ID: 1109270018

View in Genome Browser
Species Human (GRCh38)
Location 13:60245510-60245532
Sequence TCCCTATGTGAAGGGAGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109270015_1109270018 15 Left 1109270015 13:60245472-60245494 CCAACTTGGAGTCAGATCTTGGA No data
Right 1109270018 13:60245510-60245532 TCCCTATGTGAAGGGAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109270018 Original CRISPR TCCCTATGTGAAGGGAGTAG TGG Intergenic
No off target data available for this crispr