ID: 1109278100

View in Genome Browser
Species Human (GRCh38)
Location 13:60324205-60324227
Sequence ATAAGACATCTGGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109278100_1109278105 27 Left 1109278100 13:60324205-60324227 CCACACCTGGCCAGATGTCTTAT No data
Right 1109278105 13:60324255-60324277 ATGCATGAATTTTAGAGATTAGG No data
1109278100_1109278103 1 Left 1109278100 13:60324205-60324227 CCACACCTGGCCAGATGTCTTAT No data
Right 1109278103 13:60324229-60324251 TAATCATTCCTCTAACTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109278100 Original CRISPR ATAAGACATCTGGCCAGGTG TGG (reversed) Intergenic
No off target data available for this crispr