ID: 1109244220

View in Genome Browser
Species Human (GRCh38)
Location 13:59933273-59933295
Sequence GAGCAATCACAGCCATAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109244220_1109244221 -9 Left 1109244220 13:59933273-59933295 CCTCATTATGGCTGTGATTGCTC 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1109244221 13:59933287-59933309 TGATTGCTCACCTATGATATAGG 0: 1
1: 0
2: 0
3: 13
4: 237
1109244220_1109244222 -8 Left 1109244220 13:59933273-59933295 CCTCATTATGGCTGTGATTGCTC 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1109244222 13:59933288-59933310 GATTGCTCACCTATGATATAGGG 0: 1
1: 0
2: 0
3: 7
4: 185
1109244220_1109244223 -1 Left 1109244220 13:59933273-59933295 CCTCATTATGGCTGTGATTGCTC 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1109244223 13:59933295-59933317 CACCTATGATATAGGGATACTGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109244220 Original CRISPR GAGCAATCACAGCCATAATG AGG (reversed) Intronic