ID: 1109249122

View in Genome Browser
Species Human (GRCh38)
Location 13:59997153-59997175
Sequence GGGTGCAAACATATGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109249122 Original CRISPR GGGTGCAAACATATGGTAGA AGG (reversed) Intronic
902066154 1:13689818-13689840 GAGAGCAAACATATTGTAGCAGG - Intergenic
903797898 1:25944042-25944064 TGGTGCAAACATAGTGTAGCAGG - Intergenic
906405546 1:45539119-45539141 TCTTGCTAACATATGGTAGAAGG - Intergenic
909303889 1:74047634-74047656 GTGTGCTCACAGATGGTAGAGGG - Intronic
910108335 1:83655376-83655398 GGGTGCAAAATTGTGGAAGAAGG - Intergenic
912219850 1:107660927-107660949 ATGTTCAAACATATGGTTGAGGG + Intronic
913266597 1:117051181-117051203 GGATGAAATCATAGGGTAGAAGG - Intergenic
913386112 1:118259939-118259961 GGGTGCAAACTGAAGGTAAATGG + Intergenic
913695399 1:121319950-121319972 CTGTGCAAACAAATGATAGATGG + Intronic
914142164 1:144960110-144960132 CTGTGCAAACAAATGATAGATGG - Intronic
915536204 1:156537299-156537321 GGGTGACATCATATGGGAGATGG + Exonic
918438441 1:184541418-184541440 GGGTGGAGGCATGTGGTAGATGG - Intronic
920482730 1:206338329-206338351 CTGTGCAAACAAATGATAGATGG + Intronic
920518036 1:206601104-206601126 GGTTGCAAATATATGGTAAAGGG - Intronic
920658494 1:207894727-207894749 GGGTGCTGAGATATGGTAAAAGG + Intronic
1064428817 10:15254148-15254170 GGGTGGACACAGATGGCAGAGGG + Intronic
1064949087 10:20827058-20827080 GGGTGGAGACACATGGGAGAGGG - Intronic
1065023792 10:21522825-21522847 GGGGGCAAAAAAAGGGTAGAAGG - Intronic
1073319141 10:102603483-102603505 GTGTGCACACTTATGTTAGAGGG + Intronic
1074221207 10:111439989-111440011 GACTGCAAACACATGGTATATGG + Intergenic
1078613380 11:12841628-12841650 GGGTGCAAACTGAAGGAAGATGG - Intronic
1078958101 11:16226720-16226742 GGGTGAAGAAATATGGTGGAAGG - Intronic
1080136418 11:28859741-28859763 GGGTACAAAAATAATGTAGAGGG - Intergenic
1081226889 11:40534969-40534991 GGGTCTAAACATATGGTCCATGG + Intronic
1081680599 11:44999758-44999780 GGGGGCAAACATGTTGAAGAGGG - Intergenic
1090816439 11:130301082-130301104 GGGTGATAACAGATGGTATAAGG + Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1098171402 12:67750828-67750850 GGTTACAAACAGATGGTAGATGG + Intergenic
1098577382 12:72058494-72058516 GGGTGCAGCCATAGAGTAGAGGG - Intronic
1098981378 12:76960502-76960524 TGGTGCAAATGTATGGTAGAGGG - Intergenic
1100443350 12:94638453-94638475 GGGTGAAAGGATATGGTCGAGGG - Intronic
1103978077 12:124716818-124716840 GGGTGCAAACACAGGGCAGGAGG + Intergenic
1107568820 13:41634314-41634336 GGGTGCAATCATAAAGTAGAGGG - Intronic
1108787182 13:53918999-53919021 GAGTGCAGGCATATGTTAGAGGG + Intergenic
1109249122 13:59997153-59997175 GGGTGCAAACATATGGTAGAAGG - Intronic
1109646582 13:65265727-65265749 AGGTGAAAACATATGGTATGTGG - Intergenic
1110061948 13:71052512-71052534 GGGTGCAAACATACATTACATGG - Intergenic
1113933292 13:113979976-113979998 GGGTGCACACACATGGGAGGAGG - Intronic
1113933353 13:113980325-113980347 AGGTGCACACATGTGGGAGAAGG - Intronic
1116085097 14:40226829-40226851 GGGTTCAAATATTTGGTAGATGG - Intergenic
1119881950 14:78106632-78106654 GGCTGGAAATATATGGGAGAGGG + Intergenic
1120012355 14:79431231-79431253 GCTTGCAAACTTATGGCAGAGGG - Intronic
1120480995 14:85049132-85049154 GGGTGGAACCAAATGTTAGATGG - Intergenic
1123207744 14:106729499-106729521 TGGTGCATACATAGGGCAGAGGG + Intergenic
1126559448 15:50027156-50027178 GGGTGCACACATATGGGGTAGGG - Intronic
1126582581 15:50254889-50254911 AGGTGCAAACTTATTTTAGAAGG - Intronic
1129505453 15:76077913-76077935 GGGAGTAAACACATGGTAAATGG + Intronic
1133645188 16:7757445-7757467 TGGTGCCAACATCTGGTAGGGGG + Intergenic
1133736456 16:8619673-8619695 GGCTGCAAAGAGATGGTAGCTGG - Intergenic
1135496061 16:22952273-22952295 GGATGAAGACATGTGGTAGATGG - Intergenic
1135548152 16:23379329-23379351 GGGGGCAAACATATGTAAAAAGG + Intronic
1144051406 17:11500154-11500176 GAGTGCATACATATGGCAGGAGG - Intronic
1146630334 17:34464959-34464981 GGGAGCACACATATGGGGGATGG - Intergenic
1149375120 17:56035988-56036010 AGGAGCACACAGATGGTAGAAGG - Intergenic
1149608398 17:57941081-57941103 GGGCGCAGACACATGGGAGAAGG + Intronic
1152243722 17:79174149-79174171 GGGTGAAAACACCTGGTAGAAGG + Intronic
1158421607 18:57299727-57299749 GGGTGCAAACCTTTGGTGGAAGG + Intergenic
1159410648 18:68071408-68071430 GAGTGAAAACATGTGGTAGTTGG - Intergenic
1163999854 19:21088237-21088259 GAGTCCAAACATATTATAGATGG - Intronic
1164233206 19:23309270-23309292 GGGTGCAAAGATATGTCACAAGG - Intronic
926557465 2:14376167-14376189 GGGTGAGAACAAAGGGTAGATGG - Intergenic
942901252 2:181121806-181121828 GGATGCACCCAAATGGTAGAAGG + Intergenic
943066016 2:183086861-183086883 GAGAGAAAACATATAGTAGAAGG + Intronic
943443713 2:187955852-187955874 GGGTGAAAACATGTGGTATTTGG - Intergenic
944118822 2:196218282-196218304 GGGTGTGAACATATGGCAGGTGG + Intronic
1169028470 20:2389348-2389370 GGTTGCAATCATATGTTAGCTGG - Intronic
1169865295 20:10193770-10193792 GGGTTTGATCATATGGTAGACGG - Intergenic
1174967485 20:55234152-55234174 ACGTACAAACATAGGGTAGAAGG - Intergenic
1176897488 21:14398784-14398806 GGGTACAAACATGGGATAGAAGG - Intergenic
1182078411 22:27511131-27511153 GTGTGCACAGATATGGGAGAGGG + Intergenic
949310247 3:2689391-2689413 TGGAGCAAGCCTATGGTAGAGGG + Intronic
950141603 3:10619844-10619866 GGGTGCACACAGATGCTAGTGGG + Intronic
951124783 3:18970393-18970415 AGGTGCAAAAATATAGTAGAAGG - Intergenic
955349490 3:58183357-58183379 GTGTTCAAACAAATGGTAGCTGG + Intergenic
956151509 3:66248231-66248253 AATTGCAAACATAAGGTAGAAGG - Intronic
957421675 3:79979467-79979489 GGGAGCAAAAATTTGGTAGTGGG + Intergenic
958062464 3:88501314-88501336 GGGTGAATACATATGACAGAAGG - Intergenic
959443973 3:106414133-106414155 GGGTGCAAACATATGATGATAGG - Intergenic
961103308 3:124220453-124220475 GGGAGAAAACATAAGGTAAAGGG - Intronic
961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG + Intergenic
964280666 3:155061024-155061046 GGATGCAAACATCAGTTAGAGGG + Intronic
968718227 4:2177805-2177827 GGGTGTAGACACATGGTACAAGG + Intronic
971933220 4:33113410-33113432 AGGTGCACACCAATGGTAGATGG + Intergenic
988539474 5:32096227-32096249 GTGAGCATACATATGGTTGAAGG + Intronic
989826384 5:45861741-45861763 AGGTGAACACATATGGAAGAGGG + Intergenic
995159520 5:108962229-108962251 TTGTGTAAACATATGGAAGATGG + Intronic
996530829 5:124525156-124525178 GGGTGGAAACATGAGGGAGAAGG - Intergenic
996758774 5:126965607-126965629 GTTTGGAAACATATGGGAGAAGG + Intronic
1003761842 6:9187617-9187639 GGGTACTAATATATGTTAGATGG - Intergenic
1006624658 6:35388792-35388814 AGGTGCAAACATGTGGCAGAGGG + Intronic
1012371682 6:98514781-98514803 GGGTGCAATAATACAGTAGAGGG + Intergenic
1014007964 6:116442934-116442956 GGGAGTAAACATATGGAATATGG - Intergenic
1021653495 7:22853766-22853788 GGGTGCAAACTCATCGAAGAGGG - Intergenic
1026569959 7:71520779-71520801 GGGAGCAAGCATATGGCAGGAGG + Intronic
1028451855 7:90994182-90994204 GGTTGCAGACACATGGTAGCTGG + Intronic
1032275689 7:130453385-130453407 GGGTGCAAACAAAGGGGAGCAGG - Intergenic
1042675008 8:71310496-71310518 AGGTGAGAACATATGGTAGCTGG + Intronic
1043969030 8:86509755-86509777 GGTAGCAATCATATAGTAGAAGG - Intronic
1045137968 8:99243768-99243790 GGTTGCAAGCATATGATTGAAGG + Intronic
1045950079 8:107841566-107841588 GGGGGCAAACATATGGGATTTGG - Intergenic
1046290269 8:112149970-112149992 GGGTGCACACAGATGGTTGTTGG + Intergenic
1047674039 8:127180701-127180723 AGGCGCAAACTTATGGTGGAAGG - Intergenic
1048778119 8:137970105-137970127 GAGTAAAAACAGATGGTAGAGGG + Intergenic
1050406138 9:5310198-5310220 GGGTGCAAAAAATTGGTGGAGGG - Intergenic
1054974261 9:71123586-71123608 GCATGCATACATATGGTAGTAGG + Intronic
1055703324 9:78970592-78970614 GGGTGCAATCATAGGGGAGTGGG - Intergenic
1057482175 9:95453552-95453574 GGGTGCAAACATGTGCTCCAGGG + Exonic
1059085206 9:111294059-111294081 GGGTACAAAGAAATGGCAGAAGG - Intergenic
1189660639 X:43293953-43293975 TGAAGAAAACATATGGTAGATGG + Intergenic
1191159605 X:57314190-57314212 GGGTGCATACATATTTAAGATGG - Intronic
1191664545 X:63686405-63686427 GGGTACAAACATAAGATAGAAGG + Intronic
1191823866 X:65342217-65342239 GGGTGCATACATATTTAAGATGG - Intergenic
1193566192 X:83080032-83080054 GGGTTCAAAATCATGGTAGAAGG + Intergenic
1193668315 X:84351602-84351624 AGGTGCAAACAAATGGAAAAAGG - Intronic
1195942884 X:110179867-110179889 GAGTGCTAAAATATGGTAGGAGG + Intronic