ID: 1109248887

View in Genome Browser
Species Human (GRCh38)
Location 13:59993813-59993835
Sequence GTCCTGGGTAATGACTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109248887 Original CRISPR GTCCTGGGTAATGACTGGCA AGG (reversed) Intronic
900590425 1:3457014-3457036 GTCCTGGCTACTGGTTGGCAAGG - Intronic
901773632 1:11544128-11544150 TTCCTGGAGAATGACTGGAAAGG + Intergenic
902286432 1:15410951-15410973 GTCCTGGCTAATGAGTGGGTGGG - Intronic
902730754 1:18367136-18367158 GTCCTTGGTCATGAGTGGCCTGG - Intronic
904012173 1:27395989-27396011 GACCTGGGCACTGACTGGCAAGG + Intergenic
904045688 1:27607028-27607050 GTCTTGGGTAGGGACTAGCACGG + Intergenic
909712445 1:78667200-78667222 TTCCTGGGGAAGGCCTGGCAGGG + Intergenic
912498884 1:110108757-110108779 GTCCTGGGCAGTGTCTGGCTGGG + Intergenic
912572743 1:110636574-110636596 CTCCTGGAAAATGGCTGGCAAGG + Intergenic
914750641 1:150532693-150532715 GTTCTGGGAGATGACAGGCAAGG + Intergenic
916084953 1:161261769-161261791 GTCCTGTGTTTTGGCTGGCAGGG + Intronic
916184482 1:162117524-162117546 GTCCTGAGTTATGTCTGCCAGGG - Intronic
916823820 1:168425764-168425786 GCCCTTGTTAATGACTGGAAGGG - Intergenic
920011505 1:202871286-202871308 GCCATGGGTCGTGACTGGCAAGG + Intergenic
920809454 1:209268414-209268436 GTCCTGGATAATGAGTGGGCGGG - Intergenic
924106082 1:240650380-240650402 GCCGTGGGTCGTGACTGGCAAGG - Intergenic
1063285827 10:4686957-4686979 TTCTTGGGTAATGATTGGTAGGG + Intergenic
1064046917 10:12024963-12024985 CTACTGGATAATGACTGGGAGGG + Intronic
1064563137 10:16612375-16612397 GTCTTTGGCAATGACTGGCATGG - Intronic
1067135014 10:43600417-43600439 GACATGGGGAATGACTGGCCTGG + Intergenic
1067524736 10:47031467-47031489 GTGCTAGGGAAGGACTGGCAGGG + Intergenic
1069896628 10:71684184-71684206 GTCCATGGTCATGACTGCCAGGG - Intronic
1070706096 10:78639941-78639963 GTGCTGGAGAATCACTGGCAAGG + Intergenic
1074223414 10:111460532-111460554 GTCCTGGGAAAGGACTTGAATGG - Intergenic
1074309278 10:112308301-112308323 GCCCTGGGGAATCGCTGGCAGGG + Intergenic
1074704235 10:116117304-116117326 GGACTGGCCAATGACTGGCATGG - Intronic
1076251339 10:128986172-128986194 GTCATGGCTGATGGCTGGCAGGG - Intergenic
1079627627 11:22634696-22634718 GTGCTGGGGAATGTCTGGAAGGG + Intronic
1080299726 11:30770488-30770510 GGTCAGGGTAATGACGGGCAGGG - Intergenic
1081235559 11:40643446-40643468 GGCCTGGTTACTGCCTGGCAGGG - Intronic
1082987314 11:59180111-59180133 GTCCTGGGTAGTGACTTCAAAGG - Intronic
1084002944 11:66307651-66307673 CTCCTGGGTAATGCCACGCACGG - Intergenic
1087100453 11:94358952-94358974 TTTCTGGGTAATGTCTGTCATGG - Intergenic
1087176952 11:95104979-95105001 GCCCTTGGTTGTGACTGGCATGG + Intronic
1098396925 12:70028992-70029014 GTGCTGGGTAGTGAAAGGCAGGG - Intergenic
1100165549 12:91913544-91913566 GTGCTGTGTATTGACTGGGAAGG + Intergenic
1100640369 12:96476836-96476858 GCCATGGGTCGTGACTGGCAAGG + Intergenic
1100790766 12:98127468-98127490 GTCATGGGTCATGAATGGCTTGG + Intergenic
1103224316 12:119274052-119274074 GTGCTGGGTAAAGAAGGGCAGGG + Intergenic
1104045394 12:125159046-125159068 TACCTGGGTAATGATTTGCAGGG + Intergenic
1109248887 13:59993813-59993835 GTCCTGGGTAATGACTGGCAAGG - Intronic
1109977827 13:69864177-69864199 TTACTGGGTAAAAACTGGCATGG + Intronic
1111547216 13:89756076-89756098 CTCCTGGGTAATAACTGAGATGG + Intergenic
1113390912 13:109895565-109895587 GTCAGGGGTAATAACAGGCATGG + Intergenic
1115581849 14:34767757-34767779 CTCATTGGTAATGGCTGGCAAGG + Intronic
1119149218 14:72342910-72342932 GTCCTAGGTGATGACTGGTTAGG + Intronic
1119180488 14:72601648-72601670 GTGTTGTGTAATGACTGACATGG - Intergenic
1120171013 14:81247404-81247426 GTCCTGGGGGATGACTGTCAGGG + Intergenic
1121595074 14:95156716-95156738 GTCCTGTGTGATTACTGTCAGGG - Intronic
1122864052 14:104595569-104595591 GTCCTGGGTCAGGACAGGGAGGG - Intronic
1125064615 15:35467689-35467711 TTCAGGAGTAATGACTGGCATGG + Intronic
1125134314 15:36324070-36324092 CTCATGGCTAATTACTGGCAAGG - Intergenic
1128328294 15:66739377-66739399 GGCCTGGGTAAGGCCAGGCACGG - Intronic
1128715658 15:69905718-69905740 GTCCCATGTAATGAGTGGCATGG - Intergenic
1132539584 16:502351-502373 GGCCCGGGTAGTAACTGGCATGG + Intronic
1133034279 16:3026345-3026367 GTCCTGGGGAAGGAAAGGCAAGG - Exonic
1135599764 16:23772250-23772272 GTCCTGGGTACAGCCAGGCACGG - Intergenic
1136109536 16:28056020-28056042 GTCCACGGGAATGACAGGCACGG + Intronic
1136489720 16:30598973-30598995 GTTCTGGGTAATGAGTGGCAAGG + Intergenic
1137497514 16:48982035-48982057 GTCCTGGTAAGAGACTGGCAGGG - Intergenic
1141804492 16:86333905-86333927 GTCCTGGGGAGAGACAGGCAAGG + Intergenic
1142715458 17:1744882-1744904 GTCCTGGGTCATGATTGCCAAGG - Intronic
1143521663 17:7447590-7447612 GGCCTGGGTCCTGACGGGCAAGG + Exonic
1144080809 17:11762231-11762253 GTGCTGGGAAATGACTGTTAAGG + Intronic
1144645693 17:16972063-16972085 ATCCTGAGTAATGAGTGGCCTGG - Exonic
1147491961 17:40878062-40878084 GTGCTGGGTAATGAGTGACAGGG + Intronic
1148087286 17:45001772-45001794 GTCATGGGGCAGGACTGGCATGG + Intergenic
1148327978 17:46795039-46795061 GTCCTGGGAAGGGCCTGGCATGG - Intronic
1150983902 17:70173865-70173887 GTCATGTGTAATGACAGGCTAGG - Intronic
1153433042 18:5039543-5039565 GTCCTGGCTAAGGACTGGTGTGG - Intergenic
1153476473 18:5504190-5504212 GTCCTGGGTAAGGTCTGGATAGG - Intronic
1158495483 18:57951498-57951520 GTGCTGGGTTCAGACTGGCATGG + Intergenic
1160583126 18:79898960-79898982 GTCCTGGGAAAGGAAGGGCAAGG + Intronic
1161927629 19:7312989-7313011 GTTCCGGGTAAAGACTGGGAAGG - Intergenic
1162626896 19:11891798-11891820 ATCATGGGTTGTGACTGGCAAGG + Intronic
1163535489 19:17874092-17874114 CTCCTGGGTAAGGACTGTCCAGG + Intronic
1167901606 19:52626467-52626489 GTCCTGTGTAATGATTTGCCTGG - Intronic
1168089680 19:54074390-54074412 GACCTGTGTAAGGCCTGGCATGG + Intronic
925289146 2:2735226-2735248 TTCCTGGGAAATTACTGGCTGGG + Intergenic
926144749 2:10390085-10390107 GCACTGGGAACTGACTGGCAGGG - Intronic
927214659 2:20661516-20661538 GTCCTGGGAGATGAGTGACAAGG - Intergenic
927849318 2:26489106-26489128 TTCCTGGGAAAAGGCTGGCAAGG - Intronic
929778210 2:44941591-44941613 GTTCTCGGTATTGATTGGCAGGG + Intergenic
933379574 2:81525798-81525820 CTCCAGGGTAATGAGTGGCCTGG + Intergenic
935544913 2:104390657-104390679 ATCTTGGGTGATGACTGGAAGGG + Intergenic
936487695 2:112940591-112940613 GCCATGGGTCCTGACTGGCAAGG + Intergenic
940376409 2:152963791-152963813 GCCCTGGTTAAAGACTGGAAAGG + Intergenic
943879377 2:193120227-193120249 GTCTTGGGTAAGGACAGGGAAGG + Intergenic
947079127 2:226376309-226376331 GTGCTGGGTACTGAAGGGCAGGG + Intergenic
947337521 2:229102837-229102859 GTCCTGGGTGATGAGCCGCATGG - Intronic
947732238 2:232437672-232437694 GTCCTATGTTGTGACTGGCATGG - Intergenic
948742907 2:240059855-240059877 ACCATGGGTCATGACTGGCAAGG + Intergenic
1168882017 20:1214851-1214873 AACATGGGTCATGACTGGCAAGG + Intergenic
1169167697 20:3438454-3438476 ATCATGGGTAGTGACTGGCAAGG + Intergenic
1172423197 20:34835323-34835345 GCTGTGGGTAATGACTGGAAGGG - Intergenic
1172453721 20:35048932-35048954 GTGCTGGGCAATGACAAGCAAGG + Intronic
1172901098 20:38335467-38335489 GCCCTAGGTAGGGACTGGCATGG - Intronic
1174443386 20:50574155-50574177 GTCCTGGGTAATGTTTGAAATGG + Intronic
1181144762 22:20836816-20836838 GTTCTGGGTAAGGACTAGCAGGG - Intronic
1182280333 22:29214670-29214692 GTCTTGAGGAATGAATGGCAGGG - Intronic
1184492569 22:44818542-44818564 GTAATGGGTAATGGATGGCAAGG - Intronic
949807966 3:7976385-7976407 GTGCTGGGTAGAGAATGGCAGGG + Intergenic
951514999 3:23549196-23549218 GTCCTTTGTAATGGATGGCAAGG + Intronic
954289718 3:49643200-49643222 GGCCTGGGTAGTGAGTGTCATGG + Intronic
954458806 3:50614369-50614391 GTTCTGGGTAGGGAGTGGCAGGG - Intronic
958002014 3:87762192-87762214 GTGCTGGGTAGAGAATGGCAGGG - Intergenic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
964645177 3:158951180-158951202 GTCCTAGATATTGAGTGGCATGG - Intergenic
965126859 3:164641685-164641707 GTGCTGGGCAATGAGTGGAAGGG - Intergenic
966889054 3:184393120-184393142 ACCATGGGTCATGACTGGCAAGG - Intronic
967756222 3:193172599-193172621 GACCTGGTTAATGATTGCCAGGG + Intergenic
967889750 3:194356729-194356751 GTTCTGGGTTAAGATTGGCAGGG + Intronic
976239757 4:82942752-82942774 GTCCTGAGAAATAACTGGGAAGG + Intronic
980722122 4:136712013-136712035 GTCCTTAGCAATGCCTGGCAAGG + Intergenic
980734428 4:136867062-136867084 GTGCTGGGTAAAGAAGGGCAAGG + Intergenic
982422566 4:155214358-155214380 GTCCAGGGCAATTACTGTCAAGG - Exonic
984349058 4:178568694-178568716 GTCATGGGTTATGACTGGCTGGG - Intergenic
988268231 5:28979340-28979362 GTCCTGGGTAAGGCCTTGTATGG + Intergenic
988830274 5:34980294-34980316 GCTATGGGTCATGACTGGCAAGG - Intergenic
988961619 5:36376749-36376771 GCCTTGGGTCATGAATGGCATGG - Intergenic
996169098 5:120266586-120266608 GTCCTTTGAAAGGACTGGCATGG - Intergenic
997284233 5:132666953-132666975 ACCATGGGTAGTGACTGGCAAGG - Intergenic
998150922 5:139757049-139757071 GTCCAGGGTAGTGAGGGGCATGG + Intergenic
1001874230 5:175185523-175185545 ATCCTGGGAACTGACTGGGAGGG - Intergenic
1003867155 6:10373779-10373801 GTTCTCCGTAGTGACTGGCAGGG - Intergenic
1012292260 6:97471469-97471491 GTCCAGGGTAAGTACTGTCAGGG - Intergenic
1017120461 6:151019108-151019130 GTCCTGGGTAAGGCTTGCCAGGG + Intronic
1022817913 7:33931075-33931097 GTCCTGGGTAATCCCTTACATGG + Intronic
1025770048 7:64495803-64495825 TTGCTGGGTGATGACTGGGATGG - Intergenic
1025818480 7:64942237-64942259 TTGCTGGGTGATGACTGGGATGG + Intergenic
1026505061 7:70975434-70975456 ACCATGGGTCATGACTGGCAAGG + Intergenic
1028148893 7:87349682-87349704 TGACTGGGTCATGACTGGCAAGG + Intronic
1033685454 7:143636212-143636234 TTCCTAGCTAATAACTGGCAGGG - Intronic
1033688624 7:143715430-143715452 TTCCTAGCTAATAACTGGCAGGG - Intronic
1033699160 7:143821408-143821430 TTCCTAGCTAATAACTGGCAGGG + Intergenic
1041092809 8:54318520-54318542 GACCTGGGGAAGGACTGGCTGGG + Intergenic
1048151177 8:131896204-131896226 TTCCTGGGTCATGACTGACTTGG + Intergenic
1049248990 8:141578191-141578213 GTCCTGGGGGGTGACTAGCAAGG + Intergenic
1052799424 9:32953910-32953932 ACCATGGGTCATGACTGGCAAGG + Intergenic
1053478871 9:38401473-38401495 GTCCTGCTAAATGACTAGCAGGG + Intergenic
1054946626 9:70803207-70803229 GACCTGGGGACTGACTGTCAAGG - Intronic
1055372812 9:75618678-75618700 GTGATGGGTATTGACTGGAAAGG - Intergenic
1061491258 9:130945708-130945730 GTCCTGGGCCATGACACGCAAGG + Intergenic
1062120892 9:134833590-134833612 GTCCCGGATGATGTCTGGCATGG - Intronic
1185669237 X:1792663-1792685 GCCCTGAGTTATGACTGGAAGGG + Intergenic
1187506052 X:19879443-19879465 GTCATGGGCCATGACTGCCAAGG + Intronic
1189104962 X:38226038-38226060 ACCATGGGTCATGACTGGCAAGG + Intronic
1194053743 X:89104756-89104778 GTGCTGGGTATGGACTTGCATGG - Intergenic
1194232586 X:91342285-91342307 CCCGTGGGTCATGACTGGCAAGG - Intergenic
1195402845 X:104480155-104480177 TTCCTGGGTACTGATAGGCAAGG - Intergenic
1200078064 X:153561667-153561689 GTCCTGGGTAATGAGTGCAAGGG + Intronic
1201339886 Y:12923071-12923093 GTGCTGGGTAGAGACGGGCAGGG - Intergenic
1202038116 Y:20655826-20655848 GTGCTGGGAAATGTCTGGAAGGG - Intergenic