ID: 1109256963

View in Genome Browser
Species Human (GRCh38)
Location 13:60095430-60095452
Sequence GGGTGGGTCAATGTAAATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 1, 2: 6, 3: 27, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109256963 Original CRISPR GGGTGGGTCAATGTAAATTA AGG Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
903659504 1:24968452-24968474 GGGTGGGACATTGTAAAGGATGG - Intergenic
905291549 1:36925132-36925154 GGGTGGGTGAATGTATGTCAGGG - Intronic
905739052 1:40353594-40353616 GGGTGGGTCACTTGAGATTAGGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
911447040 1:98009320-98009342 GGGTGGGTGAATGTCATTCAAGG + Intergenic
912043834 1:105427861-105427883 GGCTGGGTCAGTGAAAATTGAGG + Intergenic
915270574 1:154750570-154750592 GGCTGGGTCCATGTGCATTAGGG + Intronic
916403258 1:164471504-164471526 GGCAGGGTAAATGTAAAATAAGG - Intergenic
916710017 1:167396555-167396577 GGGAGGATCATTATAAATTATGG + Intronic
920836624 1:209517060-209517082 GTGTGGCGCAATGTAAAGTAGGG - Intergenic
920934716 1:210420764-210420786 AGGTGGTTCAAGGTAAAGTATGG - Intronic
924273050 1:242354306-242354328 GGGTGGATCAATGCAAATTCAGG - Intronic
1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG + Intergenic
1065869989 10:29947911-29947933 GGGTGGCTCAATGCAACTGATGG + Intergenic
1066711662 10:38242353-38242375 GGGTGGATCAATGCAAATTCAGG + Intergenic
1072844068 10:98809078-98809100 GAGTGAGTCAATGTCAATTGGGG - Intronic
1073168855 10:101483970-101483992 GTGTGGGTAAGGGTAAATTAGGG - Intronic
1073911127 10:108346105-108346127 GGGTGGATCAATTTATTTTATGG + Intergenic
1076200558 10:128554441-128554463 GGGTGGGTTAATGTAAACTGAGG + Intergenic
1079289078 11:19170211-19170233 TGGTGGCTCAATGTTAATTGAGG - Intronic
1082176451 11:49065884-49065906 GGGTGGGTCAAGGGAATTCAGGG - Intergenic
1086269806 11:85048680-85048702 AGTCGGGACAATGTAAATTAGGG + Intronic
1087202650 11:95361438-95361460 GAGTGAGTAAATGTAAACTATGG - Intergenic
1090545525 11:127762573-127762595 GGGTGGTTCACTGGAAATGAAGG - Intergenic
1091386122 12:96168-96190 GGGTGGGACAATTTGAAATATGG + Intronic
1092725346 12:11479999-11480021 GGGTGTGTCAGTGTAATTCATGG + Intronic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1099475399 12:83102829-83102851 AGGTTGGTCAATGACAATTACGG - Intronic
1102367450 12:112350913-112350935 GTATGGCTCAATTTAAATTAAGG + Intronic
1102894504 12:116587910-116587932 TGGTGGGCCAATGTAAACTATGG - Intergenic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1109256963 13:60095430-60095452 GGGTGGGTCAATGTAAATTAAGG + Intronic
1110068446 13:71141089-71141111 TGGTGGCTCAATGTCAAATATGG + Intergenic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1112999892 13:105622438-105622460 GATTGGGTCATTGTAAATTCAGG - Intergenic
1114169256 14:20255108-20255130 GGGTGGGTCAATGTCATTACAGG - Intergenic
1117243571 14:53860939-53860961 GGGAGGGTGAAAGTAAATTTGGG + Intergenic
1117568126 14:57017467-57017489 GGATGGGTTAATATAACTTATGG - Intergenic
1118240071 14:64047380-64047402 GGGTGGGTATATGTAAAATAGGG + Intronic
1120539878 14:85738331-85738353 GGGTAGGTAAAGGAAAATTACGG + Intergenic
1120813730 14:88831303-88831325 GGGTGGGCCAATGCAAATTAGGG - Intronic
1121252199 14:92507488-92507510 GGGTGGTTCATTTGAAATTATGG - Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1128737531 15:70061693-70061715 GGGTGGGTGAAGGTAAAGTTTGG - Intronic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1130065628 15:80602374-80602396 GGGTGGAAAACTGTAAATTAAGG + Intergenic
1135858968 16:26037762-26037784 GGGTCTGTCAAAGGAAATTAGGG + Intronic
1137559492 16:49493561-49493583 GGGTGGGTCATTCTTTATTAGGG + Intronic
1138184113 16:54963341-54963363 GGATGGATCAATGAAAATCAAGG - Intergenic
1140300585 16:73753476-73753498 GAGTGGGTTAAAGTAAATTGAGG - Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1144303056 17:13941310-13941332 AGGTGAGTCAATGCAAATTGAGG + Intergenic
1144424856 17:15132285-15132307 GGGTGGGTCAATTCAAATTGAGG - Intergenic
1150935844 17:69634530-69634552 GGGTGGGGCAATGTGATATATGG + Intergenic
1153566816 18:6427177-6427199 TGGTGGATCAATGTAATTAATGG + Intergenic
1153612103 18:6896625-6896647 AGGTGAGTCAATGTGAATGAAGG + Exonic
1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG + Intergenic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159201021 18:65184179-65184201 AGGTGGATGAATGTAAATGAAGG + Intergenic
1159246992 18:65819232-65819254 GAGTGGGTCAATGCAGATTGAGG - Intronic
1159337062 18:67081956-67081978 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1159337072 18:67082029-67082051 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1161822553 19:6539209-6539231 GGTTGGGTCATTGTAGATTCAGG - Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1166513337 19:43426206-43426228 GTGTGGATTAATGCAAATTAAGG - Intergenic
1167677895 19:50899713-50899735 TAATGGGTCAATGTAAATTGAGG + Intergenic
926620048 2:15039453-15039475 GTGTGGGTCAAAGAAGATTAAGG + Intergenic
928183598 2:29089673-29089695 AGATGGGTAACTGTAAATTATGG + Intergenic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
933401983 2:81809912-81809934 GGGTGGGTCATTGAAAAATGAGG + Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
935120316 2:100178395-100178417 GGGTGGGCCAATGCAAATCAAGG - Intergenic
937837207 2:126483423-126483445 GGGTAGGTATATGTAAACTAGGG + Intergenic
940013011 2:149074153-149074175 GGGTGGGTCAATGTGGGTTCAGG + Intronic
941262971 2:163320188-163320210 GGGTGGGTCCAAGTAAGTGAAGG - Intergenic
941353079 2:164459478-164459500 GGGTAGGTAAAGGAAAATTACGG - Intergenic
944062200 2:195582012-195582034 GGGGGGGTCAATAAAAATTTTGG - Intronic
947418690 2:229922420-229922442 GCGTGGTTCAATTTAAACTAGGG + Intronic
948583919 2:239006693-239006715 GGTTGGGTCAATGGTAATTCGGG - Intergenic
1171325011 20:24283460-24283482 GGGCAGGTCAATACAAATTAAGG + Intergenic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1173891978 20:46519782-46519804 GAGTGGATCAATGCAAATTGAGG - Intergenic
1177355761 21:20004702-20004724 GGATGAGTCAATGCAAATTGAGG - Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1178108559 21:29348625-29348647 GGAAGGGGAAATGTAAATTAAGG - Intronic
1181836453 22:25613984-25614006 GGGTGGGGCGATGATAATTATGG - Intronic
1183571509 22:38656667-38656689 GGGTGGGTCAAGGTAACTCTGGG + Exonic
1185217619 22:49610827-49610849 GTGTGTGTCCATGTATATTATGG + Intronic
1185242915 22:49755981-49756003 GGATGGGCCAATGCAAATTGAGG - Intergenic
950157217 3:10730725-10730747 GGGTAGGTAAAGGAAAATTACGG - Intergenic
955632104 3:60985683-60985705 GATTGGATAAATGTAAATTATGG + Intronic
956711258 3:72040654-72040676 GGGTGGGTTAAAATAAAATAGGG - Intergenic
956919790 3:73914922-73914944 GGGCGGGTAAATAAAAATTAAGG - Intergenic
972429204 4:38964320-38964342 GGGTGGGTCAAGGTCAAGTTTGG + Intergenic
974067617 4:57094396-57094418 GGGTGGCTCCATGTGAAGTAAGG + Intronic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
979715849 4:123836825-123836847 GGGTTGCTGAATGTAAAATATGG - Intergenic
980731660 4:136832146-136832168 GGGTGGGACAATGTGAAATTTGG - Intergenic
982371892 4:154642715-154642737 GAGTGGGTCAATATAAATTGAGG - Intronic
984119290 4:175722579-175722601 AGGTTGGTAAAAGTAAATTATGG - Intronic
984385573 4:179052988-179053010 GGGTGGCTCAGTACAAATTAGGG - Intergenic
985046738 4:185948352-185948374 GGGAGGGCTAATGTATATTAGGG - Intronic
985700465 5:1368840-1368862 GGACAGGTCAATGCAAATTAAGG - Intergenic
988936640 5:36090059-36090081 GGGTGGCCCAATGCAAATTAAGG + Intergenic
994990021 5:106983923-106983945 GGGTAGGTAAAGGAAAATTACGG - Intergenic
995907097 5:117137798-117137820 GCCTGGGTCAATATAAATCATGG - Intergenic
997065367 5:130553511-130553533 AGGTGGGTCAATGGATATTAAGG - Intergenic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
998879104 5:146629059-146629081 GGATGGGATAATGTCAATTAGGG - Intronic
999847151 5:155495959-155495981 GAGTGAGTCAATGTAATCTAAGG - Intergenic
1000042280 5:157493614-157493636 GGGTGGGGCAGTGTGAATTAAGG - Intronic
1001347082 5:170913342-170913364 GGGTGGGTGAATGCAAATGATGG + Intronic
1002569951 5:180134589-180134611 GGGTGGGTCACTGTATAAAAGGG - Intronic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1004471099 6:15929784-15929806 AGGTGGTTTGATGTAAATTAAGG + Intergenic
1005918715 6:30378885-30378907 GTGTGGTTAAATTTAAATTAAGG - Intergenic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1007362757 6:41370626-41370648 GGGAGGGTCAATGGAAAGTCAGG - Intergenic
1008849284 6:56005327-56005349 GATTGGGTCCATGTAAATTATGG - Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010716165 6:79233039-79233061 GGGTGGGTCAAGAGGAATTAAGG - Intronic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1011545406 6:88477438-88477460 GGGTGGGTTAATGCAAATCAAGG + Intergenic
1016779048 6:147938409-147938431 GGGATGCTCAATGGAAATTATGG + Intergenic
1017384325 6:153865854-153865876 GGAAAGGTCAATCTAAATTAGGG - Intergenic
1017779691 6:157706227-157706249 GGGTAGGTAAAGGAAAATTACGG + Intronic
1018415618 6:163599998-163600020 GAGCGGGTCAATGTAAAGTGAGG - Intergenic
1021391858 7:20102641-20102663 GGGTGGGACAAGATAAATTAGGG + Intergenic
1022677672 7:32514772-32514794 GGGTAGGTAAAGGAAAATTACGG - Intronic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1029440816 7:100585825-100585847 GGGTGGGGCTATGCAAATGAGGG + Intronic
1033403079 7:141045862-141045884 GGCTGGCTCAATGAAAAATAAGG + Intergenic
1047829063 8:128612042-128612064 GGGTAGGTAAAGGAAAATTACGG + Intergenic
1050994067 9:12191419-12191441 GGGTAGGTATATGTAAAATAGGG - Intergenic
1051011160 9:12416231-12416253 GGGCGAGTCAAAGCAAATTAAGG + Intergenic
1051407261 9:16751309-16751331 GGATGAGTAAATGTAAACTAAGG + Intronic
1055000389 9:71442603-71442625 GTGTGGTTAAATTTAAATTAAGG + Intronic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1056618663 9:88191445-88191467 GGGTGAATTAATGCAAATTAAGG + Intergenic
1189395645 X:40620529-40620551 GGTTGGGTCATTGTAGATTCAGG - Intergenic
1190364636 X:49680108-49680130 GGGTCAGTCAATGCAAATTGAGG + Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1196294453 X:113982297-113982319 GGGTGGGGGAATGTAATTTCTGG - Intergenic
1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG + Intergenic