ID: 1109248881

View in Genome Browser
Species Human (GRCh38)
Location 13:59993803-59993825
Sequence ATGACTGGCAAGGGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 305}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109248881 Original CRISPR ATGACTGGCAAGGGGGTGGA AGG (reversed) Intronic
900721753 1:4180732-4180754 ATGTCGGGGCAGGGGGTGGATGG - Intergenic
901642797 1:10701558-10701580 ATAACGGGCAAAGGGCTGGAGGG + Intronic
902136830 1:14313994-14314016 ATTACTGGTAAGTGGGTGGCTGG + Intergenic
902659178 1:17889570-17889592 AGTAGTGGCCAGGGGGTGGATGG + Intergenic
903759571 1:25688580-25688602 ATGACTGGAAAGGGGCCAGAGGG - Intronic
904009461 1:27381507-27381529 AGAACTGGCAATGGGGAGGAGGG + Intronic
904844071 1:33395305-33395327 ATGGCTGGGAAGGGGGAAGAGGG + Intronic
905218366 1:36426471-36426493 GTGACAGGCAATGGGATGGATGG - Intronic
905897852 1:41560393-41560415 GTGACTGGCAACGGGGTTGGGGG + Intronic
905908724 1:41639254-41639276 GATACTGGCAAAGGGGTGGATGG + Intronic
906552663 1:46678594-46678616 AAGACTGGCCAGGACGTGGATGG - Exonic
906652298 1:47521411-47521433 AGCTCTGGCAAGGGGGTAGATGG - Intergenic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907474806 1:54698575-54698597 ATGTCAGGCAAGGGCATGGAGGG + Intronic
907888653 1:58617497-58617519 ATGAGAGGCAGGTGGGTGGATGG + Intergenic
908292506 1:62682507-62682529 AAAACAGGGAAGGGGGTGGAGGG + Intronic
911553135 1:99308549-99308571 ATGATTGCCAAGGGGATGAAAGG + Exonic
916760537 1:167812309-167812331 CTGGCTGTCAAGGTGGTGGAGGG - Intronic
917657177 1:177138050-177138072 GTTATTGGCAAGGGGGTGGGTGG - Intronic
917725209 1:177821324-177821346 ATGCCTGGGAAGGGGAGGGAAGG + Intergenic
917980027 1:180263424-180263446 CTGACTGGAGATGGGGTGGAGGG + Intronic
918165255 1:181938663-181938685 ATGACAGCCAAGGGGCTAGAAGG + Intergenic
918300024 1:183195093-183195115 CTGACTAGCAAAGGAGTGGAGGG - Intronic
919880330 1:201896762-201896784 GTGACAGGCAAGTGGGTGGAGGG + Exonic
919929240 1:202210396-202210418 ATGACTGGCCAGAGGCTGGGAGG + Intronic
923423871 1:233848482-233848504 ATGACTGCCAAGTGGGAGTAGGG - Intergenic
923519106 1:234722336-234722358 AGGGCTGGCGTGGGGGTGGAAGG + Intergenic
924246931 1:242094289-242094311 AGGACTGACAAGGGGGTAGCGGG - Intronic
1063894098 10:10661151-10661173 ATGGCTGGAAAGGGGCAGGAAGG - Intergenic
1066329708 10:34407194-34407216 ATGCCTGCCAAGGGGGTGGAGGG + Intronic
1067292099 10:44950887-44950909 ATGGCTGGCCAAGGGGAGGAAGG - Intergenic
1068724408 10:60285021-60285043 ATCACTTGCAAGGGGGTGCTGGG - Intronic
1068736204 10:60415917-60415939 ATGAATGGCGGGGGGGTGGGGGG - Intronic
1073029711 10:100515904-100515926 CTGACTGGAAAGGGGGGGGGTGG + Intronic
1073063266 10:100744699-100744721 GTGACTGGGAAGGGGGTACAGGG - Intronic
1073487292 10:103827631-103827653 ATGTCTAGGAAGGGGCTGGAAGG - Intronic
1073615321 10:104989437-104989459 ATGGCTGGAAATGGAGTGGAAGG + Intronic
1074935469 10:118175130-118175152 AACACTGGAAAGGGGGTTGAAGG - Intergenic
1074949137 10:118311944-118311966 AGGACTGGCAGGTGGGTGTAAGG - Intronic
1075239484 10:120765017-120765039 AAGACAGGCCAGGGGGAGGAGGG - Intergenic
1075897214 10:126007056-126007078 ATGACTGGCCTGGTGGCGGATGG + Intronic
1077318301 11:1928918-1928940 ATGCCTGGGGAGGGGGTGGAAGG - Intronic
1077357812 11:2126855-2126877 GTGAGTGGTAAGTGGGTGGATGG + Intergenic
1077474731 11:2780948-2780970 AGGACAGGCACAGGGGTGGAAGG - Intronic
1078171583 11:8932759-8932781 AGGGCTGGAAAGGGGATGGACGG - Intronic
1079129893 11:17741216-17741238 ATTACTGGGAGGGGGGTGGGGGG - Intronic
1079274977 11:19027003-19027025 AAGTGTGGCAAGGAGGTGGAGGG + Intergenic
1080257324 11:30305593-30305615 ATGACTGGAAATGAAGTGGAAGG + Intergenic
1080584015 11:33665741-33665763 ATGAATGGCAAGGGGTGGGGCGG - Intronic
1081218855 11:40435829-40435851 GTGACTGAGAAGGGGGAGGATGG + Intronic
1081426470 11:42931443-42931465 TGGACTGGGAAAGGGGTGGAGGG + Intergenic
1081896669 11:46593225-46593247 TTGACTGGTAAGTGGGGGGAAGG + Intronic
1083751931 11:64765873-64765895 ATGATGGGCATGGGGGTGGCGGG - Intronic
1085899375 11:80680000-80680022 ATGATTGAAATGGGGGTGGAGGG - Intergenic
1087176958 11:95104989-95105011 GTGACTGGCATGGAGGTGGGTGG + Intronic
1087509462 11:99072153-99072175 ATGAATGGGAAGGGAGTTGAGGG + Intronic
1088645183 11:111912107-111912129 AGGACTGGAAAGGAGGAGGAGGG - Intronic
1089323579 11:117642541-117642563 GTGCCTGGCGAGGGGCTGGAAGG + Intronic
1089571814 11:119416257-119416279 AGGACTGGCGAGGGAGTGGATGG + Intergenic
1090984645 11:131755336-131755358 AAGACTGGCAAGGGAGTGGAAGG + Intronic
1091648157 12:2289336-2289358 CTGCCTGGGGAGGGGGTGGATGG + Intronic
1091844109 12:3642024-3642046 CTGACTGGAAAGGAGATGGAGGG - Intronic
1093405575 12:18800488-18800510 GTGACTGGCGATGGGGAGGAGGG - Intergenic
1093749230 12:22779540-22779562 GTGACTGTCAAAGGGATGGATGG + Intergenic
1095223056 12:39641502-39641524 AAGACAGGCAAGGGGAAGGAAGG + Intronic
1095474021 12:42566701-42566723 ATGAATGGAAGGAGGGTGGAAGG - Intronic
1096755252 12:53794058-53794080 AGGACTGGCCAGGTGGTGGATGG - Intergenic
1099969353 12:89484863-89484885 ATCACTGGCAGGTGCGTGGATGG + Intronic
1102500906 12:113351869-113351891 GTGATTGGCCAGGGGGTGGAGGG - Intronic
1103558011 12:121777554-121777576 ATGAAGGGCAGGGGGGTGGCAGG - Exonic
1103857810 12:123986105-123986127 ATGTCTGGCGGGGGGCTGGAGGG + Intronic
1104388766 12:128374120-128374142 ATGACTGGCCCGGGTGGGGAGGG + Intronic
1104717773 12:131027732-131027754 ATGGCTGGCAGGGGGATGCAGGG - Intronic
1109248881 13:59993803-59993825 ATGACTGGCAAGGGGGTGGAAGG - Intronic
1110614462 13:77525832-77525854 ATGAGGTGGAAGGGGGTGGATGG + Intergenic
1111916132 13:94362533-94362555 AAGACTGGTAAGGGGGTGAAAGG + Intronic
1114745768 14:25145024-25145046 TTGACTGGAAAGGGGCAGGAGGG - Intergenic
1114855009 14:26428090-26428112 ATGACTGGCAAAGAGGAGAAGGG - Intergenic
1114912958 14:27223440-27223462 ATGACAGGGCAGGGGGTGCAAGG - Intergenic
1117340742 14:54789205-54789227 GAGACTGGGAGGGGGGTGGAGGG + Exonic
1118356148 14:65015516-65015538 CAGCCTGGCAAGGGGGAGGAGGG - Intronic
1119563469 14:75609046-75609068 ATGACAGGCCAAGGGGAGGAGGG - Intronic
1119876337 14:78062733-78062755 ATGTCTGGCAAAGGTGTGAAAGG - Intergenic
1120202439 14:81552626-81552648 TTGACTGGAAAGGGGCAGGAGGG + Intergenic
1122129996 14:99599364-99599386 ATGCCTGGCAATGGGCAGGAGGG + Intronic
1122277776 14:100604021-100604043 AGGACGGGCAAGGGGGTGAGGGG - Intergenic
1122967866 14:105139612-105139634 ATGACTGAGTATGGGGTGGAGGG + Intergenic
1124939119 15:34201426-34201448 ATGTGTGGCTAGGGGGTGAAGGG + Intronic
1125916521 15:43492910-43492932 GTGACGGGGAAGGGGTTGGAGGG - Intronic
1126871713 15:52996438-52996460 ATGAATGTCAGGTGGGTGGAAGG - Intergenic
1127115368 15:55721191-55721213 AGCACTGGCAAGGGGATGAATGG - Intronic
1127165998 15:56244815-56244837 ATGAATGGGAAGGGGGGGAATGG - Intronic
1128609730 15:69063988-69064010 ATGACTGACAGGGGCGTGGCAGG + Intergenic
1129090593 15:73146028-73146050 AAGCCAGGCAAGGGAGTGGAAGG - Intronic
1129678181 15:77643562-77643584 ATGGCAGGGAAGGGGGTGGCAGG - Intronic
1130088375 15:80797680-80797702 GTGACTGGCAATGGCCTGGATGG + Intronic
1131515977 15:93077032-93077054 TTGACGGGCAAGGGAGGGGATGG + Intronic
1131562294 15:93455131-93455153 ATGAGTGGGAAGGGGGTGGCTGG + Intergenic
1132109807 15:99094448-99094470 ATGACAGGCTAGGTGATGGAAGG - Intergenic
1134105888 16:11485800-11485822 ATGACTGGTGAGTGGATGGATGG + Intronic
1134204776 16:12228266-12228288 ATGCCTGCCATGGGTGTGGAAGG - Intronic
1134669211 16:16042218-16042240 ATGCCTGGGAAGGGGGTGACTGG - Intronic
1137764933 16:50970792-50970814 AGGACTGGGAAGGGGAAGGAGGG + Intergenic
1138186628 16:54982391-54982413 ATGGCGGGCTGGGGGGTGGAGGG - Intergenic
1138301095 16:55930392-55930414 ATAACTGGGCAGGGAGTGGAAGG - Intronic
1138420875 16:56898192-56898214 ATGATGGGCAAGGGGTTGGGGGG + Intronic
1139387298 16:66580907-66580929 TTGACTGGCAAGGGGTTAGGTGG - Intronic
1139787304 16:69404175-69404197 ATGGGTGGCAGGGGGGTAGAGGG + Intronic
1140038612 16:71390260-71390282 ACCATTGGCAAGGTGGTGGATGG - Exonic
1140376175 16:74447010-74447032 AAGACTGACAAGGGGGTGATGGG + Intergenic
1140666867 16:77235930-77235952 ATGTTTGGCGAGGGGGTGGTTGG - Intergenic
1141096813 16:81168623-81168645 ATGAATGGTGGGGGGGTGGATGG + Intergenic
1141609714 16:85174525-85174547 ATGAATGGGAAGGAGGGGGAGGG - Intronic
1143763058 17:9118645-9118667 AGCACTGGAAAGGGGGTGGGTGG - Intronic
1144877709 17:18411080-18411102 AAGACTGGAAAAGGGGTGAAGGG - Intergenic
1144944341 17:18962105-18962127 GTGGCTGGCATGGGGGTGGCTGG - Intronic
1145154520 17:20533323-20533345 AAGACTGGAAAAGGGGTGAAGGG + Intergenic
1147652852 17:42072051-42072073 ATGACTGTGAATGAGGTGGAGGG + Intergenic
1148063718 17:44853632-44853654 ATCACTGTAAAGGAGGTGGAGGG + Exonic
1148740511 17:49890023-49890045 GGGACCGGCAAGGGGTTGGAGGG + Intergenic
1149025928 17:52027346-52027368 CTGACTGGTATGGGGGTAGAGGG + Intronic
1149348746 17:55766041-55766063 ATGCCTTGCAAGGGCGGGGATGG - Intronic
1149666395 17:58367695-58367717 GTGACTGGACAGAGGGTGGAGGG + Intronic
1149729358 17:58929305-58929327 TTGACTGGAAAGGAGGAGGATGG + Intronic
1151171536 17:72250444-72250466 CTGACTGGCAAGCAGGTTGATGG + Intergenic
1152494600 17:80662178-80662200 CTGACTGGAAAGGGGGCTGAGGG - Intronic
1155089112 18:22488977-22488999 AAGACTGGGAAGTGGGAGGAGGG + Intergenic
1155142453 18:23055322-23055344 GTGTCTGGGAAAGGGGTGGAGGG - Intergenic
1155420000 18:25645545-25645567 ATGATAGTCAAGGGAGTGGAGGG + Intergenic
1156315081 18:35962228-35962250 ATGGGGGGCAAGGGGGTGGGTGG - Intergenic
1157500874 18:48189829-48189851 ATGGCTGGAAAGGGGCAGGAGGG + Intronic
1157618517 18:49001976-49001998 GTGACAGACAAGGGGGTGGAGGG + Intergenic
1158259315 18:55589845-55589867 ATGACTGGGAAGGGGCGGGGCGG + Intronic
1158308973 18:56138752-56138774 ATGAGTGGGAAGGGAGTGGGAGG + Intergenic
1158534070 18:58291879-58291901 ATGTTTGGGAAGGGGGTGGCTGG - Intronic
1159541187 18:69778914-69778936 ATGAGTGGAATGGGGATGGAAGG + Intronic
1159700757 18:71623822-71623844 AACACTTCCAAGGGGGTGGAGGG - Intergenic
1160038196 18:75320557-75320579 ATGACTGGGCAGGGCGGGGAAGG + Intergenic
1160181284 18:76638715-76638737 GAGACTGGAAAGGGTGTGGAAGG + Intergenic
1160767815 19:816231-816253 ATGAATGGCTAGGTGATGGATGG - Intronic
1160767957 19:816818-816840 ATGAATGGCTAGGTGATGGATGG - Intronic
1161262103 19:3343828-3343850 ATGACTGGGACAGGGGTGGGTGG - Intergenic
1161853558 19:6751336-6751358 AGGACTGGGTTGGGGGTGGAGGG - Exonic
1163290848 19:16378101-16378123 ATGAATGGCGGGTGGGTGGATGG + Intronic
1164774998 19:30845967-30845989 CTGACTGGGTAGGGGGTGGATGG + Intergenic
1164901580 19:31930595-31930617 GAGATTGGCAAGGAGGTGGAAGG - Intergenic
1165166909 19:33863371-33863393 GTGACTGGAAAGGGGCTGGTGGG - Intergenic
1166691103 19:44821498-44821520 AGGTCTTGCAAGGGGGCGGATGG - Intergenic
1167596467 19:50430915-50430937 ATGAGTGGGAAGGGGGAGGGAGG + Exonic
1168260004 19:55187999-55188021 AGGTCTGGCCAGGGGGTGGGGGG + Intronic
925851593 2:8087402-8087424 ATGCCTGGCAATGTGGTGGCAGG + Intergenic
930027972 2:47041078-47041100 CTGACTGGGGTGGGGGTGGAGGG - Intronic
931956971 2:67438444-67438466 AGGACTGGGATGAGGGTGGAAGG - Intergenic
932258104 2:70303983-70304005 ATGTCAGGCATGGGGGTGCAAGG + Intergenic
932267167 2:70377737-70377759 TTGATTGGAAAGGGGGTGGTGGG + Intergenic
932487633 2:72094140-72094162 AGGACTGAGAAGGAGGTGGAGGG - Intergenic
934774129 2:96926567-96926589 ATGAATGGGAAGCGGGTGGTGGG - Intronic
935309027 2:101764709-101764731 ATGAGTGGCAAGAAGGTGCAGGG - Intronic
935591712 2:104851375-104851397 GTGACTGGGTTGGGGGTGGAGGG + Intergenic
937062719 2:118992342-118992364 ATGAGTGGGGAGCGGGTGGAGGG - Intronic
938308449 2:130269491-130269513 GTCACTGGGAAGGGGGTGAATGG + Intergenic
938446881 2:131387345-131387367 GTCACTGGGAAGGGGGTGAATGG - Intergenic
938892321 2:135718188-135718210 CTGACTGGGAAGGGACTGGAGGG + Intronic
938977304 2:136492183-136492205 ATGACTTGCAAGGGAAGGGATGG + Intergenic
939011013 2:136845946-136845968 GTGACTGGCCATGGTGTGGATGG + Intronic
942111259 2:172684748-172684770 ATGACTGGACATGGGGTGAAGGG - Intergenic
943560563 2:189456628-189456650 ATGACTGTAAAGAGGGAGGAGGG + Intronic
945266073 2:207892678-207892700 ACCAATGGCAATGGGGTGGATGG - Intronic
945288580 2:208106548-208106570 GTCACTGGCAAGGGGGGAGAGGG - Intergenic
948383547 2:237567684-237567706 ATGTGGGGGAAGGGGGTGGATGG - Intergenic
948676398 2:239599485-239599507 ATGAGTCGCAAAGGGGAGGAGGG - Intergenic
1168903941 20:1389422-1389444 ATACCTAGCAAGGGAGTGGATGG + Intronic
1170444823 20:16415655-16415677 AAGACTGGAAAGGGGATGGAGGG - Intronic
1170557923 20:17530568-17530590 CTGACTGGGAAAGGGGAGGAGGG + Intronic
1172499053 20:35412039-35412061 AAGACTGGCAAGGGGGGCGCAGG + Exonic
1173849634 20:46209911-46209933 ATGAGAGGGAAGGGGGTGCAGGG + Intronic
1174101745 20:48132032-48132054 ATGACTGGGAAGGGGGAAGCGGG - Intergenic
1174195314 20:48768813-48768835 AAGACTGGCAAGGGGCTCAAGGG + Intronic
1174286923 20:49480557-49480579 GTGGCTGGTAAGAGGGTGGAGGG - Intronic
1175656040 20:60772014-60772036 TTGACTGACAGTGGGGTGGAAGG - Intergenic
1175823582 20:61924679-61924701 ATGACTGACATGGGAGTGGGTGG - Intronic
1178032712 21:28546065-28546087 ATGACTTTCAGGGTGGTGGATGG + Intergenic
1178123350 21:29491939-29491961 ATGATTGACAAGTGGGAGGATGG - Intronic
1178123458 21:29493072-29493094 ATGATTGACAAGTGGGAGGATGG - Intronic
1178785703 21:35651407-35651429 CTAACTGGCACTGGGGTGGAAGG + Intronic
1179464315 21:41561573-41561595 CTGACTTGCAGGGGGATGGACGG + Intergenic
1180625657 22:17191912-17191934 GTGGCTGGGAAGGGGGTGGTTGG - Intronic
1180625686 22:17191983-17192005 TTGACTGGGAAGGAGGTGGCTGG - Intronic
1181637717 22:24182006-24182028 ATAAGTGGCAAGAGGGTCGATGG - Intronic
1183191673 22:36325590-36325612 CTGACTGGCACGGCGGTGGCAGG + Intronic
1184109725 22:42387693-42387715 GTGACAGGCAAGGGGGATGAGGG - Intronic
1184508479 22:44918199-44918221 AGGACTGGCGTGGGGGCGGATGG + Intronic
1184516505 22:44965775-44965797 ATGCCAGGCAATGGGGCGGACGG + Intronic
950463364 3:13138753-13138775 CTGACTGCAAAGGGAGTGGAAGG - Intergenic
950543187 3:13624499-13624521 ATGGCTGGGAATGGGGAGGAGGG - Intronic
952273758 3:31857767-31857789 AAGATTGGCAGGGGGGTGGGGGG + Intronic
952353658 3:32564868-32564890 GTAACTGGCAAGGGAGTGTATGG - Intronic
952366546 3:32679802-32679824 ATGACTACCAAGAGGTTGGAGGG - Intergenic
952836552 3:37607232-37607254 ATGAGTGGCAGTTGGGTGGATGG + Intronic
952856359 3:37773664-37773686 TTGACTGGCAAGGGACTGGTGGG + Intronic
953095635 3:39772488-39772510 ATGAATGGGAATGGGGTAGAAGG + Intergenic
954325794 3:49862741-49862763 ATGACTAGCAGGTGGGTGGGTGG - Intronic
954874800 3:53795017-53795039 GAGACTGGGAAGGGGCTGGAGGG - Intronic
955813329 3:62815440-62815462 GTGACTGGCAGGGGGCAGGATGG + Intronic
956406525 3:68933372-68933394 ATGACTAGGAATGGGGTGGGAGG - Intergenic
958138256 3:89525625-89525647 ATGTCTGGCCATGGGGTGAAGGG + Intergenic
958143103 3:89588739-89588761 ATGTGTGGTAAGGTGGTGGACGG + Intergenic
958920889 3:100104163-100104185 ATGACTGGCAATGGGGGTGGGGG - Intronic
960102504 3:113759800-113759822 AGTACTGGCAAGGGTGTGGGGGG - Intronic
961707339 3:128797279-128797301 ATCACTGGCTATGGGGGGGAAGG + Intronic
961731099 3:128965449-128965471 GTGACGGGCAGGTGGGTGGAAGG + Intronic
961857862 3:129891181-129891203 ATGACTGAAAGGTGGGTGGAGGG - Intronic
963741853 3:149088658-149088680 GTGACTGGGAAGTGGCTGGATGG - Intergenic
963809882 3:149765317-149765339 ATGACTGGCAAGGGGCATGAAGG + Intronic
966115504 3:176456394-176456416 ATGATTGCAAAGGGGTTGGAAGG - Intergenic
966331481 3:178819509-178819531 ATGGCTGGGATGGGGGTGGGGGG - Intronic
966427523 3:179795567-179795589 ATTAATGGCAATGGGGGGGAGGG - Exonic
966728090 3:183126345-183126367 AGGACTGGGAAGGAAGTGGAGGG + Intronic
970008645 4:11434462-11434484 TGGCCTGTCAAGGGGGTGGAGGG - Intergenic
970565452 4:17327812-17327834 ATCACTGGACAGGGAGTGGAGGG - Intergenic
973544006 4:51962056-51962078 CAGACTGGCAAGGTGGTGGTGGG + Intergenic
976931256 4:90569828-90569850 TCAACAGGCAAGGGGGTGGATGG - Intronic
977685074 4:99838091-99838113 GTGGCTGGCAGGGGGATGGATGG + Intronic
977923234 4:102669352-102669374 AGGAGTGACAAGGGGCTGGAGGG - Intronic
978207581 4:106096674-106096696 ATGACTGACAGGATGGTGGAGGG + Intronic
978881596 4:113709901-113709923 ATGCCAGGCACGGGGGTGGTGGG + Intronic
979795363 4:124839659-124839681 AGGGATGGGAAGGGGGTGGAGGG - Intergenic
980992449 4:139749540-139749562 GTAACTGTCAAGGGGGTGGGGGG + Intronic
982437245 4:155393667-155393689 GTTCCTGGCAAGTGGGTGGATGG - Intergenic
982637288 4:157913047-157913069 ATCACTGGGCATGGGGTGGAGGG + Intergenic
984526631 4:180866243-180866265 CAGAGTGGCAAGGGGGTGGCGGG + Intergenic
985636215 5:1037097-1037119 ATGGCAGGCAAGCAGGTGGATGG + Intronic
987264256 5:16235775-16235797 AGTAGTGGCAATGGGGTGGAGGG - Intergenic
988914445 5:35878287-35878309 ATGCCTATCAAGGAGGTGGAAGG - Exonic
989273670 5:39561436-39561458 ATGGCTGGCAAAGGGATAGAAGG + Intergenic
989772905 5:45166216-45166238 GTGACTGGCCAGGATGTGGAAGG - Intergenic
992472683 5:77074159-77074181 AAGACTGGCATGGGGGCAGAGGG + Exonic
992607145 5:78469867-78469889 ATGTCTTGTAAGGGGTTGGAGGG - Intronic
993425832 5:87763153-87763175 AGCAGTGGAAAGGGGGTGGAAGG - Intergenic
994592704 5:101791926-101791948 TTGACTAGCAAGGGCATGGAGGG + Intergenic
995708172 5:115006983-115007005 GTGAGTGGCAAGTGGGTGCAGGG - Intergenic
995945105 5:117635603-117635625 AAGACTGGGAAGGAGGTGGGAGG - Intergenic
996583534 5:125058537-125058559 AGGACTGGAAAGGGGGAGGAGGG + Intergenic
998601187 5:143586894-143586916 ATGAATGGCAAGAGGGAGGGAGG - Intergenic
999220895 5:149976483-149976505 TTGACAGGCAAAGAGGTGGATGG + Intronic
999240038 5:150122092-150122114 ATGAGTGGCAAGGGGCAGGAGGG - Intronic
999303840 5:150507536-150507558 GTGACCGGCAAAGGTGTGGAGGG - Intronic
999595726 5:153202064-153202086 AAGAGTGATAAGGGGGTGGATGG - Intergenic
999998260 5:157113051-157113073 ACCAATGGCAAGGGGGTGGAGGG - Intronic
1002120058 5:176996300-176996322 ATTACTGGTAAGGGGCAGGAGGG + Intronic
1002451449 5:179321359-179321381 GTGAGAGGCAAGGGAGTGGAGGG - Intronic
1002550008 5:179981053-179981075 AAGACTGGGAAGGGGTTAGATGG + Intronic
1006354064 6:33543383-33543405 ATGACTGGGGAGGGGGTTCAGGG + Intergenic
1006746048 6:36342732-36342754 CTAAGTGGCAAGGGGGAGGAGGG + Intergenic
1006836076 6:36999478-36999500 ATGGCTGGCAAGGGGGAGCCTGG + Intergenic
1006934248 6:37706051-37706073 ATGCCTGGCACGGGCTTGGAAGG + Intergenic
1007171910 6:39870092-39870114 AGAACTGGCAAGGGGCTTGAAGG + Intronic
1007387180 6:41528025-41528047 AGGGCTGGTATGGGGGTGGAGGG - Intergenic
1007740236 6:44005414-44005436 ATGACTGGCATGGAGGGGGCTGG - Exonic
1008140331 6:47824457-47824479 ATGACTGGCAAAGCAGTGCAGGG + Exonic
1008246853 6:49186532-49186554 CTGGCTGGCTAGGGGGTTGAAGG - Intergenic
1009387243 6:63099933-63099955 ATCTGTGGCAAGGAGGTGGATGG + Intergenic
1013273044 6:108560306-108560328 CCGACTGGGAAGGGGGCGGAGGG + Intronic
1015790069 6:136957648-136957670 AGGAAAGGCAGGGGGGTGGAAGG - Intergenic
1016420815 6:143881077-143881099 ATGAGTGGGAGTGGGGTGGAAGG - Intronic
1016800619 6:148165332-148165354 CTGACTGGAAAGGGAATGGAGGG - Intergenic
1018170577 6:161140207-161140229 ATGAATGACAAAGGGCTGGAGGG + Intronic
1018871875 6:167790108-167790130 ATGACGGGGTATGGGGTGGACGG - Intronic
1019198111 6:170294021-170294043 ATGGCTGGCTAGGGGGCTGATGG - Intergenic
1019893588 7:3965967-3965989 ATGACGGGCTGGAGGGTGGAGGG + Intronic
1020940118 7:14522601-14522623 ACAACTGGAAAGGGGGTGGATGG + Intronic
1023938531 7:44756043-44756065 ATGGCAGGCAAGGCAGTGGAGGG - Intronic
1023985191 7:45089804-45089826 GTGCCTGGCACGGGGGAGGAGGG - Intergenic
1025021547 7:55484343-55484365 AAGACTGGCAAGGGGGTGGAAGG - Intronic
1026585903 7:71656032-71656054 ATGAATGGAGAGGGGCTGGAGGG - Intronic
1026762023 7:73134000-73134022 ATGAGTAGCAGGGGTGTGGAGGG + Intergenic
1027038364 7:74942824-74942846 ATGAGTAGCAGGGGTGTGGAGGG + Intergenic
1027085199 7:75258658-75258680 ATGAGTAGCAGGGGTGTGGAGGG - Intergenic
1028203793 7:87993590-87993612 ATGACAGGTAAGGTGCTGGAAGG - Intronic
1029202298 7:98847280-98847302 CTGGCTGGCAGGGGGCTGGATGG - Exonic
1029530358 7:101121461-101121483 ATGACCGGCCAGGGGCTGGCAGG + Intergenic
1029872203 7:103706788-103706810 ATGACTAGCAGGGGGGTTAAAGG - Intronic
1029978105 7:104852847-104852869 GGGACTGGGAAGAGGGTGGAGGG - Intronic
1031923443 7:127617825-127617847 AAAACAGGAAAGGGGGTGGAAGG + Intergenic
1032963155 7:137063994-137064016 ATCAGTGGCCAGAGGGTGGAGGG + Intergenic
1033009568 7:137605799-137605821 AAGACTGGGAAGGGTGTGGTGGG + Intronic
1034463807 7:151213788-151213810 ATAACCAGCAAGGGGCTGGAGGG + Intronic
1034479628 7:151309303-151309325 ACGATTGGCAAGGAGGTGGGAGG - Intergenic
1034721392 7:153297142-153297164 ATAACTGGCAAGGCAGTAGAGGG + Intergenic
1035124478 7:156597696-156597718 ATGACTGGCAATGGAGGGGTGGG + Intergenic
1035654353 8:1294200-1294222 ATGACTGGCAAGGGGAGAGGTGG - Intergenic
1035764735 8:2096970-2096992 ATGGCTGCCAAGGGGGTGTCTGG - Intronic
1035836982 8:2765007-2765029 ATGCCTGGGAATGGGGAGGAGGG - Intergenic
1038340573 8:26682042-26682064 AGGAGTGGGAAGAGGGTGGAGGG - Intergenic
1043276425 8:78400876-78400898 ATGAATGGCCATGGGATGGATGG + Intergenic
1044307671 8:90656795-90656817 AGGACTGCACAGGGGGTGGAAGG + Intronic
1047921401 8:129638414-129638436 TAAACTGGCAAGGGGGTGGTGGG - Intergenic
1049080623 8:140440598-140440620 ATGAAGGGGAAGGGGGTGCAGGG - Intronic
1049320626 8:141994448-141994470 ATGAGTGGATAGTGGGTGGATGG - Intergenic
1049497990 8:142945680-142945702 GGGACTGGGAATGGGGTGGAGGG + Intergenic
1049707132 8:144048184-144048206 CTGGCTGGCAGGGAGGTGGAGGG - Intergenic
1050195202 9:3075537-3075559 ATGAGTGGCATGAGGGTGAAAGG - Intergenic
1052874538 9:33545111-33545133 ATGACTGGCAAGTGTGTTGGAGG - Intronic
1052966222 9:34342654-34342676 ATGCCTGGGAAGGGGGTGCAGGG - Intronic
1053501483 9:38599182-38599204 ATGACTGGCAAGTGTGTTGGAGG + Intergenic
1054811969 9:69442226-69442248 ATGACTTGAAAGGGGTGGGAAGG - Intronic
1055018169 9:71641464-71641486 ATGACTGGAGAGGGGGTGGGTGG + Intergenic
1055947388 9:81703818-81703840 ATGAATGGGTAGGGGGTGGGAGG - Intergenic
1056196778 9:84236837-84236859 ATGACTGGCAAGTTGGTGCTGGG + Intergenic
1057314851 9:93961509-93961531 AGTCCTGGCAAGGTGGTGGAGGG - Intergenic
1057352780 9:94314716-94314738 ATGAAGGGCAAGGGGATGAAGGG + Intergenic
1057611320 9:96546395-96546417 CTGACTGGAAAGGGGTGGGAGGG + Intronic
1057654967 9:96942874-96942896 ATGAAGGGCAAGGGGATGAAGGG - Intronic
1059996870 9:119919304-119919326 ATGTCTGGCAAGGAGGTCAATGG - Intergenic
1061002081 9:127908193-127908215 ATGACTTGAAGGGGAGTGGAGGG - Exonic
1061919152 9:133772619-133772641 GTGTCTGGCAAGGGGGTGGGTGG - Intronic
1062577793 9:137216667-137216689 TTGACTGGGAAGGGGGTGGGGGG - Exonic
1062733078 9:138120254-138120276 ACGCCTGGCTAGGGGGTGGGCGG - Exonic
1203751036 Un_GL000218v1:80679-80701 AGTACTTGCCAGGGGGTGGAAGG + Intergenic
1186174805 X:6914696-6914718 GTCACTGCCAAGGAGGTGGAAGG - Intergenic
1186220918 X:7348387-7348409 ATGACTTACACAGGGGTGGAGGG + Intronic
1187573778 X:20532539-20532561 ATGACCGGCATGGGAGTGGGTGG + Intergenic
1189057628 X:37714853-37714875 ATGCCTGGAAAGGGGGTGAGAGG + Intronic
1191936695 X:66434633-66434655 ATGACTGAGAAGGTGGAGGAGGG + Intergenic
1197849673 X:130844281-130844303 ATGACAGGCAAGGGGGGAGTAGG - Intronic
1199525420 X:148786208-148786230 ATGACTGGCCAGGGTGGGGTGGG - Intronic
1200179849 X:154143655-154143677 ATGGGGGGCAAGGGGGAGGAGGG + Intergenic
1200830781 Y:7687358-7687380 ATGACTGCCAGTGGGGTTGATGG + Intergenic