ID: 1109287525

View in Genome Browser
Species Human (GRCh38)
Location 13:60427902-60427924
Sequence GGTAGCAAATTACCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 708
Summary {0: 1, 1: 0, 2: 8, 3: 114, 4: 585}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109287525 Original CRISPR GGTAGCAAATTACCACAAGC TGG Intronic
900282035 1:1876186-1876208 TGTAGCAAATCATCACAAGTTGG - Intronic
900829959 1:4958921-4958943 TATAACAAATTACCACAAGCTGG + Intergenic
901181884 1:7347551-7347573 CATAGCAAATTACCACAAACTGG + Intronic
901794807 1:11673963-11673985 GACAGTAAGTTACCACAAGCTGG - Exonic
902489841 1:16773235-16773257 TGTAACAAATTACCACAAACTGG + Intronic
902699946 1:18165195-18165217 CATAGCAAAATACCACAAACTGG + Intronic
903473674 1:23605087-23605109 TATAACAAAGTACCACAAGCTGG - Intronic
904390238 1:30180180-30180202 GGTAACAAATTCACACAAACTGG - Intergenic
904842754 1:33383992-33384014 CTTAACAAATTACCACAAACTGG - Intronic
906115806 1:43356398-43356420 TGTAACAAAGTACCACAAACTGG - Intergenic
906732891 1:48098416-48098438 CATAACAAATTACCACAAACTGG - Intergenic
907148447 1:52259008-52259030 GTTAGCAAAATACCACAAATTGG + Intronic
907581760 1:55578548-55578570 TGTAGCAAATTACCCTAAGATGG + Intergenic
907683861 1:56590809-56590831 TGTAACAAATTACCACAAGTTGG - Intronic
908662286 1:66449925-66449947 TGTAACAAAATACCACAAACTGG + Intergenic
909062604 1:70896564-70896586 TGTAACAATTTACCACAAGCTGG - Intronic
909380960 1:74997839-74997861 TGTAGCAAAATACCATAAACTGG - Intergenic
909432189 1:75601639-75601661 GGGACCAAAATAACACAAGCTGG + Intronic
910514745 1:88047330-88047352 TGTAACAAATTACCATAAACTGG - Intergenic
910784766 1:90984186-90984208 TCTAACAAATTACCACAAACTGG - Intronic
910864935 1:91779774-91779796 TGTAACAAATTACCATAAACTGG + Intronic
910882895 1:91938534-91938556 CGTAAGAAAGTACCACAAGCTGG - Intergenic
911709578 1:101054501-101054523 AGTAACAAATTACCACAAACTGG - Intergenic
911834186 1:102595049-102595071 TGTAACAAATGACCACAAACTGG - Intergenic
911933262 1:103932250-103932272 TGTAACAAATTACTACAAGCTGG + Intergenic
912582294 1:110731396-110731418 TGTAACAAAGTACCACAAACTGG - Intergenic
912995163 1:114525900-114525922 TGTAACAAATGACCACAAACAGG + Intergenic
913967719 1:143391068-143391090 TGTAACAAAATAGCACAAGCTGG - Intergenic
914062097 1:144216658-144216680 TGTAACAAAATAGCACAAGCTGG - Intergenic
914117053 1:144749696-144749718 TGTAACAAAATAGCACAAGCTGG + Intergenic
915706969 1:157853380-157853402 TATAACAAATTACCACAAACTGG + Intronic
915964854 1:160297640-160297662 GATAGCACATTTCCACAATCTGG + Exonic
916271442 1:162946936-162946958 GGTAACAAATTCCCACAAACTGG - Intergenic
916376577 1:164161082-164161104 TGTAGCAAAATACCATAAACTGG + Intergenic
916740113 1:167640167-167640189 CGTAACAGATTACCACAAACTGG + Intronic
917063511 1:171066569-171066591 TCTAGCAAATTACCACAAACAGG - Intergenic
917294861 1:173507887-173507909 TGTAACAAAGTACCACAAACTGG - Intronic
917522436 1:175759400-175759422 GGCAGCAAAGTACCACAAACCGG + Intergenic
917630675 1:176888430-176888452 GGCAGCCCATTACCACAAGGAGG - Intronic
918503919 1:185230258-185230280 TGTAGCAAAGTATCACAAACTGG + Intronic
918770000 1:188545041-188545063 AGTAACAGATTACCACAAACTGG + Intergenic
919156122 1:193767818-193767840 GGTAACAAAGTACCACAAACTGG - Intergenic
919619903 1:199852620-199852642 TGCAACAAATTACCACAAGTGGG - Intergenic
920740274 1:208575370-208575392 TGTAACAAAGTACCACAACCTGG + Intergenic
920862391 1:209721215-209721237 CATAACAAATTACCACAAACTGG - Intronic
921096121 1:211888807-211888829 TATAGCAAAGTACCACAAACTGG + Intergenic
921716460 1:218422043-218422065 AGTAACAAAGTACCACAAACTGG - Intronic
922873706 1:228923491-228923513 GGTAGGAAATTAATACATGCGGG + Intergenic
923143202 1:231179063-231179085 CATCACAAATTACCACAAGCTGG + Intronic
923530599 1:234809293-234809315 TGTAACAAATTACCACAAACTGG - Intergenic
923766987 1:236901553-236901575 TGTAACAAAATACCACAAACTGG + Exonic
923824748 1:237488256-237488278 TGTAGCAAAATATCACAAACTGG + Intronic
923923618 1:238598217-238598239 GTTAGCAAAATACCACATACTGG + Intergenic
923952923 1:238980310-238980332 GGTAACAAAGTACCACAGACTGG - Intergenic
923993922 1:239470396-239470418 CATAGCAAATTACCACAAACTGG - Intronic
924284891 1:242476012-242476034 CGTAGCAAAATACCACCAACTGG - Intronic
924421500 1:243914234-243914256 AGTAACAAAGTACCACAAACTGG - Intergenic
924493316 1:244561469-244561491 CGTAACAAAGTACCACAAACTGG + Intronic
1063066845 10:2618752-2618774 AATAGCAAATTACCACTACCTGG - Intergenic
1063253697 10:4302985-4303007 CATAGCAAATTACCACCAACTGG + Intergenic
1063634957 10:7773288-7773310 TGTAACAGATTACCACAAACTGG - Intronic
1063802789 10:9599725-9599747 CCTAACAAAATACCACAAGCTGG - Intergenic
1064219186 10:13425121-13425143 TGTAACAAATTACCATAGGCTGG - Intergenic
1065073725 10:22054602-22054624 TGTAACAAAATACCACAGGCTGG + Intergenic
1066188911 10:33037415-33037437 GGTAGCCCCTTTCCACAAGCAGG - Intergenic
1066488826 10:35874564-35874586 GGTTGTAAATTACTTCAAGCTGG - Intergenic
1066589742 10:36981540-36981562 GGTAACAAAGTACCACAAACTGG - Intergenic
1066680084 10:37929799-37929821 TGTAGCAAATTACCACAGACTGG + Intergenic
1067914094 10:50377664-50377686 TGTAACAAATAACCACAAACTGG + Intronic
1068128244 10:52867301-52867323 GGCAGCAAACCACCAGAAGCTGG - Intergenic
1068818531 10:61345987-61346009 TGTAACAAATTCCCACAAACTGG + Intergenic
1069635240 10:69921035-69921057 GGTAACAAAGTACTACAGGCTGG + Intronic
1071974784 10:90944452-90944474 CGTAACAAAGTACCACAAACAGG + Intergenic
1072539011 10:96384366-96384388 CATAACAAATTACCACAAACTGG - Intronic
1072690471 10:97569585-97569607 TGTAACAAAATACCACATGCTGG + Intronic
1073617754 10:105014965-105014987 TGTAGCAAAATACCATAAACTGG - Intronic
1074301787 10:112240167-112240189 GGTAGCACATTTCCACAGGCAGG + Intergenic
1075191608 10:120314832-120314854 TGGAACAAATTACCACAAACTGG + Intergenic
1075234988 10:120719709-120719731 TGTAACAAATGACCACAAACTGG + Intergenic
1075235766 10:120727455-120727477 CATAGCAAAGTACCACAAACTGG + Intergenic
1075514516 10:123098365-123098387 CATAGCAAATTACCATAAACGGG - Intergenic
1076228227 10:128798099-128798121 TGTAACAAATTACAACAAACTGG - Intergenic
1076229523 10:128808473-128808495 TGTAACAAATTACCAAAACCTGG + Intergenic
1076256974 10:129034897-129034919 GGTAGCAAATAGCAACATGCTGG - Intergenic
1076427765 10:130379752-130379774 AGTAGCAAATTACAACAACCTGG + Intergenic
1076433628 10:130424698-130424720 CGTAGCAAATTATCACAAACTGG - Intergenic
1078206409 11:9233851-9233873 GGCAACAAATTACCACAAACTGG - Intronic
1078925732 11:15873126-15873148 TATAACAAATTACCATAAGCTGG - Intergenic
1078990958 11:16645851-16645873 TGTAACAAAGTACCACAAACTGG - Intronic
1079667508 11:23125167-23125189 GGCAGCAAATTAGCACAATTGGG - Intergenic
1080048607 11:27835824-27835846 TGTAGCAAATGACCACAAACTGG + Intergenic
1081188726 11:40077628-40077650 TGTAACAAATTACCACAAACTGG - Intergenic
1081430005 11:42966641-42966663 TGTAACAAATGACCACAAACTGG + Intergenic
1081741405 11:45443505-45443527 TGTGACAAATTATCACAAGCTGG + Intergenic
1083473848 11:62902845-62902867 CGTAACAAAGTACCACAAACTGG - Intergenic
1084073705 11:66755630-66755652 TGTAACAAAGTACCACAAACTGG + Intronic
1084330696 11:68428341-68428363 TGTAACAAATGACCACAAACTGG + Intronic
1084581957 11:70029656-70029678 TGTAACAAATTTCCACAAACTGG + Intergenic
1084676631 11:70639279-70639301 CGTAGCAAAATGCCACAAACTGG + Intronic
1084684065 11:70683511-70683533 TGTAACAAATTGCCACAAACCGG + Intronic
1085490525 11:76912391-76912413 CGTAACAAATTACCACAAACTGG - Intronic
1086192163 11:84092735-84092757 CCTAGAAAATTACCACAAACCGG + Intronic
1086411947 11:86552470-86552492 GGTGGCAAGTTACCAAAGGCAGG - Intronic
1086453979 11:86943701-86943723 TGTAACAAATTATCACAAACTGG + Intronic
1086546582 11:87974895-87974917 CGTAACAAACTACCACAAACTGG + Intergenic
1086999489 11:93400181-93400203 TGTAACAAAGTACCAAAAGCTGG + Intronic
1087737509 11:101851535-101851557 TGTAACAAATTACTACAAACTGG + Intronic
1088278856 11:108116936-108116958 AGCAGCAAATTACCACCAACTGG - Intergenic
1088574866 11:111260769-111260791 TGTAACAAATTATCACAAACAGG - Intronic
1089157976 11:116416545-116416567 TGTAACAAATTACCATAAACTGG - Intergenic
1089187213 11:116627426-116627448 TGTAACAAAGTACCACAAACTGG + Intergenic
1090681097 11:129058039-129058061 TGTAGTAAAATACCACAAACTGG - Intronic
1091017564 11:132066472-132066494 TGTAACAAATTACCACAAACTGG + Intronic
1091041310 11:132284223-132284245 GGTAACAAAGTACCACAGCCTGG + Intronic
1091493676 12:953681-953703 TGTAACAAATTACCACAACTGGG - Intronic
1091615252 12:2046161-2046183 CATAGCAAATTACCACTAGCTGG - Intronic
1091891484 12:4058488-4058510 TGTAACAAATTGCCACAAACTGG + Intergenic
1092732644 12:11548463-11548485 TGTAATAAATGACCACAAGCTGG - Intergenic
1093974874 12:25410588-25410610 TGTAACAAAGTACCACAAACTGG - Intronic
1094031784 12:26020394-26020416 AGTAGCAAATTACCACAAACTGG - Intronic
1094120328 12:26967196-26967218 TCTAACAAATTACCACAGGCTGG - Intergenic
1094318684 12:29160580-29160602 TGTAACAAAGTACCACAAACTGG + Intronic
1094466876 12:30762816-30762838 GGCTACAAATTACCACAAACTGG - Intergenic
1095569636 12:43669687-43669709 TGTAGCAAGTTACCACAAATTGG - Intergenic
1095933780 12:47655097-47655119 AGTAACAAATTACCATAAACTGG + Intergenic
1095967959 12:47882264-47882286 AGCAGCAAATAACCTCAAGCAGG - Intronic
1096261911 12:50098237-50098259 TGTAGCAAACTACCACAAACTGG + Intronic
1097393879 12:59050057-59050079 TATAACAAATTACCACAAACTGG + Intergenic
1098131781 12:67358710-67358732 TGTAACAAAGTGCCACAAGCTGG + Intergenic
1098606863 12:72402036-72402058 TGTAGAAAAGTACCACAAACTGG + Intronic
1098621305 12:72602961-72602983 GGTAGAAAAATACCAAAAGAAGG + Intronic
1098686371 12:73426051-73426073 TATAACAAATTACCATAAGCTGG + Intergenic
1099161034 12:79242135-79242157 TGTAACAAATGACCACAAACTGG - Intronic
1099410806 12:82324130-82324152 CATAACAAATTACCACAATCTGG - Intronic
1099450256 12:82799484-82799506 TGTAGCAAAGTACCACAGACTGG + Intronic
1099747933 12:86731615-86731637 GGAAACAAAGTGCCACAAGCTGG - Intronic
1099932982 12:89095022-89095044 GCTAGCAAACCACCAGAAGCTGG + Intergenic
1100324886 12:93531421-93531443 TGTAACAAATTACCACAAACCGG + Intergenic
1100580058 12:95930257-95930279 TGTAGCAGATTACCACAAACAGG + Intronic
1100664689 12:96738332-96738354 TGTAGCAAAGTACCAAAAACTGG + Intronic
1100772325 12:97937085-97937107 CCTAACAAATTACCACAAACTGG + Intergenic
1100825859 12:98473565-98473587 CGTAACAAATTACCACAAACTGG - Intergenic
1101054331 12:100896610-100896632 TTTAACAAATTACCACAACCAGG - Intronic
1101191313 12:102336398-102336420 CATAACAAATTACCACAAACTGG - Intergenic
1101328101 12:103734694-103734716 CATCACAAATTACCACAAGCTGG + Intronic
1101395107 12:104340404-104340426 TGTAACAAAGTACCACAAACTGG + Intronic
1101505328 12:105341042-105341064 TGTAACAAATTACCACAAACTGG - Intronic
1101653396 12:106697494-106697516 TGTAACAAATTACCACAAACTGG + Intronic
1101702863 12:107191755-107191777 TGTAACAAATTATCACAAGCTGG + Intergenic
1101953442 12:109193969-109193991 GGTAACAAGGTACCACAAACTGG + Intronic
1102722817 12:115032831-115032853 CGTAACAAATTGCCACAAACTGG - Intergenic
1103033912 12:117641014-117641036 TGTAACAAAGTACCACAAACTGG + Intronic
1103061847 12:117864541-117864563 TGTAACAAAGTACCACAAGTTGG + Intronic
1103859062 12:123997336-123997358 TGTAACAAAGTACCACAAGCTGG + Intronic
1103884353 12:124189632-124189654 TGTAGCAAATTACCATAGGATGG + Intronic
1104077102 12:125399659-125399681 TGTAACAAATTACCACAAACTGG - Intronic
1104574331 12:129953035-129953057 CGTAATAAATTACCACAAACTGG - Intergenic
1105249963 13:18689562-18689584 TGTAACAAAGTACCACAAACCGG - Intergenic
1105968133 13:25403317-25403339 TGTAACAAAATACCACAGGCTGG - Intronic
1106329925 13:28730624-28730646 GGTAACAAAGTACCACAAGCTGG + Intergenic
1107245241 13:38286184-38286206 TGTAACAAATTACCATAAACTGG - Intergenic
1107658094 13:42612431-42612453 GATAACAAATGACCACAAACTGG + Intergenic
1107912825 13:45121549-45121571 GTTAGCAAATGATCACAAGGGGG - Intronic
1107948955 13:45444917-45444939 TGTAGCAAATTACCACAGACTGG - Intergenic
1108701202 13:52945764-52945786 CATAGCAAATTACCACAAACTGG + Intergenic
1108825216 13:54405550-54405572 TGTAACAAATTACCACAAACTGG + Intergenic
1108843549 13:54651067-54651089 TGTAGTAAAGTACCACAAACTGG + Intergenic
1109261963 13:60155995-60156017 TGTAACACATTACCACAAACTGG + Intronic
1109287525 13:60427902-60427924 GGTAGCAAATTACCACAAGCTGG + Intronic
1109738763 13:66522889-66522911 TGTAGCATATTACCATAAGCTGG - Intronic
1110482642 13:75998522-75998544 TGTAGCAAAATACCAAAAGCTGG + Intergenic
1111622946 13:90747547-90747569 TGTAACAAAGTACCACAAACTGG + Intergenic
1111760796 13:92461851-92461873 TGTAACAAATTACCACAGACAGG - Intronic
1111927712 13:94480880-94480902 TGTAACAAATGACCACAAACTGG + Intergenic
1112569462 13:100580570-100580592 CATAGCAAATTACCACAAACTGG - Intronic
1112584777 13:100708595-100708617 TGTAGCAAAATACCACAGACAGG + Intergenic
1113220075 13:108090096-108090118 GGTAATAAATTACTACAAACAGG - Intergenic
1113223692 13:108134953-108134975 TGTAACAAAGTACCACAAACTGG - Intergenic
1115502856 14:34064745-34064767 GTTAATAAATTACCACAAACTGG - Intronic
1115620955 14:35139736-35139758 CCTAACAAATTACCACAAACTGG + Intronic
1117410875 14:55449818-55449840 TGTAACAAATTACCACATCCCGG - Intronic
1117845978 14:59912400-59912422 TGTAACAAATTACCGCAAACTGG + Intergenic
1118087409 14:62433594-62433616 TGTAACAAATTATCACAAACTGG + Intergenic
1118869220 14:69727341-69727363 CGTAACAAATTACCACTAACTGG + Intronic
1120366648 14:83579964-83579986 TTCAGCAAATTACCACAAGCCGG - Intergenic
1120673046 14:87386536-87386558 TGTAAGAAATTACCACAAGCTGG - Intergenic
1120991382 14:90380463-90380485 TGTAACAAAATACCACAGGCTGG - Intergenic
1121014022 14:90537489-90537511 TGCAGCAAATTACCATAAACTGG - Exonic
1121754799 14:96393377-96393399 GGTAACCAATTGCCACAAACTGG + Intronic
1121813939 14:96914744-96914766 TGTAACAAATTAGCACAAACTGG + Intronic
1121944049 14:98102295-98102317 TGTAACAAATTATCACAAACTGG + Intergenic
1121992061 14:98567822-98567844 TGTAACCAATTACCACAAACTGG - Intergenic
1122483196 14:102060981-102061003 GCCAACAAATTACCACAAACTGG - Intergenic
1126568948 15:50129252-50129274 AATAGCAAAGTACCACAAGCTGG + Intronic
1126681090 15:51202822-51202844 TGCAACAAATTACCACAAACTGG - Intergenic
1127308543 15:57730918-57730940 CATAACAAATTACCACAAACTGG - Intronic
1127616356 15:60690031-60690053 GGTAACAAAGTGCCACAAACTGG - Intronic
1127991439 15:64121229-64121251 TGTAGCAAAGTACCACAAACTGG + Intronic
1128132418 15:65237784-65237806 TGTAACAAATTACCACAGACTGG - Intronic
1129524657 15:76206058-76206080 GGAAGGAAATTACCACGTGCTGG + Intronic
1129789114 15:78328868-78328890 GCTATCAAATCACCACAACCTGG + Intergenic
1129923826 15:79344297-79344319 TGTAACAAATGACCACAAACTGG + Intronic
1130660540 15:85828510-85828532 TGTAACAAATTACCACAAACTGG + Intergenic
1130676914 15:85960972-85960994 TATAACAAAGTACCACAAGCTGG - Intergenic
1131369166 15:91865451-91865473 TGTAACAAATTACCACAAACTGG + Intronic
1131545857 15:93314897-93314919 GGGAGCAAAATACCACAATCTGG + Intergenic
1131673295 15:94645269-94645291 TGTAACAAATGACCACAACCGGG - Intergenic
1133245460 16:4445846-4445868 GGTAACAAAATATCACAGGCCGG - Intronic
1133268001 16:4596123-4596145 CGAGACAAATTACCACAAGCAGG + Intronic
1133527578 16:6620893-6620915 CTTAACAAATTACCACAAACTGG + Intronic
1133741920 16:8658357-8658379 GGTAACAAATGACCACAAACTGG - Intergenic
1134077473 16:11302063-11302085 GGTAACAAATTCCCACAGACTGG + Intronic
1134855051 16:17511526-17511548 TGTAACAAAGTCCCACAAGCTGG + Intergenic
1135178485 16:20252405-20252427 TGTAACAAATTGCCACAAACTGG + Intergenic
1136243792 16:28961440-28961462 TGTAACAAAGTACCACAAGTTGG + Intronic
1136929050 16:34402694-34402716 TGTAACAAATTACCATAGGCTGG + Intergenic
1136975524 16:35009110-35009132 TGTAACAAATTACCATAGGCTGG - Intergenic
1137952887 16:52800300-52800322 TGTAACAAAGTACCACAGGCCGG - Intergenic
1139151003 16:64381665-64381687 GGTAGCTCCTTTCCACAAGCAGG - Intergenic
1140144345 16:72291114-72291136 CATAACAAATTACCACAAACTGG + Intergenic
1140588221 16:76319905-76319927 AGTAGCAAAGTACTACAAACAGG - Intronic
1140764165 16:78140389-78140411 TGTAGCAAAGTACCATAAACTGG + Intronic
1140828545 16:78729706-78729728 TGTAACAAATTACCACAAACTGG - Intronic
1140908822 16:79432823-79432845 GGCAGCCAACTACCAGAAGCTGG + Intergenic
1141481495 16:84309566-84309588 CGTAACAAATGACCACAAACTGG + Intronic
1141650688 16:85391368-85391390 CGTAACAAAGTACCACAAACTGG + Intergenic
1141922848 16:87147489-87147511 GATAACAAATGACCGCAAGCAGG - Intronic
1142510688 17:390782-390804 CCTAGTAAATTACCACAAACTGG - Intergenic
1142897133 17:2988341-2988363 GATAGCACAATACCACAACCAGG + Intronic
1143832832 17:9666036-9666058 GACAGCAAATTATCACAAACTGG - Intronic
1143993016 17:10982764-10982786 TGTAACAAAGTACCACAGGCTGG + Intergenic
1144336004 17:14269483-14269505 TGTAACAAATTACCACAAACTGG + Intergenic
1144409540 17:14987123-14987145 CGTAGCAAATTACCCCTATCTGG + Intergenic
1146206411 17:30908703-30908725 TGTAACAAATGACCACAAACTGG - Intronic
1146312471 17:31779799-31779821 GGTAACAAACTATCACAAACTGG - Intergenic
1147001018 17:37362221-37362243 TATAGCAAAGTACCACAAACTGG - Intronic
1147764944 17:42828215-42828237 TGTAGCAAAGTACCACAAAGTGG - Intronic
1148481675 17:47963609-47963631 TGTAACAAATCACCACAAACTGG - Intergenic
1149189057 17:54036638-54036660 TGTAACAAATTACCATAAACTGG + Intergenic
1150249165 17:63696710-63696732 AGTAGCAGATGACCACAAGGGGG - Exonic
1150482587 17:65522006-65522028 TGTAGCAAAGTACCACAAATTGG - Intergenic
1150579112 17:66456264-66456286 CCCAGCAAAGTACCACAAGCTGG - Intronic
1150582054 17:66483189-66483211 CATAACAAATTACCACAAACCGG + Intronic
1150841043 17:68605595-68605617 TGTAACAAAGTGCCACAAGCTGG - Intergenic
1151232676 17:72695967-72695989 CCTAACAAATTACCACAAACTGG - Intronic
1151264219 17:72941432-72941454 TGTAGCAAAATACCACAAACCGG - Intronic
1151307249 17:73271103-73271125 TGTAACAAATTACCACAAATTGG - Intergenic
1151400963 17:73855780-73855802 TGTAACAAATTACCAGAAACTGG - Intergenic
1151968292 17:77443846-77443868 AGTTGCAACTTTCCACAAGCAGG - Intronic
1152478028 17:80531086-80531108 TGTAACAAAGTACCACAAACTGG - Intergenic
1153367421 18:4273121-4273143 AGTAACAAATTACCACAAATAGG - Intronic
1153933875 18:9903190-9903212 CGTAACAAATTATCACAAACTGG - Intergenic
1154438863 18:14369334-14369356 TGTAACAAAGTACCACAAACTGG + Intergenic
1155766738 18:29643932-29643954 GGCAGCAAATTACAGCTAGCTGG - Intergenic
1156109857 18:33713207-33713229 GTTAGCAATCTACCACAAGAAGG + Intronic
1156221305 18:35055142-35055164 CATAACAAATTACCACAAACCGG + Intronic
1156686772 18:39658821-39658843 GGAATCAAATTACAAGAAGCAGG - Intergenic
1157000878 18:43523024-43523046 TGTAACAAGTTACCACAAACGGG + Intergenic
1157451268 18:47790934-47790956 CGTAACAAAATACCACAAACTGG + Intergenic
1158403379 18:57140734-57140756 TGTAGCAAAGTACCACAGACTGG - Intergenic
1158415683 18:57247923-57247945 TGTAACAAAGTACCACAAACTGG + Intergenic
1158565522 18:58551186-58551208 GGCTGCAAATGACCACAAACTGG + Intronic
1158733683 18:60055289-60055311 TGTAACAAAATACCACAAACTGG + Intergenic
1158827114 18:61235142-61235164 CGTAACAAAGTACCACAAACTGG + Intergenic
1158847587 18:61461299-61461321 CGTAACAAAGTACCACAAGCTGG + Intronic
1158979852 18:62749504-62749526 GATAGCAAAATACCACAAACTGG + Intronic
1159643707 18:70892493-70892515 GGTAACAAAGTACCATGAGCTGG - Intergenic
1160038047 18:75319487-75319509 GGTAGCAGATCTCCAAAAGCTGG - Intergenic
1160064881 18:75565456-75565478 TGTACCACATTACCACAAACTGG + Intergenic
1160389326 18:78518321-78518343 TGTAGCAAAGTGCCACAAACTGG - Intergenic
1161228596 19:3160647-3160669 CGTAACAAAGTACCACAAACTGG + Intronic
1161243909 19:3238415-3238437 TGTAACAAATGACCACAAACTGG + Intronic
1163563497 19:18035333-18035355 GGTAACAGAATACCACAGGCTGG - Intergenic
1163687628 19:18720933-18720955 TGTAACAAATGACCACAAACTGG + Intronic
1165368105 19:35382395-35382417 GGTCTCAAATTTCCACAAGGAGG - Intergenic
1165643980 19:37417572-37417594 TGAAACAAAGTACCACAAGCTGG - Intronic
1165872930 19:38985984-38986006 TGTAGCAAAATACCATAAGCTGG - Intergenic
1167199245 19:48052752-48052774 TGTAACAAAATACCACTAGCTGG - Intronic
1168497031 19:56862015-56862037 GTCAGCAAATTACAGCAAGCAGG + Intergenic
1168510883 19:56972818-56972840 GCTAACAAAATACCACAAACTGG + Intergenic
1168585402 19:57587664-57587686 GCTAGCATAATACCACAAACTGG - Intronic
1202701506 1_KI270712v1_random:168536-168558 TGTAACAAAATAGCACAAGCTGG - Intergenic
925465438 2:4104212-4104234 AGTAGCAAAATACCACCAGCTGG + Intergenic
927203469 2:20592570-20592592 CATAGCAAATGACCACAAACTGG + Intronic
927235273 2:20868001-20868023 TATAACAAATTACCACAAACTGG - Intergenic
927451226 2:23211135-23211157 CATAACAAATTACCACAAGCTGG - Intergenic
927654355 2:24932898-24932920 CATAACAAATTACCACAAACTGG + Intergenic
928138489 2:28707073-28707095 TGTAACAAATTAGCACAAACTGG - Intergenic
928564611 2:32532221-32532243 TGTACCAAAATACCACAAACGGG + Intronic
928945203 2:36765881-36765903 TGTAACAAACTACCACAAACTGG - Intronic
929796827 2:45066023-45066045 CATAACAAATTACCACAAACCGG - Intergenic
930551098 2:52835853-52835875 CATAACAAATTACCACAAACTGG + Intergenic
931241298 2:60454648-60454670 GTGAGCAAAGTACTACAAGCAGG + Intronic
931500130 2:62856017-62856039 GGTAGCTCCTTTCCACAAGCAGG - Intronic
931749319 2:65316980-65317002 AGCAGCAAATTGCCACAACCAGG - Intronic
931898739 2:66763998-66764020 GATAACAAAGTACCACAAGTTGG - Intergenic
932177358 2:69615025-69615047 AGTAACAAATGACCACAAACTGG - Intronic
932373058 2:71208983-71209005 TGTGACAAATTACCACAAACTGG - Intronic
932385351 2:71327370-71327392 CGTAACAAATCACCACAAGTTGG - Intronic
932848250 2:75156735-75156757 TATAACAAATTACCACAAACTGG - Intronic
932981365 2:76672340-76672362 CGTAACAAATTACCACAAACTGG + Intergenic
933541132 2:83644052-83644074 CCTAACAAATTACCACAAACTGG + Intergenic
934172423 2:89551983-89552005 TGTAACAAAATAGCACAAGCTGG - Intergenic
934282736 2:91626335-91626357 TGTAACAAAATAGCACAAGCTGG - Intergenic
934513739 2:94970555-94970577 GGTAGCAGATGACCAGAAGGAGG - Intergenic
935599226 2:104905526-104905548 TGTAACAAATCACCACAAACTGG + Intergenic
935626493 2:105176107-105176129 GATAGCAAAGTACCATAAACTGG - Intergenic
935639863 2:105280506-105280528 GGTAGCAAATGGCTACAAGGAGG - Exonic
935667585 2:105525838-105525860 GGTAGCTCCTTTCCACAAGCAGG - Intergenic
935801232 2:106698431-106698453 GGTCTCAAATTTCCACAAGGAGG + Intergenic
935895266 2:107730281-107730303 TGTAGTAAAATACCACAACCAGG - Intergenic
936996707 2:118423251-118423273 TATAATAAATTACCACAAGCTGG + Intergenic
937008447 2:118539911-118539933 TGTATCAAATTGCCACAACCTGG + Intergenic
937561576 2:123231139-123231161 GGTAGCAAAGGACCATCAGCTGG + Intergenic
937645038 2:124257210-124257232 CATAACAAATTACCACAAACTGG - Intronic
938079068 2:128359639-128359661 GGTAACTCATTACCACAAGGAGG - Intergenic
938160760 2:128982737-128982759 GGTAACAAAGTACCACAGTCTGG - Intergenic
939892809 2:147757701-147757723 TGTAACAAATTTCCACAAACTGG - Intergenic
940153704 2:150630559-150630581 TGTAACAAATTGCCACAAACTGG - Intergenic
941103922 2:161330902-161330924 AATAGAAAATTACCACAGGCAGG - Intronic
941522502 2:166563953-166563975 GGTAACAAATTACCACAAACGGG - Intergenic
941805523 2:169708315-169708337 TGTAACAAATTACTACAAACTGG + Intronic
941992782 2:171573223-171573245 CGTAGCAAACAACCACAAACTGG - Intergenic
942008717 2:171736976-171736998 CATAACAAATTACCACAAACTGG + Intronic
942245733 2:174006166-174006188 TGTAACAAAATACCATAAGCTGG + Intergenic
942804026 2:179908782-179908804 CGTAACAAATTACCACAAACTGG - Intergenic
943070946 2:183139880-183139902 TGTAACAAATTACCACAAACTGG - Intronic
943265933 2:185732424-185732446 TGTAACAAAGTACCACAAGCTGG - Intergenic
943345591 2:186734181-186734203 GGTAGCTCCTTCCCACAAGCAGG + Intronic
943414500 2:187584017-187584039 AGTAGCCAATAACCAGAAGCTGG + Intergenic
943533971 2:189123560-189123582 GATAACAAAGTACCACAAACTGG - Intronic
944175226 2:196821317-196821339 TGTAACAAATTACCAAAAACTGG - Intergenic
944345138 2:198654945-198654967 GGTAGCAAATAACCCCAAGATGG + Intergenic
944677830 2:202048940-202048962 TGTAACAAACTACCACAAACTGG - Intergenic
944922960 2:204434578-204434600 TGTAACAAATCACCACAAACTGG - Intergenic
945323462 2:208454617-208454639 GATAGCAAAATACCACAGGCTGG - Intronic
945972451 2:216243849-216243871 TATAACAAATTACCACAGGCTGG + Intergenic
946460828 2:219867104-219867126 TGTAACAAAGTACCACAAACTGG + Intergenic
946554407 2:220839112-220839134 GCTAGCAAAATACCAGTAGCGGG - Intergenic
946867518 2:224055770-224055792 TGTAACAAATTACCACAAACTGG + Intergenic
947352515 2:229261271-229261293 AATAGCAAAGTACCACAAACCGG - Intronic
947534515 2:230932317-230932339 GGCAGAAAATTACCACCGGCTGG + Intronic
947956396 2:234195820-234195842 TGAAGCAAAGTGCCACAAGCTGG + Intergenic
948147906 2:235722219-235722241 GGTAACAAAGTACCACAAACTGG + Intronic
948287804 2:236800631-236800653 TGTAACAAATGGCCACAAGCTGG + Intergenic
948658547 2:239492085-239492107 AGTAACAAATGACCACAAACTGG + Intergenic
948719326 2:239888535-239888557 TGTAACAAAGTACCACAGGCTGG - Intergenic
1169486620 20:6039988-6040010 TGTAACAAGTTACCACAAACTGG - Exonic
1169517919 20:6337830-6337852 TGCAACAAATTACCACAAACTGG - Intergenic
1170054505 20:12185539-12185561 TGTAACAAAATACCACAAACTGG - Intergenic
1170327888 20:15176576-15176598 GGAAGCTCATTTCCACAAGCAGG - Intronic
1170467473 20:16635929-16635951 TATAACAAATTACCACAAACTGG - Intergenic
1172585911 20:36084409-36084431 CATAACAAATTACCACAAGCTGG + Intergenic
1173531913 20:43776286-43776308 GGTAACAAAGTGCCACAAGCGGG + Intergenic
1174505698 20:51016107-51016129 TGTCACAAATTACCACAAACTGG - Intronic
1174627410 20:51927107-51927129 TGTAACAAATTACCACAGACAGG - Intergenic
1175056260 20:56201429-56201451 TGTAACAAATTCCCACAAACTGG - Intergenic
1175115061 20:56676325-56676347 CCTAACAAATCACCACAAGCTGG - Intergenic
1175163183 20:57023842-57023864 TGTAACAAATGACCACAAACTGG - Intergenic
1175669906 20:60893126-60893148 TGTAACAAATGACCACAAACTGG - Intergenic
1175671907 20:60910571-60910593 CGTAGCAAAGTACCACAGACTGG + Intergenic
1175850019 20:62085274-62085296 TGTGACAAATCACCACAAGCTGG - Intergenic
1176456819 21:6920098-6920120 TGTAACAAAGTACCACAAACTGG - Intergenic
1176696524 21:9984107-9984129 TGGAACAAATTACCACAAACTGG - Intergenic
1176834992 21:13785158-13785180 TGTAACAAAGTACCACAAACTGG - Intergenic
1177107458 21:16977972-16977994 CATAACAAAGTACCACAAGCAGG + Intergenic
1177302813 21:19272000-19272022 GGTAACAAAATACCACAAACTGG + Intergenic
1177318398 21:19490869-19490891 GGCAGCAAATTGTCACAAACTGG + Intergenic
1177388835 21:20441029-20441051 TGTAACAAATTATCACAAACTGG - Intergenic
1177596256 21:23247365-23247387 TGCAGCAAATTACCATAAACTGG + Intergenic
1177698961 21:24612036-24612058 TGTAACTAATTACCACAAACTGG + Intergenic
1177993603 21:28068725-28068747 GGTGGCAAATTTTCACATGCTGG + Intergenic
1178433579 21:32537411-32537433 TGTAACAAATTGCCACAAACTGG + Intergenic
1178807026 21:35847759-35847781 TGCAACAAATTACCACAAACTGG + Intronic
1178911039 21:36673950-36673972 CGTAACAAATCACCACAAACTGG - Intergenic
1179047695 21:37861196-37861218 TGTAACAAAGTACCACAAACTGG + Intronic
1179513760 21:41892405-41892427 TGTATCAAAGTACCACAAACTGG - Intronic
1179531651 21:42023582-42023604 TGTAATTAATTACCACAAGCAGG + Intergenic
1179804251 21:43826936-43826958 AGCAGCAAATTAGCACAAGGTGG + Intergenic
1179910713 21:44446424-44446446 TGTAGCAAAATGCCACAGGCCGG + Intergenic
1179972465 21:44843908-44843930 TTTAGCAAAATACCCCAAGCTGG - Intergenic
1180981925 22:19882570-19882592 GGTACCAAATCACCACACACGGG - Intronic
1180993313 22:19951782-19951804 AGTGGAAAATTACCAAAAGCAGG + Intronic
1181515699 22:23410620-23410642 CGTAACAAAATACCACAGGCTGG + Intergenic
1182192234 22:28473987-28474009 TGTAACAAAGTACCACAAACTGG - Intronic
1182606025 22:31504589-31504611 TGTAACAAAGTACCACAAACCGG + Intronic
1182670742 22:31993690-31993712 TGTAACAAATTACCACAAATTGG + Intergenic
1182808392 22:33095150-33095172 TGTAACAAATTACCACAAAGTGG + Intergenic
1184329281 22:43816219-43816241 GGTAACAAATTTCCACAGACTGG + Intergenic
949285054 3:2392819-2392841 TGTAACAAAGTACCACAAACTGG + Intronic
950550481 3:13663178-13663200 TGTAGCAAATTCCCACAAATGGG + Intergenic
950817621 3:15722900-15722922 CGTAGAGAATTACCACAAACTGG - Intronic
951201836 3:19883960-19883982 TGTATCAAAGTACCACAAACTGG - Intronic
951429754 3:22592802-22592824 TGTAACAGATTACCACAAGCTGG + Intergenic
951495514 3:23320888-23320910 TGTAACAAATTACCATAATCTGG + Intronic
952086357 3:29826525-29826547 TGTAACAAACTACCACAAACTGG + Intronic
952135619 3:30415948-30415970 CATAACAAAATACCACAAGCTGG - Intergenic
952218548 3:31301695-31301717 CGTAACAAAATACCACAAGCTGG + Intergenic
952872786 3:37916732-37916754 TATATCAAAGTACCACAAGCAGG - Intronic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
953442173 3:42927708-42927730 CATAACAAATTACCACAGGCTGG - Intronic
954889096 3:53906910-53906932 TGTAACAAATTACTACAAACTGG + Intergenic
955064976 3:55526297-55526319 TGTAACAAAGTACCACAAACTGG - Intronic
955497121 3:59545304-59545326 GGTAACAAAGTGCCACAAACTGG - Intergenic
955507918 3:59650517-59650539 TATAACAAATTACCACAAGATGG - Intergenic
955597090 3:60603001-60603023 TGTAGCAAAATACCATAAACTGG - Intronic
955888810 3:63628718-63628740 TGTAACAAAATACCACACGCTGG - Intergenic
956323831 3:68028464-68028486 TGTAACAAGTTACCACAAACTGG + Intronic
956752387 3:72353648-72353670 CGTAACAAAGTACCACAAACTGG - Intergenic
956801524 3:72763884-72763906 TGTAACAAATTACCACAGACTGG - Intronic
956944018 3:74198156-74198178 TGTAACAAAGTGCCACAAGCTGG - Intergenic
957300105 3:78381112-78381134 TGTAACAAAATACCACATGCTGG + Intergenic
957314126 3:78555924-78555946 GATAGCAAATTACTACAAACTGG + Intergenic
957368080 3:79252581-79252603 TGTAACAAATTACCACAAACTGG - Intronic
957586169 3:82135335-82135357 TGTAACAAATTACTACAAACTGG + Intergenic
957682890 3:83460408-83460430 TGTAATAAATTACCACAAACTGG - Intergenic
957832660 3:85543617-85543639 TATAGCAAAATACCACAGGCTGG + Intronic
958552343 3:95632436-95632458 TGTAACAAAGTAGCACAAGCTGG - Intergenic
959830311 3:110853770-110853792 CGTAACAAAGTACCACAACCTGG - Intergenic
960235479 3:115277158-115277180 TGTAACAAAGTACCACAAACTGG + Intergenic
960475848 3:118127109-118127131 GGTAGCTAACCACCAAAAGCTGG - Intergenic
960851559 3:122060039-122060061 GGTAACAAAGTACCACAAACTGG - Intronic
962166044 3:133049352-133049374 GGTAGCCACTAACCACAAGTGGG - Intronic
962930031 3:140027549-140027571 AGTAACAAATTACCACAAACTGG - Intronic
963283262 3:143407883-143407905 CGTAACAAATTACCATAAACTGG + Intronic
963669052 3:148229418-148229440 TGTAACAAAGTACCACAAACTGG + Intergenic
964210457 3:154221008-154221030 GCCAGCAAACTACCAGAAGCTGG + Intronic
964795015 3:160487583-160487605 TGAAGCAAAGTACCACAAACTGG + Intergenic
965205168 3:165712959-165712981 GGTAGCTCCTTTCCACAAGCAGG + Intergenic
965290947 3:166879583-166879605 GGTAACAAAGTACCACAATCTGG + Intergenic
965418489 3:168426952-168426974 TGTAACAAATTACCACACACTGG - Intergenic
965458692 3:168933765-168933787 CATAGCAAAGTACCACAAACTGG + Intergenic
965898731 3:173612726-173612748 TGTAACAAAGTACCACAAACTGG + Intronic
965903184 3:173669288-173669310 TGTAACAAAGTACCACAAACTGG + Intronic
966109089 3:176375523-176375545 CATAACAAATTACCACAAGCTGG + Intergenic
966727718 3:183122513-183122535 AGCAGCAAGTTACCACAAGATGG + Exonic
967723168 3:192836711-192836733 CGTAGCAAAATACCACAGACAGG - Intronic
967817009 3:193808185-193808207 CGTAGCAAACGATCACAAGCTGG + Intergenic
969280783 4:6169566-6169588 TGTAACAAATTTCCACAATCTGG - Intronic
970067772 4:12118762-12118784 CATAACAAATTACCACAAGTGGG - Intergenic
970370702 4:15403326-15403348 TTTAGCAAATTACCACAACCTGG + Intronic
970721620 4:18995698-18995720 TGTGGCAAATTCCCTCAAGCTGG - Intergenic
970878168 4:20896729-20896751 TGTAACAAATTTCCACAAACTGG - Intronic
972292769 4:37705248-37705270 TGTAACAAAATACCACAAACTGG + Intergenic
972387050 4:38577332-38577354 TGTAACAAATTACCAGAAACTGG - Intergenic
972578617 4:40375107-40375129 CATAGCAAAATACCACATGCTGG - Intergenic
973173025 4:47168741-47168763 TGTAGCAAAGTACCACAAACTGG + Intronic
973879012 4:55249954-55249976 AGTAACAAATTACCACAAACTGG - Intergenic
974419811 4:61658886-61658908 TGTAACAAAGTACCACAAACAGG + Intronic
974546535 4:63315735-63315757 GGTAACAAAGCACCACAAACTGG + Intergenic
974796093 4:66752178-66752200 GATAACAAAATACCATAAGCTGG + Intergenic
976660375 4:87534511-87534533 CATAACAAATTACCACAAGCTGG + Intergenic
976676160 4:87705725-87705747 TGTAACAAATTACCACAAACTGG + Intergenic
976956580 4:90908916-90908938 CGTAACAAAGTACCACAAACTGG + Intronic
977306073 4:95324894-95324916 TGTAGCAAAATACCACAGCCTGG - Intronic
977366654 4:96077777-96077799 CATAACAAAGTACCACAAGCTGG + Intergenic
977860523 4:101953904-101953926 TGTAGCAAATTACCACAAACTGG + Intronic
978227918 4:106360916-106360938 TGTAACAAAGTACCACAACCTGG - Intergenic
978322298 4:107510928-107510950 TGGAACAAATTACCACAAACTGG - Intergenic
978612167 4:110554449-110554471 GGTAAAAATTTATCACAAGCAGG - Intronic
978707749 4:111735850-111735872 GGTACCAAACTAGAACAAGCAGG + Intergenic
979135415 4:117105542-117105564 TGTAACAAATTGCCACAAACTGG - Intergenic
979350053 4:119632881-119632903 CGTAACAAAGTACCACACGCTGG - Intergenic
979474046 4:121134030-121134052 CATAACAAAATACCACAAGCTGG - Intronic
979656753 4:123203805-123203827 TATAACAAATTACCACAGGCTGG + Intronic
980369136 4:131844274-131844296 TGGAACAAATTACCACAAACTGG - Intergenic
980501058 4:133654847-133654869 GGTAACAAAATACCACAGACTGG + Intergenic
980593195 4:134918199-134918221 AGTAACAAAGTACCACAAACTGG - Intergenic
980975160 4:139604234-139604256 TGTAACAAATTATCACAAACTGG + Intronic
982363831 4:154553165-154553187 TGTAACAAAGTACCACAAACTGG + Intergenic
982434444 4:155367510-155367532 TGTAACAAATTGCCACAAACTGG - Intronic
982559315 4:156910149-156910171 GGTAACAAACTGCCCCAAGCAGG - Intronic
983082559 4:163404798-163404820 TGTAGCAAAATACCACAAACTGG - Intergenic
984842270 4:184079588-184079610 GATAACAAACGACCACAAGCTGG + Intergenic
984948964 4:184992459-184992481 TGTAGCATGTTACCACAAACTGG + Intergenic
985034441 4:185824081-185824103 CGTAGCAAAGTACCCCAAACCGG + Intronic
985130915 4:186737798-186737820 CATAACAAATGACCACAAGCTGG - Intergenic
985404029 4:189618127-189618149 GGAAGAAAATTTCAACAAGCCGG - Intergenic
985729213 5:1537839-1537861 CGTAACAAATTACCACAAAGCGG + Intergenic
986694911 5:10343075-10343097 TGTAGCAAATTATCACAAACTGG + Intergenic
986789093 5:11143298-11143320 TGTAAAACATTACCACAAGCTGG + Intronic
986990693 5:13549531-13549553 TGTAACAAAGTACCACAAACTGG + Intergenic
987299741 5:16586772-16586794 TGTAACAAAATACCACAGGCAGG + Intronic
988387869 5:30590157-30590179 GGTAGTAATTTTCCAGAAGCAGG - Intergenic
988806388 5:34744756-34744778 TGTAACAAATGACCACAAACTGG + Intronic
988958432 5:36343977-36343999 TCTAACAAATTAGCACAAGCTGG + Intergenic
989277210 5:39603086-39603108 TGAAACAAATTACCACAAACTGG + Intergenic
989642823 5:43599933-43599955 TGTAAGAAATTACCACAAACTGG - Intergenic
990002329 5:50908718-50908740 TATAACAAAGTACCACAAGCTGG - Intergenic
990158002 5:52901401-52901423 TGTAACAAATTACCACAAGTTGG - Intronic
990324329 5:54660128-54660150 TGTAACAAACTACCACAAACTGG + Intergenic
990482878 5:56228800-56228822 TGTAACCAATTATCACAAGCTGG - Intronic
990604343 5:57394024-57394046 CATAACAAATTACCACAAACTGG - Intergenic
990724194 5:58735493-58735515 TGTAGCAAAATACCAGAAACTGG + Intronic
992158014 5:73973645-73973667 CATAACAAATTACCACAAGCTGG - Intergenic
992278158 5:75142937-75142959 TGTAACAAATTACCACAAACTGG + Intronic
992957745 5:81927727-81927749 CATAACAAAATACCACAAGCTGG + Intergenic
993294019 5:86110751-86110773 TGTAACAAATTACCACAAATGGG + Intergenic
993619003 5:90146185-90146207 GGTAACAAATTACCATAGACCGG - Intergenic
994671376 5:102765598-102765620 TGTAACAAAGTACCACAAACCGG + Intronic
994931916 5:106199712-106199734 AGTAACAAATTACCACAAATTGG - Intergenic
995240242 5:109877253-109877275 TGTAACAAATTACCACAAACTGG - Intergenic
995469997 5:112491182-112491204 TGTAACAAATTACCACCAACTGG - Intergenic
996011862 5:118489569-118489591 CCTAACAAAATACCACAAGCTGG - Intergenic
996506572 5:124274987-124275009 GCTAACAAAGTACCACAAACAGG + Intergenic
996777170 5:127145172-127145194 GGTAACAAAGTACTACAAACTGG - Intergenic
997108646 5:131049571-131049593 TGTAGCAAATTACTACAAAGTGG - Intergenic
997648975 5:135501112-135501134 CATAACAAATTACCACAAACTGG + Intergenic
997693688 5:135845030-135845052 TGTAACAAATAACCACAAACTGG + Intronic
997903433 5:137790211-137790233 TGTAACAAAGTACCACAGGCTGG + Intergenic
998655747 5:144177382-144177404 TGTAACAAAGTACCACAAACTGG + Intronic
998825353 5:146095992-146096014 CATAGCAAAATACCACAAACTGG + Intronic
998980105 5:147692400-147692422 TGTAACAAATTACCACAAACTGG - Intronic
999632268 5:153583277-153583299 TGTAACAAAATTCCACAAGCAGG + Intronic
1000087270 5:157898443-157898465 GGTATCTAAATACCACAATCTGG + Intergenic
1000165953 5:158648881-158648903 CATAGCAAAATACCACAAACTGG - Intergenic
1000821951 5:165995708-165995730 TGTAACAAATTATCACAAACTGG - Intergenic
1000865131 5:166504350-166504372 CGTAACAAAGTACCACAAACTGG + Intergenic
1001191988 5:169639869-169639891 TGTAGCAAAATACCACCAACTGG + Intronic
1001516991 5:172362798-172362820 GGTAGCCAACTACCAGAAGCAGG - Exonic
1001520932 5:172392402-172392424 CATAGCAAAATACCACAAACTGG - Intronic
1001630445 5:173171046-173171068 GATAACAAAATACCACAAACTGG - Intergenic
1003713624 6:8620336-8620358 TGTAACAAATTACCATAAACTGG - Intergenic
1003844617 6:10160228-10160250 TATAGCAAAATACCACAGGCTGG + Intronic
1003880547 6:10476175-10476197 CGTAACAAATGACCACAAACTGG - Intergenic
1004233789 6:13855341-13855363 TGTAACAAAGTACCACAAACTGG + Intergenic
1004476879 6:15981559-15981581 CATAGCAAAGTACCACAAACTGG + Intergenic
1004975982 6:20966955-20966977 TGTAACAAAGTACCACAAACTGG + Intronic
1005103993 6:22203479-22203501 CGTAACAAAGTACCACAGGCTGG - Intergenic
1005213387 6:23496049-23496071 AGTAACAAATTGCCACAAACTGG - Intergenic
1005238343 6:23793021-23793043 GGAAGCATTTTACCTCAAGCTGG - Intergenic
1005353317 6:24958734-24958756 TGTAACAAAGTACCACAAACTGG + Intronic
1005709085 6:28486294-28486316 CATAACAAATTACCACAAACTGG + Intergenic
1005815685 6:29550480-29550502 GGTAGCAAATCAGCATTAGCTGG - Intergenic
1005889090 6:30121699-30121721 CGTAACAAAGTACCACAGGCTGG - Intergenic
1006891959 6:37436435-37436457 TGTAACAAATTACTACAAACTGG + Intronic
1007101236 6:39248519-39248541 GCCAGCAAATTACCAGAAGCAGG - Intergenic
1008071913 6:47106770-47106792 CATAACAAAATACCACAAGCTGG - Intergenic
1008509608 6:52263906-52263928 TGCAGCAAACTACCACAAGGTGG - Intergenic
1008526581 6:52413307-52413329 CGTAACAAAGTACCACAAGCTGG - Intergenic
1009446711 6:63751061-63751083 GGTAGCAAATAACCATCAGTAGG - Intronic
1009467126 6:63985426-63985448 CATAGCAAAGTACCACAAACTGG - Intronic
1009481973 6:64170347-64170369 GGTAACAAATTACCACAACGTGG + Intronic
1010068552 6:71715163-71715185 GCTAGCAAACTGCCAGAAGCTGG - Intergenic
1010275334 6:73962402-73962424 CATAACAAATTACCACAAACTGG - Intergenic
1010579433 6:77575691-77575713 TCTACCAAAGTACCACAAGCTGG - Intergenic
1010738887 6:79475718-79475740 TGTAACAAATTACCACAAACTGG + Intergenic
1011342186 6:86328670-86328692 CATAGCAGAATACCACAAGCTGG - Intergenic
1011349382 6:86405734-86405756 TATAGCAAAATACCACAGGCTGG - Intergenic
1011493850 6:87919799-87919821 TATAACAAATTACCACAAACGGG + Intergenic
1011551330 6:88533556-88533578 TGTAACAAGTTACCACAAACTGG - Intergenic
1011705100 6:89993180-89993202 CATAGCAAAATACCACAGGCTGG - Intronic
1011788024 6:90868041-90868063 TGTAACAAAGTACCACAAACTGG - Intergenic
1012244447 6:96911088-96911110 CGTAACAAAGTACCACAAACTGG + Intergenic
1012457288 6:99421727-99421749 TGTAGCAAATTACCACAAACTGG - Intronic
1012584533 6:100906377-100906399 AGTAGCAAATTACAACAAACTGG + Intergenic
1013039913 6:106423042-106423064 GATAGCAAATTACCAAATGGTGG - Intergenic
1013086143 6:106859512-106859534 CTTAGCAAAGTACCACAAGCTGG - Intergenic
1013468157 6:110435486-110435508 TGTAACAAAATACCACAGGCTGG - Intronic
1013580252 6:111527007-111527029 CGTAACAAAGTACCACAAACTGG + Intergenic
1013714723 6:112945125-112945147 CATAACAAATTACCACAAACTGG - Intergenic
1014418097 6:121208881-121208903 CGTAACACATTACCACAAACCGG - Intronic
1014609696 6:123526024-123526046 TGTAACAAATTACCACAAACTGG - Intronic
1014720694 6:124914080-124914102 TGTAACCAAATACCACAAGCCGG - Intergenic
1014736619 6:125101513-125101535 AGTAGCAAAATACCACAAACTGG + Intergenic
1014965139 6:127738926-127738948 TATAGCCAATTACCACAAACAGG + Intronic
1015006980 6:128295306-128295328 GTTGGCAAATTACCACCAGCAGG - Intronic
1015212175 6:130710835-130710857 TGTAACAAAATACCACAAACTGG + Intergenic
1015312923 6:131784516-131784538 GATAGCAAAGTACCAAAAACTGG + Intergenic
1015403312 6:132811254-132811276 CATAGCAAAGTACCACAAACTGG - Intergenic
1016433692 6:144013495-144013517 CATAACAAATTACCACAAACTGG + Intronic
1016529428 6:145041623-145041645 TGTAAAAAATTACCACAAACTGG + Intergenic
1016599243 6:145838181-145838203 TGTAGCAAAATACCACAGACTGG + Intergenic
1017017159 6:150110698-150110720 GCTAGCAAAATACTACAAACTGG - Intergenic
1020347986 7:7185390-7185412 GGTAACAAAATACGACAAACTGG + Intronic
1020601367 7:10278529-10278551 TCTAGCAAATTACCACAAAATGG + Intergenic
1020832515 7:13109879-13109901 GGTAGCTCCTTTCCACAAGCAGG + Intergenic
1021576717 7:22111951-22111973 TGTAACAAAATACCACAGGCTGG + Intergenic
1021915371 7:25426223-25426245 TGTAACAAAATACCATAAGCTGG + Intergenic
1022248582 7:28584684-28584706 AGTCACAAATTACCACAAACTGG - Intronic
1022805725 7:33820355-33820377 TGTAACAAATTACCTCAAACAGG + Intergenic
1022851101 7:34263019-34263041 CATAACAAATTACCACAAACTGG - Intergenic
1022878627 7:34563109-34563131 CATAACAAATTACCACAAACTGG - Intergenic
1023088571 7:36596789-36596811 CATATCAAAGTACCACAAGCTGG - Intronic
1023410152 7:39882140-39882162 GTAAGCAAATTAACACCAGCTGG - Intergenic
1023415488 7:39928231-39928253 TATAACAAAGTACCACAAGCTGG + Intergenic
1023490240 7:40732043-40732065 TGTAACAAATTACTACAAACCGG + Intronic
1023536004 7:41211692-41211714 CATAACAAATTACCACAAGCTGG - Intergenic
1023633769 7:42188250-42188272 TATAACAAATTACCACAAACTGG - Intronic
1023639145 7:42240369-42240391 GGTAACAAAGTACCAAAAACTGG + Intergenic
1023767704 7:43527278-43527300 CATAGCAAATTACCACAAACTGG + Intronic
1024090036 7:45929252-45929274 CATAACAAATTACCACAAACTGG - Intergenic
1024401777 7:48932162-48932184 TATAACAAATTACCATAAGCTGG + Intergenic
1026241151 7:68576509-68576531 CATAGCAAACTATCACAAGCTGG + Intergenic
1027669388 7:81077186-81077208 CATAACAAATTACCACAAACTGG + Intergenic
1027930945 7:84534259-84534281 TGTAACAAATTACCACAAACTGG + Intergenic
1028239719 7:88404846-88404868 CATAACAAATTACCACAAACTGG - Intergenic
1028671146 7:93401468-93401490 TGTAACAAATTACCACAAACTGG + Intergenic
1029159712 7:98542995-98543017 TGTAACAAAGTACCACAAACTGG + Intergenic
1029295548 7:99537490-99537512 TGTAACAAAGTACCACAAACTGG - Intergenic
1029969372 7:104773936-104773958 TGTAACAAAGTACCACAACCCGG - Intronic
1029985893 7:104923035-104923057 GGTAGCCAACTTCCACAAGGTGG + Intergenic
1030173345 7:106626890-106626912 TGTGACAAATTACCACAAACTGG - Intergenic
1030339592 7:108362094-108362116 TATAGCAAAATACCACAAGCTGG + Intronic
1030419369 7:109288210-109288232 TGTAACAAATTACCACAACCAGG - Intergenic
1030477246 7:110051388-110051410 AGTAACAAATTACCAAAAACCGG + Intergenic
1030688724 7:112511454-112511476 TGTAACAAAGTACCACAAACTGG + Intergenic
1030755877 7:113287271-113287293 AGTAACAAAGTACCACAAACTGG + Intergenic
1030778062 7:113561465-113561487 TGTAACAAAGTACCACAAACAGG + Intergenic
1030991830 7:116310292-116310314 TGTAACAAATGACCACAAACTGG + Intronic
1031029073 7:116715192-116715214 CATAACAAATTACCACAAACTGG + Intronic
1032114780 7:129107694-129107716 TGTAGCAGATGACCACAAACTGG + Intergenic
1032364583 7:131287261-131287283 CGTAACAAATTACTACAAACTGG + Intronic
1032614056 7:133446937-133446959 GGTGGCAAAGTATCAGAAGCAGG - Intronic
1032894259 7:136233412-136233434 TGTAACAAATTACCACCAACTGG - Intergenic
1033309048 7:140246499-140246521 GGTAATAAATTGCCACAAGCAGG + Intergenic
1033704937 7:143877260-143877282 TGTAGCAAATGACCACAAATGGG - Intronic
1033823397 7:145160835-145160857 TGTAACAAATTACAACAAACTGG + Intergenic
1034107532 7:148503006-148503028 CGTAACAAATTAGCACAAACTGG + Intergenic
1034362344 7:150511296-150511318 TGTAACAAATTACCACAAACTGG - Intergenic
1034476505 7:151287363-151287385 TGTAACAAATCACCACAAACTGG - Intergenic
1034504558 7:151477295-151477317 AGTAGCAAATCAACTCAAGCAGG + Intronic
1034888125 7:154814613-154814635 GCTAACAAATTACCGCAATCTGG + Intronic
1035821679 8:2599393-2599415 TGTAACAAATTACCACAAACTGG - Intergenic
1036407716 8:8469853-8469875 TGTAACAAATTACCCCAAACTGG - Intergenic
1036608455 8:10329168-10329190 TATAACAAATTACCACAAACTGG + Intronic
1036814282 8:11889519-11889541 CGTAACAAAATACCACAGGCTGG - Intergenic
1036907662 8:12720607-12720629 GGTAGCTGTTTTCCACAAGCAGG - Intergenic
1037574041 8:20184304-20184326 TGTAACAAATTACTACAATCTGG + Intergenic
1037755701 8:21708898-21708920 TGTAGCAAAGTACCACAAGCTGG - Intronic
1038704111 8:29878219-29878241 TGTAACAAATTACCACAAACCGG + Intergenic
1039778759 8:40762863-40762885 TGTAACAAATTGCCACAAACTGG - Intronic
1040541560 8:48361779-48361801 TGTAACAAAATACCACAGGCTGG + Intergenic
1041473305 8:58234978-58235000 CATAGCAAATTACCACAAACTGG + Intergenic
1041829554 8:62138487-62138509 GGTAGGAAATTACCAAGAGAGGG - Intergenic
1042356553 8:67834846-67834868 TGTAACAAAGTACCACAAACTGG + Intergenic
1042478107 8:69272614-69272636 TGTAACAAACTACCACAAACTGG - Intergenic
1042648599 8:71014292-71014314 TGTAACAAATTATCACAAACTGG + Intergenic
1043221192 8:77667101-77667123 TGTAACAAATTACCACATGATGG + Intergenic
1043735641 8:83739715-83739737 TGTAACAAAGTACCACAAACTGG + Intergenic
1043984452 8:86677233-86677255 CATAACAAATTACCACAAACTGG - Intronic
1044464649 8:92489098-92489120 TGTAACAAATTACTACAAACTGG + Intergenic
1044850387 8:96421586-96421608 CGTAACAAATGACCACAAACTGG + Intergenic
1044929671 8:97239842-97239864 TGTAACAAATTACCACAAATTGG + Intergenic
1045230612 8:100303107-100303129 TGTAACAAACTACCACAAACTGG + Intronic
1045468532 8:102490623-102490645 TGTAACAAACTACCACAAACTGG - Intergenic
1045508151 8:102793270-102793292 TGTAACAAAATACCACAATCTGG - Intergenic
1046195770 8:110860957-110860979 GGTAGCTCCTTTCCACAAGCAGG - Intergenic
1046213925 8:111117148-111117170 CATAACAAATTACCACAAACTGG - Intergenic
1046311926 8:112448679-112448701 TGTAACAAATTACCACAAATTGG - Intronic
1046688096 8:117249502-117249524 TGTAACAAATTACCACAAATGGG + Intergenic
1048301158 8:133252417-133252439 TGTAACAAATTACCACAAACAGG - Intronic
1048586938 8:135783149-135783171 GGGAACAAAATACCACAAACCGG + Intergenic
1048599335 8:135902381-135902403 TGTAACAAAGTACCACAACCGGG + Intergenic
1049907142 9:228670-228692 TGTAACAAACTACCACAAACTGG - Intronic
1050133903 9:2441670-2441692 GGTAGAGAATTACCATAAGGTGG + Intergenic
1050164105 9:2746440-2746462 TGTAACAAAGTAGCACAAGCTGG - Intronic
1050325943 9:4497093-4497115 CCTAACAAATTACCACAAACCGG + Intronic
1050888180 9:10791023-10791045 GGTAGCTCCTTTCCACAAGCAGG - Intergenic
1051745642 9:20292540-20292562 TGTAACAAAGTACCACAAACTGG + Intergenic
1052440530 9:28491100-28491122 TGTAACAAATTACTACAAACTGG + Intronic
1052715595 9:32112551-32112573 TGTAACAAATTACCACACACTGG - Intergenic
1053268008 9:36729923-36729945 TGCAACAAATTACCACAAACTGG - Intergenic
1055441002 9:76336171-76336193 AGTCTCAAGTTACCACAAGCTGG + Intronic
1055887481 9:81081084-81081106 CATAGCAAAGTACCACAAACTGG + Intergenic
1056485457 9:87052758-87052780 TGTAACAAATCACCACAAACTGG + Intergenic
1056848364 9:90059521-90059543 TGTAGCACCTTACCACAAACTGG - Intergenic
1058214530 9:102217303-102217325 TGTAACAAAATACCACAAACTGG - Intergenic
1058814045 9:108667532-108667554 TGTAACAAATTCCCACAAACTGG - Intergenic
1058820202 9:108722662-108722684 TGTAACAAATTGCCACAAACTGG - Intergenic
1059985211 9:119814443-119814465 GTCAGCAAATTACCACCTGCAGG + Intergenic
1060004930 9:119991664-119991686 CATAGCAAACTACCACAAGCTGG - Intergenic
1060115924 9:120940682-120940704 GGTAACAAAGTGCCACAAACTGG + Intergenic
1062624712 9:137437556-137437578 GGTAACAAATTACCACAAATTGG - Intronic
1185822650 X:3219944-3219966 GGCAACAAATGACCACAGGCTGG + Intergenic
1186113288 X:6278091-6278113 TGTAACAAAGTACCACAACCCGG + Intergenic
1186409790 X:9336599-9336621 TGTAGCAAATTACCATGAACTGG - Intergenic
1186552620 X:10522457-10522479 CATAACAAATTACCACAAACTGG - Intronic
1186769402 X:12803034-12803056 TATAACAAATTACCACAAACTGG + Intronic
1187448291 X:19376167-19376189 TGTAACAAAATACCACAAACTGG + Intronic
1187544241 X:20231927-20231949 CATAACAAATTACCACAAACTGG - Intronic
1187748899 X:22439411-22439433 TATAACAAATTACCACAAACTGG - Intergenic
1188027866 X:25229897-25229919 CATAACAAATTACCACAAACTGG - Intergenic
1188323867 X:28775176-28775198 CATAACAAATTACCACAAACAGG + Intronic
1188392100 X:29633565-29633587 TGTAACAAATTACCACAAGCTGG + Intronic
1188604157 X:32007473-32007495 TGTAACAAATTACCACAAGCTGG - Intronic
1189136719 X:38558279-38558301 TGTAACAAAGTACCACAAGCTGG + Intronic
1189213626 X:39304992-39305014 TGTAACAAAGTGCCACAAGCTGG + Intergenic
1189343178 X:40220022-40220044 TGTAACAAAGTACCACAAACTGG + Intergenic
1189360681 X:40348442-40348464 AGTACCAAAATACCACAGGCTGG + Intergenic
1189458299 X:41214019-41214041 GGTAGAAAATGACCATAAACTGG + Intronic
1190133628 X:47773820-47773842 AGTAACAAATTACCACAAACTGG - Intergenic
1190382957 X:49857197-49857219 TGTTGTAAATTACCACAAACTGG - Intergenic
1192901540 X:75503746-75503768 GGTAATAAATGACCACAAGCTGG + Intronic
1193686482 X:84582603-84582625 TGTAACAAAATACCACAAACTGG + Intergenic
1194831395 X:98626621-98626643 TGTGGCAAAGTACCACAAACTGG - Intergenic
1196686522 X:118514899-118514921 TGTAACAAATTACCACAAATTGG + Intronic
1197863757 X:130996970-130996992 TGTAACAAAGTACCACAAACCGG - Intergenic
1198167182 X:134069444-134069466 AGTAACAAATTACCACAAACTGG - Intergenic
1198438288 X:136638045-136638067 CATAACAAATTACCACAAACTGG + Intergenic
1198524910 X:137491368-137491390 CATAGCAAAATACCACAGGCTGG - Intergenic
1198573957 X:137989629-137989651 TGTAACAAAGTACCACAAACTGG + Intergenic
1198937445 X:141913343-141913365 AATAGCAAAGTACCACAACCTGG - Intergenic
1198959221 X:142166354-142166376 CATAGCAAAGTACCACAACCTGG + Intergenic
1198961607 X:142189522-142189544 AATAGCAAAGTACCACAACCTGG + Intergenic
1199118446 X:144020969-144020991 CATAACAAATTACCACAAACTGG + Intergenic
1199524319 X:148775499-148775521 TGTAACAAATTACCAAAAACTGG + Intronic
1201251776 Y:12066015-12066037 TGTAACAAATTACTACAATCTGG + Intergenic