ID: 1109265494

View in Genome Browser
Species Human (GRCh38)
Location 13:60194264-60194286
Sequence CCATGTTACCAACTGTTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109265494_1109265499 6 Left 1109265494 13:60194264-60194286 CCAAGTAACAGTTGGTAACATGG No data
Right 1109265499 13:60194293-60194315 GCTAAGGAAGTTAGGGATTCTGG No data
1109265494_1109265497 -2 Left 1109265494 13:60194264-60194286 CCAAGTAACAGTTGGTAACATGG No data
Right 1109265497 13:60194285-60194307 GGTAGCATGCTAAGGAAGTTAGG No data
1109265494_1109265496 -10 Left 1109265494 13:60194264-60194286 CCAAGTAACAGTTGGTAACATGG No data
Right 1109265496 13:60194277-60194299 GGTAACATGGTAGCATGCTAAGG No data
1109265494_1109265498 -1 Left 1109265494 13:60194264-60194286 CCAAGTAACAGTTGGTAACATGG No data
Right 1109265498 13:60194286-60194308 GTAGCATGCTAAGGAAGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109265494 Original CRISPR CCATGTTACCAACTGTTACT TGG (reversed) Intergenic
No off target data available for this crispr