ID: 1109269336

View in Genome Browser
Species Human (GRCh38)
Location 13:60236870-60236892
Sequence CGGTGGGTGTGGAGAACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109269336_1109269350 24 Left 1109269336 13:60236870-60236892 CCATCTGTTCTCCACACCCACCG No data
Right 1109269350 13:60236917-60236939 ATAATCCAGCAGGAGGTATATGG No data
1109269336_1109269346 -2 Left 1109269336 13:60236870-60236892 CCATCTGTTCTCCACACCCACCG No data
Right 1109269346 13:60236891-60236913 CGGGGCAGAACAAAAAGGATGGG No data
1109269336_1109269347 -1 Left 1109269336 13:60236870-60236892 CCATCTGTTCTCCACACCCACCG No data
Right 1109269347 13:60236892-60236914 GGGGCAGAACAAAAAGGATGGGG No data
1109269336_1109269349 17 Left 1109269336 13:60236870-60236892 CCATCTGTTCTCCACACCCACCG No data
Right 1109269349 13:60236910-60236932 TGGGGTTATAATCCAGCAGGAGG No data
1109269336_1109269348 14 Left 1109269336 13:60236870-60236892 CCATCTGTTCTCCACACCCACCG No data
Right 1109269348 13:60236907-60236929 GGATGGGGTTATAATCCAGCAGG No data
1109269336_1109269345 -3 Left 1109269336 13:60236870-60236892 CCATCTGTTCTCCACACCCACCG No data
Right 1109269345 13:60236890-60236912 CCGGGGCAGAACAAAAAGGATGG No data
1109269336_1109269342 -7 Left 1109269336 13:60236870-60236892 CCATCTGTTCTCCACACCCACCG No data
Right 1109269342 13:60236886-60236908 CCCACCGGGGCAGAACAAAAAGG No data
1109269336_1109269351 25 Left 1109269336 13:60236870-60236892 CCATCTGTTCTCCACACCCACCG No data
Right 1109269351 13:60236918-60236940 TAATCCAGCAGGAGGTATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109269336 Original CRISPR CGGTGGGTGTGGAGAACAGA TGG (reversed) Intergenic
No off target data available for this crispr