intergenic
1137246585 16:46711017-46711039 GGAAAGAGGTGAGCACAAGAGGG - Intronic
1137759144 16:50926694-50926716 GGTAAGGGATCAGCAGCAGCAGG - Intergenic
1139434405 16:66927752-66927774 GGAGAGAGTGGAGCAGAAACAGG - Intergenic
1141424287 16:83935360-83935382 GGTAAGAGTCAATCAGGAGCAGG + Intronic
1141767803 16:86070262-86070284 GGGCAGAGTTTAGAAGAAGCCGG + Intergenic
1143789345 17:9281311-9281333 TGTAGGGGCTGAGCAGAAGCAGG + Intronic
1143920939 17:10330592-10330614 CCTCAGAGTTGAGCAGAAACAGG - Intronic
1144860920 17:18301374-18301396 GGTAACACTTGAGCAGAGGCTGG - Intronic
1146587584 17:34095578-34095600 GGGAAGAGTTGGGGAGAAGCAGG + Intronic
1146833116 17:36087681-36087703 GGTAAGATTTGAGTATAGGCGGG + Intergenic
1146847641 17:36194303-36194325 GGTAAGATTTGAGTATAGGCGGG + Intronic
1147134433 17:38427081-38427103 GGAAAGAGGTAAGCATAAGCTGG + Intergenic
1147376943 17:40027980-40028002 GGCATGAGCTGAGCAGTAGCTGG + Intronic
1149272390 17:54994377-54994399 GGGAAGAGTTGAGCAGAATATGG - Intronic
1150209016 17:63431397-63431419 AGTAGGAGGTGAGCAGCAGCGGG + Intergenic
1150717854 17:67587086-67587108 GGAAACAGTGGAGGAGAAGCAGG + Intronic
1152193347 17:78902055-78902077 GCTAAGAGTTGGGGAGAAGAGGG - Intronic
1152684461 17:81687288-81687310 GGTCAGGGTTTAGCAGGAGCCGG + Intronic
1152864190 17:82712563-82712585 GCTGAGAGCTGAGCAGATGCTGG - Intergenic
1154974126 18:21440388-21440410 GGTAAGATTTTAACAGAAGATGG + Exonic
1157298016 18:46459750-46459772 GGGAAGAGTGGAGAAGAGGCAGG + Exonic
1157684129 18:49629241-49629263 GGGAACAATTGGGCAGAAGCAGG + Intergenic
1157696315 18:49726442-49726464 GCCAGGAGCTGAGCAGAAGCTGG - Intergenic
1159582161 18:70245629-70245651 GGCAACATTTGAGCAGAAACAGG - Intergenic
1159756820 18:72376109-72376131 GGTAGGAGATGGGCTGAAGCAGG + Intergenic
1161246647 19:3256276-3256298 GGTCAGGGATGAGCAGAAGGAGG - Intronic
1163567054 19:18058198-18058220 GGAACGGCTTGAGCAGAAGCTGG + Intergenic
1163750061 19:19071445-19071467 GGTCAGTCTTGAGGAGAAGCTGG + Intronic
1165304746 19:34996508-34996530 AGTAAGAGTGGAGGGGAAGCCGG + Intronic
1202646217 1_KI270706v1_random:144451-144473 GGGAAGATTTGGGTAGAAGCAGG - Intergenic
925734166 2:6945870-6945892 GGAAAGAGATGAGGAGAACCTGG + Intronic
926181976 2:10652685-10652707 GATAAGAAGTGAGCAGGAGCTGG - Intronic
926549482 2:14284302-14284324 AGAAAGAGATGAGCAGAATCTGG + Intergenic
926656211 2:15409715-15409737 GGTAATAGATGATCAGATGCAGG - Intronic
926823146 2:16875712-16875734 GGTAAGAGATGTGCAGAACAGGG - Intergenic
928378465 2:30798317-30798339 GGAAATGGTTGAGCAGAGGCTGG + Intronic
928498148 2:31856591-31856613 GGGAAGAATTGGGTAGAAGCTGG + Intergenic
928737128 2:34304838-34304860 GGTGAGAGTTGAGAATAAGTAGG + Intergenic
931171383 2:59807268-59807290 GGTGAGAGGTGAGCAGAAAGAGG - Intergenic
931644925 2:64413359-64413381 GGTAATAGTTGAAGAGCAGCAGG + Intergenic
931816640 2:65909756-65909778 GATAAGATTTGAGCAAAACCTGG - Intergenic
932292744 2:70596320-70596342 GGTAGGATTTGAGCAGCGGCTGG - Intergenic
932435442 2:71700409-71700431 GGTAAGAACTGAGGAAAAGCTGG + Intergenic
932703328 2:74005108-74005130 GGAAAGAGCTGAAGAGAAGCGGG - Intronic
933992083 2:87640987-87641009 GGTAAGAGGTGAGGAGGAGAAGG + Intergenic
934325364 2:92009201-92009223 GCTAAGCTTTGAGCAGCAGCAGG + Intergenic
934509352 2:94924878-94924900 GGGAAGATTTGGGTAGAAGCAGG - Intergenic
934886420 2:98029379-98029401 CGTACAAGTTGAGCAAAAGCAGG - Intergenic
936301760 2:111309831-111309853 GGTAAGAGGTGAGGAGGAGAAGG - Intergenic
936970890 2:118175274-118175296 GGTGAGAGTTGAGAAAAGGCAGG + Intergenic
938409850 2:131054967-131054989 TGTAAGACTTGAGTAGAAGGAGG - Intronic
939668180 2:144976618-144976640 GGTAACAGTTGCCCTGAAGCAGG + Intergenic
945884542 2:215361404-215361426 GCTGTGAGTTGAGCTGAAGCTGG + Exonic
945984716 2:216344433-216344455 GCTAAGACTTCACCAGAAGCAGG + Intronic
946087762 2:217191483-217191505 AGTAAGAGTTAAGGAGAAGAGGG - Intergenic
946111676 2:217425151-217425173 GCTAACAGTTGAGCAGAGACCGG - Intronic
946165118 2:217858978-217859000 GGTGAGAGTTGAGCAGGGGCTGG - Intronic
946443002 2:219712776-219712798 GGTAAGAGTGGAAAAGAAGGTGG + Intergenic
946735028 2:222745375-222745397 GATTAGAGATGAGCAGAGGCTGG - Intergenic
947048504 2:226016526-226016548 CGTAACATTTGAGCAGAAACAGG - Intergenic
947868919 2:233421609-233421631 GGGAAGGGCTGAGCAGAAGCAGG - Intronic
948212266 2:236203531-236203553 GGTATGAGTGGAGGAGAGGCTGG + Intronic
948997036 2:241586329-241586351 AGTAAGAGTTAACCAGAAACAGG + Intronic
1170200532 20:13738609-13738631 TGTAAGAGTTTAGGAGAGGCTGG - Intronic
1170859276 20:20087787-20087809 GGTCACAGCTGGGCAGAAGCAGG + Intronic
1174017744 20:47502228-47502250 GGTAGGAGCTGAGACGAAGCTGG + Intronic
1174076188 20:47938964-47938986 AGTAAGAGTTCACCAGAAGTGGG + Intergenic
1174977006 20:55347198-55347220 GCTGAGAGTGGGGCAGAAGCTGG - Intergenic
1175140037 20:56854157-56854179 GATAACATTTGAGCAGAAACTGG - Intergenic
1175302325 20:57951645-57951667 GCTGAGAGATCAGCAGAAGCTGG - Intergenic
1175862890 20:62159597-62159619 GGTAACAGCTAAGCGGAAGCTGG - Intronic
1176605657 21:8828310-8828332 GGGAAGATTTGGGTAGAAGCAGG + Intergenic
1177253230 21:18624073-18624095 GGTAAGAATTGAGGAGTATCAGG + Intergenic
1178379306 21:32094536-32094558 GGGAAGAATTGAGGAGAAGAGGG - Intergenic
1180347954 22:11719914-11719936 GGGAAGATTTGGGTAGAAGCAGG + Intergenic
1180355732 22:11838016-11838038 GGGAAGATTTGGGTAGAAGCAGG + Intergenic
1180382523 22:12154309-12154331 GGGAAGATTTGCGTAGAAGCAGG - Intergenic
1181298720 22:21863662-21863684 TGTAAGAGGGGAGCAGGAGCTGG - Intronic
1183280109 22:36927495-36927517 GGTAACAGCTGTGCAGAGGCTGG + Intronic
1184454406 22:44600989-44601011 GGTCAGGGTTGAGCTGACGCAGG - Intergenic
1184559113 22:45251314-45251336 GGTAAGCGCTGAGAAGAAGGCGG + Intergenic
949940663 3:9151850-9151872 GGTCAGAGATAAGCAGAAGCAGG + Intronic
950567040 3:13775747-13775769 GGTATGAGGAGAGGAGAAGCAGG - Intergenic
951031010 3:17881723-17881745 GCTAAGAGATGAGCAGATGAAGG + Intronic
951319111 3:21223737-21223759 GGTTGGAGTGGAGCAGATGCAGG - Intergenic
954263325 3:49455543-49455565 AGGAAGAGTTCAGCAGTAGCAGG - Intergenic
957170318 3:76730251-76730273 AGTAGGAGGTGAGGAGAAGCGGG - Intronic
957170332 3:76730307-76730329 AGTAGGAGGTGAGGAGAAGCGGG - Intronic
957170354 3:76730391-76730413 AGTAGGAGGTGAGGAGAAGCGGG - Intronic
957170375 3:76730475-76730497 AGTAGGAGGTGAGGAGAAGCGGG - Intronic
957170382 3:76730503-76730525 AGTAGGAGGTGAGGAGAAGCGGG - Intronic
957170494 3:76730951-76730973 AGTAGGAGGTGAGGAGAAGCGGG - Intronic
959166756 3:102789712-102789734 GATAAGATTTGAGCAGAAAGGGG - Intergenic
960973056 3:123152769-123152791 AGGAAGAGCTGTGCAGAAGCTGG - Intronic
963312993 3:143728988-143729010 GGTAGAAGATGAGCTGAAGCAGG - Intronic
963831722 3:150016028-150016050 GTGAAGAGCTGAGCAGAAGTGGG + Intronic
964888087 3:161507896-161507918 GGGAAGAGTTGAGCAACAGGTGG - Intergenic
965001929 3:162965381-162965403 GGTAAAAGGTGAAAAGAAGCAGG + Intergenic
965704722 3:171494774-171494796 GGTTGGAGTGGAGGAGAAGCAGG + Intergenic
969606229 4:8203634-8203656 GGTAGGAGTTGCGGAGATGCTGG - Intronic
973372452 4:49262679-49262701 GGGAAGATTTGGGTAGAAGCAGG - Intergenic
973388549 4:49532462-49532484 GGGAAGATTTGGGTAGAAGCAGG + Intergenic
975792454 4:77968670-77968692 AGTAAGACATGAGAAGAAGCAGG + Intergenic
976175404 4:82346995-82347017 GGTAAGGGTTGATTATAAGCTGG - Intergenic
978406383 4:108383367-108383389 GGGAGGAGGTGAGCAGAAGCTGG + Intergenic
981002118 4:139838021-139838043 GGAAAGGCTTGAGCATAAGCTGG + Intronic
981043820 4:140247859-140247881 GGAGAGACTTGAGCACAAGCTGG + Intergenic
981949896 4:150393448-150393470 GGGAAGAGGTGAGGAGAAGGAGG - Intronic
983874514 4:172861192-172861214 GGTGAGATTTGAGGATAAGCTGG + Intronic
984175117 4:176407867-176407889 GGTCTGAGTTCAGCAGAGGCTGG - Intergenic
984887151 4:184459866-184459888 GGTAAAAGGTGTGGAGAAGCTGG + Intronic
985410336 4:189676731-189676753 GGAAAGAGTTGTGCAGAAAAGGG - Intergenic
986164522 5:5262336-5262358 GGAAAGAGTAGAAAAGAAGCAGG + Intronic
986462133 5:7983332-7983354 GGTTAGGGGTGTGCAGAAGCAGG - Intergenic
987033117 5:13994041-13994063 GGTCAGAGGTGAGCAGAGGACGG - Intergenic
989267909 5:39499029-39499051 TGTAAGAGTAGAGCACAGGCAGG + Intergenic
989807750 5:45631438-45631460 GGTATGAGATGACAAGAAGCAGG + Intronic
991956318 5:71998796-71998818 GGTAAGAATAGAGGAGAAGGAGG + Intergenic
996234746 5:121111634-121111656 AGTAAGTGTTGAGAAGAACCAGG + Intergenic
997173917 5:131754337-131754359 GATAAGAGGTGTGCATAAGCAGG + Intronic
997287305 5:132689834-132689856 GGTAAGAGTTTTACATAAGCTGG + Intergenic
997917106 5:137938122-137938144 TGTCATAGTTGAGCAGTAGCTGG - Exonic
998410200 5:141904212-141904234 GGGAAGAGTAGACCAGAAGGAGG + Intergenic
1001007566 5:168067253-168067275 GGTAAGACAGGAGCAGATGCTGG + Intronic
1002683292 5:180986510-180986532 GGGAAGAGGTGATCAGGAGCAGG + Intergenic
1002683299 5:180986541-180986563 GGGAAGAGGTGATCAGGAGCGGG + Intergenic
1002683306 5:180986572-180986594 GGGAAGAGGTGATCAGGAGCGGG + Intergenic
1004629531 6:17408234-17408256 GGCAAGAGTTGAAGGGAAGCTGG + Intronic
1005515236 6:26548422-26548444 GGGAATAGTTGAGCAGATGAAGG - Intergenic
1006626912 6:35404122-35404144 GGTAAGACTGGACCAGGAGCTGG - Intronic
1006931864 6:37693589-37693611 GCTATGAGAGGAGCAGAAGCCGG + Intronic
1007623628 6:43229696-43229718 GGGAGGAGGGGAGCAGAAGCGGG - Intergenic
1011097334 6:83680921-83680943 GGTAAGTATTGATCACAAGCTGG - Intronic
1011475078 6:87743732-87743754 GGGAAGAAATGAGCAGAACCTGG + Intergenic
1011650726 6:89503951-89503973 GGTAAGTGGGGAGCAGACGCTGG + Intronic
1013226371 6:108121664-108121686 GGCTAGAGATGGGCAGAAGCTGG - Intronic
1014177210 6:118343673-118343695 AATAAAAGTTGAGGAGAAGCAGG + Intergenic
1014256921 6:119169779-119169801 GGTAAGAGGTGAGGGGAAGGAGG + Intergenic
1017611269 6:156188833-156188855 GGTGAGAGGTGGGCAGCAGCAGG + Intergenic
1020424438 7:8048197-8048219 GGTAAGAGATGTGCAGAACAGGG - Intronic
1020433966 7:8142257-8142279 GGTGAGAGTTGAGTAGGAGATGG - Intronic
1020691649 7:11362208-11362230 GGTAAGTGATGAGCACGAGCTGG + Intergenic
1021497245 7:21289535-21289557 GGTAATATTTGAGCAAAAACTGG + Intergenic
1022298934 7:29084231-29084253 GGTAGGAGCTGAGCAGAAAGAGG - Intronic
1023608361 7:41950050-41950072 GGTAGCAGTGGAGCAGCAGCAGG + Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1025787341 7:64655662-64655684 GGCAAGATTCAAGCAGAAGCGGG - Intergenic
1025910037 7:65820795-65820817 GGGAAGATTTGGGTAGAAGCAGG + Intergenic
1030147185 7:106368574-106368596 GGTTAGAGTTCAACAGCAGCAGG + Intergenic
1032459544 7:132100382-132100404 GGTTAGAGGTGAGGGGAAGCAGG - Intergenic
1033535653 7:142309576-142309598 GGAAAGTGTTGAGGAGATGCCGG + Intergenic
1033605063 7:142920968-142920990 GGAAAGAGATGAGGAGAACCAGG - Intronic
1033672404 7:143505582-143505604 GGTTAAATTTAAGCAGAAGCAGG + Intergenic
1037344685 8:17886278-17886300 GGTAAGAGTTAAGAAGGAGTTGG + Intronic
1038145326 8:24889466-24889488 GGGAAGAATTGAGGAGAAGCAGG + Intergenic
1039912286 8:41834885-41834907 GGCAAGAGGTGAGCAGTAGGCGG - Intronic
1041398762 8:57419270-57419292 GGATAGAGATGAGCATAAGCGGG + Intergenic
1044641415 8:94385822-94385844 TGTAAGAGCAGAGCAGAAGTGGG + Intronic
1046576748 8:116039447-116039469 GGTCAGAGGTTAGAAGAAGCAGG + Intergenic
1047364064 8:124196066-124196088 AGTAGGAGTGAAGCAGAAGCAGG - Intergenic
1049678895 8:143906720-143906742 GAAAAGAGTTTAGCAGATGCAGG - Intergenic
1050290754 9:4151896-4151918 GGTAAGAGTTGAGCCCAAGGAGG - Intronic
1054352445 9:64029416-64029438 GGGAAGATTTGGGTAGAAGCAGG + Intergenic
1055147128 9:72949283-72949305 GGGAACAGCTGAGCAGCAGCTGG + Intronic
1055671443 9:78610479-78610501 GTTAAGAGTTCAGCCAAAGCTGG - Intergenic
1057908804 9:99002510-99002532 GGTAGGAGATGGGCAGGAGCTGG + Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1062547625 9:137070742-137070764 GGCCAGAGTGGAGCAGGAGCTGG - Intergenic
1203553051 Un_KI270743v1:180318-180340 GGGAAGATTTGGGTAGAAGCAGG + Intergenic
1186958714 X:14711488-14711510 GGTAAGAGAAGAGCAGAAATTGG + Intronic
1186991825 X:15078100-15078122 GGCAAGAGTTGAACATAAACAGG - Intergenic
1187270066 X:17772085-17772107 GGTTAGAGATGGGCAGAGGCAGG - Intergenic
1189947149 X:46191079-46191101 GGTTCAAGTTGAGCTGAAGCTGG + Intergenic
1193451947 X:81681977-81681999 GCTGTGAGTTGAGCTGAAGCTGG - Intergenic
1193982536 X:88201352-88201374 AGTTAAAATTGAGCAGAAGCAGG + Intergenic
1196037794 X:111166171-111166193 GGTAATGGTGGAGCAGGAGCAGG - Intronic
1196098361 X:111823589-111823611 GGGCAGAGTTGAGAAGAAACTGG + Intronic
1196181657 X:112698560-112698582 GGTAAAAGATGAGAAGAAGGAGG - Intergenic
1197118351 X:122860701-122860723 GGAAATTGTAGAGCAGAAGCTGG + Intergenic
1199134787 X:144236557-144236579 GCTAAGACTGGGGCAGAAGCTGG - Intergenic
1199472911 X:148214600-148214622 GATAAAAGTTGAATAGAAGCAGG + Intergenic
1201154336 Y:11115973-11115995 GGGAAGATTTGGGTAGAAGCAGG + Intergenic
1201886573 Y:18890380-18890402 GGTCAGAGTTTAGCAGATGAGGG + Intergenic
1202302308 Y:23429678-23429700 GGTAAAAGTAGAGGAGAAACTGG - Intergenic
1202568503 Y:26240920-26240942 GGTAAAAGTAGAGGAGAAACTGG + Intergenic