ID: 1109252638

View in Genome Browser
Species Human (GRCh38)
Location 13:60038442-60038464
Sequence CAGGTGGAACATCTTGATTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109252638_1109252641 14 Left 1109252638 13:60038442-60038464 CCGAAATCAAGATGTTCCACCTG 0: 1
1: 0
2: 0
3: 18
4: 203
Right 1109252641 13:60038479-60038501 TCCCAGAAATGAAGAAAAAATGG 0: 1
1: 0
2: 9
3: 106
4: 1271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109252638 Original CRISPR CAGGTGGAACATCTTGATTT CGG (reversed) Intronic
900813222 1:4824102-4824124 AAGGTGGGACATCTTGAAGTGGG + Intergenic
901854885 1:12038304-12038326 CAGCTGAAACATCTTCATCTGGG + Intergenic
903110474 1:21128713-21128735 CAGGTGAAAAAACTAGATTTAGG - Intronic
908723031 1:67146743-67146765 CATGTTGAACATCTTGGTTTCGG - Intronic
910248707 1:85171073-85171095 CAGGAGGAAAATCATGTTTTAGG + Intronic
911082156 1:93943916-93943938 TAGGTGGATTATCTTGGTTTTGG + Intergenic
916775466 1:167958818-167958840 CAGGTGGAAGATGTTGATAATGG - Intronic
917644997 1:177021187-177021209 AAGGTGCAGCATCTTCATTTTGG - Intronic
919355137 1:196512517-196512539 CAGGTATAACAACATGATTTTGG - Intronic
921153200 1:212417947-212417969 GAGGTGGAAAATCTAGCTTTGGG - Intergenic
921901603 1:220457052-220457074 AAGGTGGAACATCTTGAAGGAGG + Intergenic
923386610 1:233471449-233471471 GAGGTGGAATATCTTGAAGTGGG - Intergenic
924279337 1:242420318-242420340 GAGATGGAACATGTTGATTGAGG - Intronic
1064291731 10:14040642-14040664 CAGGTGGAAAGTCTAGATTCTGG - Intronic
1065038980 10:21671556-21671578 CAGGTGGATCATCTGAGTTTAGG + Intronic
1069699212 10:70408766-70408788 CAGGTTTAAATTCTTGATTTGGG + Intronic
1072130896 10:92492920-92492942 CAGGTGAGTCATCTTGCTTTAGG - Intronic
1074361919 10:112830496-112830518 CAGGTGGACCTTCTTGAGATTGG - Intergenic
1084293468 11:68193204-68193226 CAGGTGGATCATGTGGTTTTAGG - Intronic
1085244605 11:75089746-75089768 CAGCTGGAACATCTAGACATTGG + Exonic
1087042504 11:93815577-93815599 AAGGTGGGACATCTTGAAGTAGG - Intergenic
1088218110 11:107536602-107536624 GAGGTGGATCATCTTGAATGTGG + Intronic
1089880257 11:121766547-121766569 CAGATGGAAGAGCTAGATTTAGG - Intergenic
1093049211 12:14487181-14487203 CAGGCTGAATTTCTTGATTTGGG - Intronic
1093049948 12:14493179-14493201 CAGGCTGAATTTCTTGATTTGGG - Intronic
1093129009 12:15367522-15367544 CAGGTTGAAGATATTAATTTAGG - Intronic
1093471363 12:19505567-19505589 GAGGTGTAACATCTTGAGGTGGG + Intronic
1094424958 12:30307628-30307650 AAGGTGGGACATCATGAATTTGG + Intergenic
1097076571 12:56399269-56399291 CAGGTTGAATTTATTGATTTGGG + Intergenic
1098936495 12:76485342-76485364 CAGGTGGATCATCTGAAGTTGGG + Intronic
1099859685 12:88210845-88210867 CAGGCTGAATATATTGATTTGGG - Intergenic
1100143416 12:91647153-91647175 CAGGTGGAAAATATAGATATGGG - Intergenic
1100755775 12:97749582-97749604 AAGGTGGGACAACTTGATCTGGG - Intergenic
1101131045 12:101691589-101691611 GAGAAAGAACATCTTGATTTAGG - Intergenic
1102039885 12:109794076-109794098 CTGGGGGAACATCTGGATTGGGG - Intronic
1107958832 13:45541877-45541899 CAGGTGGACCATGGTGATGTGGG + Intronic
1109252638 13:60038442-60038464 CAGGTGGAACATCTTGATTTCGG - Intronic
1109582772 13:64363916-64363938 CAGGTTGAATTTATTGATTTGGG + Intergenic
1113266155 13:108620502-108620524 TGGGTGGAACTTCTGGATTTTGG + Intronic
1113269541 13:108657621-108657643 AAGGTGGAACATCTTTTGTTAGG + Intronic
1114041119 14:18679284-18679306 CAGGTGGATCATCTGAGTTTGGG + Intergenic
1115092722 14:29597739-29597761 CAGGTGAAACTTTGTGATTTTGG - Exonic
1115532919 14:34343510-34343532 GAGGTGGAATATCTTGAAGTGGG - Intronic
1117599662 14:57362321-57362343 AAGGTGGGACATCTTGAAGTAGG + Intergenic
1118371820 14:65144119-65144141 CATTTGGAACATGTTCATTTTGG - Intergenic
1118634810 14:67737979-67738001 CAGGTTAAATATCTTGACTTAGG - Intronic
1119785666 14:77311872-77311894 CTGGAGCCACATCTTGATTTTGG - Intronic
1121891872 14:97602228-97602250 CAGGAGGGACATCTTGTTTTGGG + Intergenic
1130048855 15:80466954-80466976 CAGGTGAAAAATCTTCATATGGG - Intronic
1130432112 15:83859207-83859229 AAGGTGGAATATCTTGAAGTGGG + Intronic
1130829524 15:87585108-87585130 CAGGAGGAGCAAATTGATTTGGG - Intergenic
1131620189 15:94060172-94060194 CAGATGGGACAGCTTGATTGTGG + Intergenic
1136144263 16:28306649-28306671 CAGGTGCCACCTCCTGATTTAGG - Intronic
1137927405 16:52553658-52553680 TGGGTGGAACATCTTGAGGTAGG + Intergenic
1137952471 16:52796791-52796813 CAGGTGGAACCTAATAATTTAGG - Intergenic
1138795495 16:59963334-59963356 TAAGTTGAAGATCTTGATTTGGG + Intergenic
1140118827 16:72065957-72065979 CGGGAGGAACATCATGAGTTGGG - Intronic
1141389190 16:83650130-83650152 CAGGTGCAACACATTGATTCTGG - Intronic
1141559841 16:84860260-84860282 CAGGCTGAATTTCTTGATTTGGG - Intronic
1142420314 16:89966015-89966037 CAGAAGGAACAACTTGATGTTGG - Exonic
1142767630 17:2074451-2074473 GAGGAGGAGCATCTTCATTTGGG + Intronic
1146197845 17:30828259-30828281 CAGGTGGATCATCTGGAGTCAGG - Intergenic
1146200941 17:30857967-30857989 CAGGTGGATCATCTGAAGTTAGG - Intronic
1146805903 17:35864845-35864867 GAGATGGAACATTTTGATGTGGG + Exonic
1149112908 17:53055395-53055417 CAAGTTGAACATCTGGCTTTAGG - Intergenic
1149236300 17:54594469-54594491 CAGGTTGAATTTATTGATTTGGG - Intergenic
1149487660 17:57055915-57055937 CAGGTGGAACACCTGAAGTTAGG + Intergenic
1151394416 17:73812795-73812817 CAGGTGGAACATTTTATTGTTGG - Intergenic
1151798747 17:76364791-76364813 AAGGTGGGACATCTTGAAGTGGG - Intronic
1152050002 17:77966248-77966270 CAGGTGGAACCTCTAGTTGTTGG + Intergenic
1152662196 17:81547728-81547750 CAGGTGCCACATCTTGACTCAGG + Intronic
1153607948 18:6853814-6853836 AAGGTGGAACAACTTGAAGTAGG - Intronic
1154123112 18:11667494-11667516 CAGGTGGAGCATTTTGCTTTGGG + Intergenic
1155878928 18:31119640-31119662 CAGGTGGAAAATCAGTATTTTGG - Intergenic
1157163662 18:45338164-45338186 CAGGTGGAATAACTTGAATCAGG - Intronic
1158006299 18:52675438-52675460 AAGGTGGAACAACTTGAAGTTGG - Intronic
1159883348 18:73880941-73880963 CAGGTAGAAGATATAGATTTGGG + Intergenic
1161611732 19:5246951-5246973 CAGGGGGAAGATCTGGATTTTGG + Intronic
1164725517 19:30463337-30463359 CAGGTGGAAGATCTGGCTTTTGG + Intronic
1165067547 19:33237818-33237840 CAGGAGGAACATCTGGGTGTGGG - Intergenic
1167800512 19:51738150-51738172 CTGCTGGAACATCCTGATTCTGG - Intergenic
926190164 2:10722011-10722033 CTGGTGGAACCTCTTCCTTTCGG - Intronic
927241502 2:20923379-20923401 CAGGTGGGACATTTTGAGGTGGG + Intergenic
927458549 2:23277989-23278011 CAGGTGGAAGATCAGGGTTTTGG - Intergenic
931230251 2:60368391-60368413 CACATGAAACATCTTAATTTGGG - Intergenic
931266034 2:60661121-60661143 CAGGGGGCAGATCTAGATTTGGG - Intergenic
933870828 2:86563677-86563699 CTGGTGCAACATCTAGGTTTAGG - Intronic
936585365 2:113752511-113752533 TAGGTGTAAAGTCTTGATTTAGG - Intronic
937049586 2:118877383-118877405 GATGTTGAATATCTTGATTTGGG - Intergenic
938269075 2:129953226-129953248 CAGGTGGATCATCTGAGTTTGGG - Intergenic
939681675 2:145142928-145142950 CAGGTTGAACTTCTTTAATTTGG - Intergenic
940501592 2:154500906-154500928 CAGGTGGCACAGCTGGCTTTTGG + Intergenic
942605096 2:177682242-177682264 AAGGCGGAACATCTTGAAGTGGG - Intronic
942690559 2:178580601-178580623 CAGGTGGAACTGTTTAATTTTGG + Exonic
943517877 2:188909465-188909487 CAGGTTGAATTTATTGATTTGGG - Intergenic
943691028 2:190869742-190869764 AAGGTGGGACATCTTGAAATGGG + Intergenic
946425511 2:219593455-219593477 CAAGTGTAACATTTTCATTTTGG + Intergenic
948258242 2:236584059-236584081 CAGGTGGCACCTTTTGCTTTGGG + Intergenic
1172088303 20:32407112-32407134 CAGGTGGATCACTTTGGTTTAGG + Intronic
1174091283 20:48050329-48050351 CAGCTGGAGCCTTTTGATTTCGG + Intergenic
1174389800 20:50211562-50211584 CAGGTGGATCATCTGAAGTTAGG - Intergenic
1174781384 20:53392215-53392237 CAGGTGGATCATCTGAAGTTGGG + Intronic
1175343876 20:58255763-58255785 CATTTGGATCATCTTGATGTTGG - Intergenic
1175793002 20:61754161-61754183 GTGCTGCAACATCTTGATTTTGG + Intronic
1175830153 20:61960248-61960270 CGGGTGGAACGTCTTGACTGTGG - Intronic
1176524731 21:7857551-7857573 AAGGTGGAACATCTTGAAGTGGG + Intergenic
1178658751 21:34487564-34487586 AAGGTGGAACATCTTGAAGTGGG + Intergenic
1178919747 21:36730923-36730945 CAGGCGGGAAATGTTGATTTTGG - Intronic
1179221346 21:39410275-39410297 AAGGTGGAACATCTGATTTTTGG + Exonic
1181270350 22:21654917-21654939 CAGGGAGAACATTTTGATTTAGG - Intronic
949237965 3:1833712-1833734 CACATAGAACATCTTGATATAGG - Intergenic
949417943 3:3833414-3833436 CAGGCTGAACTTATTGATTTGGG - Intronic
951670304 3:25174258-25174280 CAGTTGAACCATCTTGACTTTGG + Intergenic
953746854 3:45581409-45581431 CAGGTGCTACTTCTTGATCTGGG + Intronic
954806158 3:53222130-53222152 AAGGGGCAACATCTTGATTTTGG + Intergenic
954858850 3:53670570-53670592 CAGGTGGATCACCCTGAGTTTGG - Intronic
960286430 3:115834945-115834967 CAGGTGATACATCTTGGTCTTGG + Intronic
962398390 3:135037053-135037075 CATGGGGAACATCTTGACCTGGG + Intronic
964203443 3:154144132-154144154 CAGGGGGAGCAACTTAATTTAGG + Intronic
966581939 3:181576929-181576951 CAGGTGGATCATCTCGACTCAGG + Intergenic
969346375 4:6573133-6573155 AAGGTGGGACATCTTGAAGTGGG - Intergenic
969550139 4:7860444-7860466 CAGGTTGAACATCCTGAATCTGG - Intronic
969661921 4:8535291-8535313 AAGGTGGGACATCTTGAAGTAGG - Intergenic
970445151 4:16117211-16117233 CAGGTTAAACATCTTGAACTAGG - Intergenic
970916171 4:21337892-21337914 CGGGTGGAAGAAATTGATTTAGG - Intronic
971171840 4:24241715-24241737 CAGATAAAACATCTGGATTTAGG - Intergenic
971588082 4:28431849-28431871 CAGGTGGCACACTTTGGTTTTGG + Intergenic
973192361 4:47400346-47400368 CAAGTGGAACAACTAGATTTAGG - Intronic
973739784 4:53908657-53908679 AGTGTGGAACATCTTTATTTTGG - Intronic
976402152 4:84619803-84619825 CAGGTGGAACATCTGAAGTCGGG + Intronic
976736843 4:88318775-88318797 AAGGTGGAACAACTGGAATTGGG - Intergenic
977459295 4:97304774-97304796 CATGTGGAAGATATTCATTTTGG + Intronic
978627761 4:110706597-110706619 CAGGTGCAGCTTCTTGACTTTGG + Intergenic
980383251 4:132054731-132054753 CAGGTGGGAGATCTTAGTTTGGG + Intergenic
982726046 4:158907755-158907777 CAGAGGGGACTTCTTGATTTAGG - Exonic
984453010 4:179927777-179927799 CAGCTGAAAAATCTTGAGTTGGG + Intergenic
986698912 5:10385228-10385250 AGTGTTGAACATCTTGATTTGGG + Intronic
986955820 5:13148364-13148386 CAGGTCGAATTTATTGATTTGGG - Intergenic
988167211 5:27609220-27609242 CAGGAGCAACATCTTTATTCAGG + Intergenic
988470032 5:31529050-31529072 CAGGCGGAACATCATGATGCAGG - Exonic
991974930 5:72176312-72176334 CAGCTTGAAAATCTTTATTTTGG + Intronic
992236851 5:74718947-74718969 AAAGTGGAACCTCTTGATTTTGG + Exonic
995286031 5:110389031-110389053 CAGGTGGATCATCTGAAGTTAGG + Intronic
995740178 5:115347809-115347831 CAGGAGGAACAGTTGGATTTGGG + Intergenic
996165231 5:120214769-120214791 CAGGTTGAATTTATTGATTTAGG - Intergenic
998756347 5:145385063-145385085 AATGTGTTACATCTTGATTTGGG + Intergenic
999289894 5:150417560-150417582 AAGGTGGGACATCTTGAAGTGGG - Intergenic
999933447 5:156458726-156458748 CAGGTGGATGATCGTGATGTTGG - Intronic
1000730495 5:164828731-164828753 CAGGCTGAACTTATTGATTTGGG + Intergenic
1003311782 6:4975196-4975218 CAGGTGGGACATTTTGTTTTGGG + Intergenic
1004399178 6:15272638-15272660 AAAGTGAAACATCCTGATTTGGG - Intronic
1004824586 6:19405464-19405486 CAGGTTGAATTTATTGATTTGGG - Intergenic
1006917499 6:37603943-37603965 CAGTTGGGACAGCTTGATTTGGG + Intergenic
1007902983 6:45429200-45429222 AAAGTGGAGCCTCTTGATTTTGG + Intronic
1010447339 6:75962811-75962833 CAGGTGGATCATCTGAATTCAGG + Intronic
1010784149 6:79980505-79980527 CAGGTGGATCATCTGAAGTTAGG + Intergenic
1010922743 6:81704171-81704193 CTGTTGGAACAACTTGACTTAGG + Intronic
1011674849 6:89722619-89722641 CAGGTGGATCATCTGAATTCAGG + Intronic
1011795139 6:90944962-90944984 AAGGAGAAACATCCTGATTTTGG - Intergenic
1011877939 6:91985197-91985219 CAGCTCGAACATCTACATTTTGG - Intergenic
1011889426 6:92138664-92138686 CAGGTGGATCATCTGAAGTTGGG + Intergenic
1013276766 6:108593009-108593031 CAGTTTGAACATCTAGATGTTGG + Intronic
1013294866 6:108749931-108749953 CAGAGGGAACATCTTGCTTCTGG - Intergenic
1013303650 6:108827948-108827970 CAGGCAGAATATCTTAATTTTGG - Intergenic
1013600865 6:111703783-111703805 CAGGAGGAAGGTCTTGATTTGGG + Intronic
1015785395 6:136917719-136917741 CAGGTGGATCACCTGAATTTAGG + Intergenic
1016531104 6:145058889-145058911 CAGGTGGAACATATAGTTTCAGG + Intergenic
1022184389 7:27953114-27953136 CAGCTGGAAAAACTTGAGTTTGG - Intronic
1022245999 7:28559938-28559960 CAGGTGGAATACCTTTAGTTAGG + Intronic
1022827254 7:34027916-34027938 CATGTGGAATATATTGATTTGGG - Intronic
1024383711 7:48727054-48727076 AAGGTGGAATATCTTGAAGTGGG - Intergenic
1024486863 7:49929150-49929172 GAGGAGGACCCTCTTGATTTGGG - Intronic
1024568387 7:50703502-50703524 AAGGTGAATCCTCTTGATTTTGG - Intronic
1024778402 7:52816356-52816378 CAGATGGCACATCTTCCTTTGGG - Intergenic
1024898767 7:54293167-54293189 AAGGTGGGACATCTTGAAGTGGG + Intergenic
1028939586 7:96506091-96506113 CAGTTGGAGCCTCTTTATTTTGG + Intronic
1029015807 7:97314495-97314517 AAGGTGGAATATCTTGAAATGGG + Intergenic
1030577282 7:111304764-111304786 CATGTGGGTCATCTTGATTTTGG - Intronic
1034363738 7:150526152-150526174 CATGGGGAAAATCTTGATCTGGG - Intergenic
1037156891 8:15712412-15712434 CAAGTTGAAGATCTTGGTTTTGG - Intronic
1037731333 8:21526186-21526208 CAGGTGGAGCATCGTGCTCTAGG + Intergenic
1039573451 8:38604920-38604942 AAGGTGGGACATCTTGAAGTGGG - Intergenic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1041382474 8:57265108-57265130 CAGGAGGCACTTTTTGATTTGGG + Intergenic
1042783313 8:72517514-72517536 CAGGTGGAACGTTTAGATTAGGG + Intergenic
1044086499 8:87948552-87948574 CAGGTGAATCATGTTGATTTAGG + Intergenic
1044155518 8:88841064-88841086 CAGATGGAGCCTCTTGATCTGGG + Intergenic
1045508942 8:102798574-102798596 CAGGTTGATCGTCTTGATCTTGG + Intergenic
1047723545 8:127665105-127665127 TAGGGCCAACATCTTGATTTTGG + Intergenic
1049241666 8:141540481-141540503 CAGGAGGGACACCTTGATCTGGG - Intergenic
1049551024 8:143259794-143259816 CATCTGGAACTTCTTGCTTTGGG - Intronic
1049567147 8:143346742-143346764 CAGATGCAGCTTCTTGATTTTGG - Intronic
1051401388 9:16687317-16687339 CAGGTAGCAGGTCTTGATTTCGG - Intronic
1052552255 9:29967187-29967209 ATGGTGGCACATCTTGACTTTGG - Intergenic
1055193277 9:73553777-73553799 CATATGGAACATTTTCATTTTGG + Intergenic
1055776812 9:79775254-79775276 AAGGTGGGACATCTTGAAATGGG + Intergenic
1058565681 9:106282629-106282651 TAGGTAGAACATATAGATTTTGG + Intergenic
1060751167 9:126170434-126170456 AAGGTGGGACATGTTGATTCTGG + Intergenic
1186597953 X:11005033-11005055 CACATGGAACTTCTTGATTGAGG + Intergenic
1186716182 X:12254406-12254428 CAGCTGAAACAGCTTGCTTTGGG + Intronic
1186878351 X:13839284-13839306 AAGGTGGGACATCTTGAAGTTGG - Intronic
1189250540 X:39598033-39598055 CAGGTGCCACATGTTGATGTAGG - Intergenic
1189528835 X:41857089-41857111 CAGGTGGAACGTGTTGACTTTGG - Intronic
1190931441 X:54952082-54952104 CACGTCGAAGATCTTGATGTAGG + Exonic
1193080048 X:77397840-77397862 CAGGTGACACATCATGATTAAGG + Intergenic
1193215318 X:78856851-78856873 CAGGTAGAAAAACCTGATTTAGG + Intergenic
1193287187 X:79726417-79726439 CAGATGGAAAATGTTGCTTTTGG + Intergenic
1193850934 X:86536672-86536694 AAGGTGGGACATCTTGAAGTGGG - Intronic
1194108340 X:89799270-89799292 CAGGTGGAAGATTTTGGCTTGGG + Intergenic
1195802540 X:108729876-108729898 CAGATGGAGAATCTTAATTTAGG + Intronic
1195883391 X:109615883-109615905 TAGGTTCATCATCTTGATTTTGG + Intergenic
1196327619 X:114426123-114426145 CAGGCAAAACATCTTGATGTGGG - Intergenic
1196327747 X:114428265-114428287 CAGGCAGAACATTTTGATATGGG + Intergenic
1196388550 X:115186258-115186280 CAGGTGAAACATTTGAATTTGGG + Intronic
1197739899 X:129882343-129882365 CATGGCCAACATCTTGATTTTGG - Intergenic
1198008496 X:132524653-132524675 CAGATCGAACATCTGGAATTTGG - Intergenic
1200460999 Y:3454006-3454028 CAGGTGGAAGATTTTGGCTTGGG + Intergenic
1200521011 Y:4209812-4209834 CAGGCTGAATTTCTTGATTTGGG + Intergenic
1200813693 Y:7509864-7509886 GAGGTGGGACAACTTGATTCAGG - Intergenic
1200875403 Y:8149123-8149145 CAGGTGGATCATCTGGAGTCAGG - Intergenic
1201593093 Y:15637043-15637065 CAGCTGTAACATGTTGATTGGGG + Intergenic
1202188664 Y:22217709-22217731 CAGGTGGATCATCTGGAGTCAGG - Intergenic