ID: 1109292386

View in Genome Browser
Species Human (GRCh38)
Location 13:60492419-60492441
Sequence TCCAAATATCCCAATGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 359}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109292383_1109292386 30 Left 1109292383 13:60492366-60492388 CCATGTGCCAGCTACTGAGATAA 0: 1
1: 0
2: 2
3: 52
4: 374
Right 1109292386 13:60492419-60492441 TCCAAATATCCCAATGAGGTAGG 0: 1
1: 0
2: 3
3: 45
4: 359
1109292384_1109292386 23 Left 1109292384 13:60492373-60492395 CCAGCTACTGAGATAATCACTTC 0: 1
1: 1
2: 9
3: 8
4: 152
Right 1109292386 13:60492419-60492441 TCCAAATATCCCAATGAGGTAGG 0: 1
1: 0
2: 3
3: 45
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109292386 Original CRISPR TCCAAATATCCCAATGAGGT AGG Intronic
900772430 1:4555884-4555906 CCCAAATTTACCAATGAGATAGG + Intergenic
902902701 1:19530629-19530651 TCCCAATAACCCTTTGAGGTGGG - Intergenic
903033868 1:20481933-20481955 TCCTAATAACCCTATGAGGCAGG + Intergenic
903704346 1:25274168-25274190 TCACAATAACCCAATGAGGTGGG + Intronic
903722893 1:25419149-25419171 TCACAATAACCCAATGAGGTGGG - Intronic
903770409 1:25760209-25760231 TCCCAACAACCCTATGAGGTGGG + Intronic
903894541 1:26595321-26595343 TCCTAATAGCCCTTTGAGGTAGG - Intergenic
904350342 1:29901159-29901181 TTCCAATAACCCTATGAGGTGGG - Intergenic
904707039 1:32399289-32399311 TCCCAAAAGCTCAATGAGGTGGG + Intergenic
905011845 1:34752633-34752655 TAGAAATAACCCTATGAGGTAGG - Intronic
905337013 1:37251723-37251745 TCAACATAGCCCCATGAGGTAGG - Intergenic
905875847 1:41431739-41431761 TCAAACTAACCCCATGAGGTTGG - Intergenic
906777467 1:48542960-48542982 TCACAATAACCCAATGAAGTAGG + Intronic
907190970 1:52648608-52648630 TCCAGCTATCCCAGTGAGGTAGG + Intronic
908138627 1:61159633-61159655 TCATAACAACCCAATGAGGTAGG - Intronic
908179924 1:61593537-61593559 TCCAAATATTCCACCCAGGTTGG - Intergenic
908423255 1:63980363-63980385 ATCAAATATCTCAATGAGGTGGG - Intronic
908679999 1:66649964-66649986 TCAAAATAGCCCAATGAAGTAGG - Intronic
908745097 1:67368820-67368842 TCACAATAACCCAACGAGGTAGG - Intronic
910395924 1:86793905-86793927 TTTAAATATCCAAATGAGGCCGG + Intergenic
911364344 1:96918977-96918999 TCAAAACAACCCAATGAGGTAGG + Intergenic
911891067 1:103372603-103372625 TCCAAACAATTCAATGAGGTAGG - Intergenic
912698628 1:111859838-111859860 TCACAATAGCCCAAGGAGGTGGG + Intronic
912850391 1:113119043-113119065 TCACAACATCCCTATGAGGTAGG - Intronic
913511278 1:119564993-119565015 TGCAAATAACCCCATGAGGAAGG + Intergenic
915983355 1:160437749-160437771 TCCCAACATCCCTGTGAGGTTGG - Intergenic
916869081 1:168892907-168892929 TCCAAATATCCCAAGGATCTGGG + Intergenic
917406916 1:174716925-174716947 TCCTAACATCCCAATGAAGTAGG + Intronic
918216538 1:182396673-182396695 TCCAAATTAACTAATGAGGTGGG - Intergenic
918241178 1:182621973-182621995 TTGAAATAACCCTATGAGGTAGG - Intergenic
918335041 1:183501250-183501272 TCAAAACACCTCAATGAGGTAGG + Intronic
918384297 1:183989846-183989868 TCAAAATAACCCAGTGAGCTAGG - Intronic
919518968 1:198563634-198563656 TCACAATAACCCTATGAGGTAGG + Intergenic
920572519 1:207028340-207028362 TCACAATAACCCCATGAGGTAGG - Intronic
920716658 1:208346435-208346457 TTCAAACATCCCAGAGAGGTAGG + Intergenic
920770080 1:208875772-208875794 TACAAATATCCAAAGGAGTTTGG - Intergenic
920844729 1:209584239-209584261 TCCCAATAACCCAAAGAGGTCGG - Intronic
921705385 1:218316620-218316642 TCACAACATCCCTATGAGGTAGG - Intronic
922059546 1:222074624-222074646 TGAAAACAACCCAATGAGGTAGG - Intergenic
924201766 1:241667707-241667729 ACCAACAATCCCAATGAGCTTGG + Intronic
1065211050 10:23403470-23403492 TCCCAACAACCCTATGAGGTTGG + Intergenic
1066277644 10:33884608-33884630 TGCAAATAGCCCAAGGAGGCTGG - Intergenic
1066300513 10:34091727-34091749 TCCTAACAACCCCATGAGGTAGG + Intergenic
1068320661 10:55409985-55410007 TTCAAATAACCCTAAGAGGTAGG - Intronic
1068524430 10:58111857-58111879 TCCAAATAACTCCCTGAGGTAGG - Intergenic
1069458733 10:68574805-68574827 TCCCAACAACCCTATGAGGTTGG - Intronic
1069609862 10:69765895-69765917 TCACAATAACCCTATGAGGTAGG + Intergenic
1070509296 10:77145935-77145957 TCACAATAACCCCATGAGGTAGG - Intronic
1073543587 10:104331284-104331306 TCCAAAGTTCCCAAGGAGGCAGG - Intronic
1074427862 10:113368167-113368189 TTCAAATAACCCTTTGAGGTAGG + Intergenic
1074965232 10:118485150-118485172 TCACAACATCCAAATGAGGTAGG - Intergenic
1075302671 10:121339435-121339457 TCAAAATATCCTTTTGAGGTTGG + Intergenic
1075314932 10:121445333-121445355 TACAAATCTGCCAATGAGGATGG - Intergenic
1075736449 10:124667403-124667425 TCCAGATAGCCCCATGAGGAAGG - Intronic
1075872961 10:125783833-125783855 TCAAAATAGCCCTATCAGGTGGG - Intergenic
1077408197 11:2391934-2391956 CCCAAATATCCTAATGATCTGGG - Intronic
1078221422 11:9354623-9354645 TCCTAATACCCCTAAGAGGTAGG - Intergenic
1079258058 11:18849769-18849791 TCACAATAACCCAAAGAGGTGGG - Intergenic
1079576454 11:22009246-22009268 TTCCAATATCCCAGTGGGGTAGG - Intergenic
1080021482 11:27565037-27565059 CACAATTATCCCAATGAGGCAGG + Intergenic
1080420396 11:32105219-32105241 TCTTAATATGCCAATGAGGTAGG + Exonic
1081589515 11:44411508-44411530 TCAAAATGACCCTATGAGGTAGG + Intergenic
1081937039 11:46912179-46912201 TCACAATATCCTTATGAGGTAGG - Intronic
1083316529 11:61817903-61817925 TCCTAACAACCCTATGAGGTTGG + Intronic
1085269254 11:75260583-75260605 TGCAATTGTCCCAGTGAGGTGGG + Intergenic
1086608091 11:88721343-88721365 TTCAAATATTCCAATGATGCAGG - Intronic
1086851418 11:91813915-91813937 TCAAAATAACCTTATGAGGTAGG + Intergenic
1088363204 11:109012492-109012514 TCCATATATTCTAATGAGCTTGG - Intergenic
1089749964 11:120644416-120644438 TGCAAATAGCCCCGTGAGGTAGG + Intronic
1090652921 11:128823199-128823221 TCGTAACAGCCCAATGAGGTGGG + Intergenic
1090710973 11:129384871-129384893 TCAAAATATCCCTATGAAATAGG + Intronic
1090761259 11:129838659-129838681 CCCAAATATCCCAGAGAGCTTGG - Intronic
1090863819 11:130677376-130677398 TCAAAACAACCCTATGAGGTAGG + Intronic
1091907803 12:4202901-4202923 TCCCAATTTCACAATGAGTTTGG - Intergenic
1091983082 12:4882236-4882258 TCCATAAAACCCAGTGAGGTTGG - Intergenic
1092845164 12:12578093-12578115 TCCCAATAACCCTATGAGGAAGG - Intergenic
1093213300 12:16333061-16333083 GACAAAAATCCCCATGAGGTAGG + Intergenic
1093515768 12:19985053-19985075 TCACAATAGCCCAATGAAGTAGG + Intergenic
1093736759 12:22629070-22629092 TCACAATAACCCATTGAGGTAGG - Intronic
1095574931 12:43726096-43726118 TTCAAATATAGCAATGAGGGAGG + Intergenic
1095852543 12:46826562-46826584 TCCTAAAATCCCTGTGAGGTTGG + Intronic
1096198716 12:49665822-49665844 TCCAACTCACCCAATGTGGTTGG + Exonic
1096915084 12:55023044-55023066 TCCTAATAATCCTATGAGGTAGG + Intronic
1097040129 12:56151406-56151428 TCCGAAGAGCCCTATGAGGTAGG + Intergenic
1097102494 12:56599483-56599505 TTCACATAACCCAATGAAGTAGG + Intronic
1097713573 12:62940626-62940648 TCAAGATAATCCAATGAGGTAGG - Intergenic
1097751108 12:63353836-63353858 TCACAATATCCCTGTGAGGTGGG + Intergenic
1098080877 12:66784397-66784419 TCACAATATCCTAATGAGGTAGG + Intronic
1098929191 12:76390806-76390828 TCAAAATAACCCTATGAGATAGG + Intronic
1099317546 12:81103643-81103665 TATAAAGATCCAAATGAGGTAGG - Intronic
1100070862 12:90715636-90715658 TCAAAACAACCCTATGAGGTTGG + Intergenic
1100952964 12:99873079-99873101 TCACAATAGCCCTATGAGGTAGG - Intronic
1101213811 12:102561111-102561133 TCCAAATATCCCAAACCTGTGGG + Intergenic
1101796192 12:107976639-107976661 TCAAAACATCCCAGTGAGGTAGG + Intergenic
1102199201 12:111045816-111045838 TCTCAATGTCCCTATGAGGTAGG - Intronic
1102390152 12:112543106-112543128 TCCAAATATTCCAAAAAGATTGG - Intergenic
1102416342 12:112766287-112766309 TCACAATATCCCTATGAGGCAGG - Intronic
1102539206 12:113606398-113606420 ACCCAATATCCCAGTGAGGGTGG + Intergenic
1103934842 12:124469701-124469723 TCCAAACAACCTTATGAGGTAGG - Intronic
1104355096 12:128078244-128078266 TCCCAACATCCCAATTAGATGGG - Intergenic
1104827040 12:131719254-131719276 TACAAAATTCCAAATGAGGTGGG - Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1106524289 13:30526605-30526627 TCCCAATAGCCCTATGAGGCAGG - Intronic
1107942812 13:45389585-45389607 TCTTAATATGCCAATGAGGTAGG - Intergenic
1109292386 13:60492419-60492441 TCCAAATATCCCAATGAGGTAGG + Intronic
1110535696 13:76648377-76648399 CCCAACTATCCCATTGAGGAGGG - Intergenic
1110602426 13:77389873-77389895 TTCAAATAACCACATGAGGTGGG - Intergenic
1112184583 13:97115439-97115461 TCCAAATAGACGAATAAGGTGGG - Intergenic
1112668529 13:101607183-101607205 TCCTAAAAACACAATGAGGTAGG + Intronic
1112915951 13:104550547-104550569 TTCAATTATACAAATGAGGTAGG + Intergenic
1115186271 14:30691242-30691264 TCCAAATAACACTATGAGCTAGG - Intronic
1115501564 14:34054272-34054294 TTCTAATATCTCAATGACGTAGG - Intronic
1116798164 14:49413975-49413997 TCCAAATATCAGAGTGAGGAGGG + Intergenic
1117272511 14:54159324-54159346 TGCAAATAGCTCAACGAGGTTGG + Intergenic
1117458446 14:55920921-55920943 TCTAAATATCCCAATGAGTGTGG + Intergenic
1117572238 14:57058877-57058899 TCCAAATAAACCTAGGAGGTAGG + Intergenic
1118585661 14:67350039-67350061 TCCAAATAACACTATGAGATAGG - Intronic
1120750706 14:88195317-88195339 TCCAAACAATCCGATGAGGTGGG - Intronic
1121548122 14:94777677-94777699 TACAAATAACCCAATGACATGGG - Intergenic
1122384521 14:101334829-101334851 TCCAAACATCACCAGGAGGTAGG + Intergenic
1122452125 14:101817790-101817812 TCAAAAAACCCCAAAGAGGTAGG - Intronic
1124585577 15:31003045-31003067 TGAAAATATGTCAATGAGGTTGG - Exonic
1125293334 15:38174071-38174093 GCAAAATATCCCAAGGAGGTGGG - Intergenic
1125406240 15:39354986-39355008 TTCAAATAGCCAAATAAGGTGGG - Intergenic
1126376875 15:48005827-48005849 TCTGCATAACCCAATGAGGTAGG - Intergenic
1127631458 15:60831616-60831638 TCAAAATACCCAAATGAGGTGGG - Intronic
1127804740 15:62509000-62509022 TCCTAACATTCCTATGAGGTAGG + Intronic
1127954772 15:63843904-63843926 TCCATATTTCCCAATGATGGGGG - Intergenic
1129192408 15:73945168-73945190 TCCAGATTTCCAACTGAGGTAGG - Intronic
1129474577 15:75776109-75776131 TCCAAATAGCCCAGGGATGTTGG - Intergenic
1130549533 15:84881147-84881169 TCACAATAACCCAGTGAGGTAGG - Intergenic
1130559949 15:84950178-84950200 GCAAAATATCCTAATGAGGAAGG + Intergenic
1131310545 15:91286682-91286704 TCACAATAACCCTATGAGGTAGG + Intronic
1131460263 15:92612769-92612791 TCATAATATCCAGATGAGGTAGG + Intergenic
1132910530 16:2308457-2308479 CTCAAATTTCCCAATGAGCTGGG + Exonic
1134327927 16:13224054-13224076 TCTCAACATCCTAATGAGGTAGG - Intronic
1134506120 16:14808606-14808628 TCCACTTAACCCAATGAGGTAGG + Intronic
1134574430 16:15320164-15320186 TCCACTTAACCCAATGAGGTAGG - Intergenic
1134727985 16:16436139-16436161 TCCACTTAACCCAATGAGGTAGG + Intergenic
1134939451 16:18275687-18275709 TCCACTTAACCCAATGAGGTAGG - Intergenic
1135092403 16:19529069-19529091 TCAAAATAGCCTTATGAGGTAGG - Intronic
1135240018 16:20796472-20796494 TACAAATATCCCAGAAAGGTAGG + Exonic
1135598568 16:23762314-23762336 TCAAAATATCACATTGAGCTGGG + Intergenic
1135849147 16:25946945-25946967 ACCCAATGTCCCAATGTGGTTGG + Intronic
1137511935 16:49108403-49108425 TCACAAGATCCCTATGAGGTAGG - Intergenic
1137709872 16:50559145-50559167 TTAAAACAACCCAATGAGGTAGG - Intronic
1137733586 16:50708109-50708131 TCCCAAAATCCCAATGAGACGGG - Intronic
1137849462 16:51724578-51724600 TCAAAATAGCCCTATGAAGTAGG + Intergenic
1138490812 16:57375372-57375394 TACAAATATCCCAATGTTTTTGG + Intronic
1138652317 16:58467755-58467777 TCCAAAGATCCCAGCCAGGTAGG - Intronic
1139285702 16:65811872-65811894 GCCAAATGTCCCTGTGAGGTGGG - Intergenic
1139693500 16:68656526-68656548 TCCTAAAAGCCCCATGAGGTGGG + Intronic
1139695143 16:68668934-68668956 TCCTAATAACCTGATGAGGTAGG + Intronic
1141359914 16:83386084-83386106 TCCACACAACCCTATGAGGTTGG - Intronic
1142549465 17:729195-729217 TCAAAATAACCCAGTGAGGTTGG - Intergenic
1144564171 17:16346255-16346277 TCCAAATGTCTCAATGACATAGG + Intronic
1145846935 17:28047636-28047658 GCTAAAGATCCCAGTGAGGTGGG + Intronic
1146365482 17:32222471-32222493 TCTAAACATCCCTATGAGGCTGG - Intronic
1147186159 17:38714121-38714143 TCAAAATAATCCAATTAGGTTGG + Intronic
1147385793 17:40081190-40081212 TCCAGACAACCCTATGAGGTAGG - Intronic
1148074892 17:44929563-44929585 TTCCAATAACCCTATGAGGTGGG - Intronic
1148955494 17:51350533-51350555 GCCAAATGTCCCCAGGAGGTAGG - Intergenic
1150036496 17:61805456-61805478 TCCAAAGATGGCATTGAGGTAGG - Intronic
1150608261 17:66712828-66712850 TCCCAACATCCCTAGGAGGTTGG - Intronic
1150789833 17:68195271-68195293 TCCCAATAATCCAGTGAGGTGGG + Intergenic
1153950391 18:10053374-10053396 TGAAAATAACCCAATCAGGTGGG + Intergenic
1154039953 18:10844809-10844831 TCATAATAACCCTATGAGGTAGG - Intronic
1155040169 18:22058528-22058550 TCACAATATCCCAAAGAGGGAGG - Intergenic
1155244516 18:23894576-23894598 CCCTAATATCCCTATAAGGTAGG - Intronic
1156609612 18:38711148-38711170 TTACAATAACCCAATGAGGTAGG + Intergenic
1157496228 18:48159338-48159360 TCGTAAGATCCCTATGAGGTAGG - Intronic
1157663351 18:49465097-49465119 TCCAAATAACCCTATGAGAAAGG + Intergenic
1157784211 18:50467544-50467566 GCCAAGAATCCCAATGAGTTTGG - Intergenic
1160348664 18:78155176-78155198 TCCACATATCCCCAAGAGGCTGG - Intergenic
1162431061 19:10628864-10628886 TCAAAATAGCCCCATGAGGGTGG - Intronic
1162774020 19:12968065-12968087 TCAGAATAACCCAATGAGATAGG + Intronic
1166520331 19:43475697-43475719 TCCTTATAACCCAGTGAGGTAGG - Intronic
1167537596 19:50064922-50064944 TCCAAACATTTCATTGAGGTGGG + Intergenic
1168592465 19:57648756-57648778 TACAAAACTGCCAATGAGGTAGG - Intergenic
925180650 2:1815042-1815064 TCAAAATATCCCTATGAGGTGGG - Intronic
926695604 2:15768305-15768327 TCCAAATAACCCCAAAAGGTAGG + Intergenic
927422889 2:22951660-22951682 TCTCAATAGCCCTATGAGGTTGG + Intergenic
928282774 2:29963766-29963788 TCCTAGTATGCCGATGAGGTGGG - Intergenic
928359656 2:30652956-30652978 TGCAAATATCCAAATGGGGGTGG + Intergenic
928989986 2:37222841-37222863 TGTAAATAACCCTATGAGGTAGG + Intronic
930875807 2:56214267-56214289 ACTTAATATCCCTATGAGGTAGG - Intronic
931190215 2:59992939-59992961 TCTCAATAACCCAGTGAGGTTGG - Intergenic
931292759 2:60890294-60890316 TCACAACAACCCAATGAGGTAGG + Intronic
931973401 2:67615558-67615580 TCTCAATAACCCAATAAGGTAGG + Intergenic
932209116 2:69913303-69913325 TCAATATAACCCCATGAGGTAGG - Intronic
933192694 2:79353636-79353658 TCCAAATATCCCACTTAAATTGG - Intronic
933739653 2:85523512-85523534 TGCAACAATCCTAATGAGGTAGG + Intergenic
937435088 2:121873653-121873675 TCCAAGTCTCCCATTGAGGGAGG - Intergenic
939175349 2:138741508-138741530 TCCAAAAATCCCAGTGATTTTGG + Intronic
939679364 2:145111182-145111204 GCCAAATCTCCCAGTGATGTTGG + Intergenic
939692570 2:145283389-145283411 TCTCAATATGCAAATGAGGTGGG - Intergenic
941034326 2:160551165-160551187 TCCTAATATCCTTAGGAGGTAGG - Intergenic
941513522 2:166443398-166443420 TCCCAATGTCCCAATGGGATAGG + Intronic
942530419 2:176903959-176903981 TCTAACTATCCCCATGAGGAAGG + Intergenic
945228005 2:207552728-207552750 CCCAAATATCCCAAGTAGCTGGG + Intronic
945940884 2:215948809-215948831 TCACAATAAGCCAATGAGGTAGG - Intronic
946731771 2:222716963-222716985 TTAAAATATCCCTAGGAGGTTGG + Intergenic
947956917 2:234200089-234200111 TCCAGATATTCCAAAGAGGAAGG - Intergenic
1169320779 20:4631657-4631679 TCCACAAATCCCTATGAGGATGG - Intergenic
1170220711 20:13938742-13938764 TCAAAACATCCCAATGAGATAGG - Intronic
1173867501 20:46321994-46322016 TCCCCAAATCCCCATGAGGTGGG - Intergenic
1174187291 20:48715849-48715871 TCGAATCATCCCAGTGAGGTGGG + Intronic
1174362327 20:50036818-50036840 TCAAAACAACACAATGAGGTTGG - Intergenic
1174387576 20:50196476-50196498 TCTTAAAATCCCAATGATGTAGG + Intergenic
1174831466 20:53816716-53816738 TTCAAATAACCTAATGAGGCTGG - Intergenic
1175082912 20:56436485-56436507 TCACAATAACCCCATGAGGTAGG + Intronic
1175299641 20:57933844-57933866 TCCCAATATCCCACTCAGGGAGG + Intergenic
1178741108 21:35202293-35202315 TCCTCACAACCCAATGAGGTAGG + Intronic
1180871338 22:19148940-19148962 TCCAAAGATCCCAAAAAGGGTGG + Exonic
1181920015 22:26313256-26313278 TCAAAATAACCCAATGAGGTTGG + Intronic
1182011196 22:27002048-27002070 CCCCAATAACCTAATGAGGTAGG - Intergenic
1182045717 22:27272522-27272544 TCCTAATAACCCAATAAAGTAGG - Intergenic
1182765512 22:32755185-32755207 TCCCATCACCCCAATGAGGTAGG + Intronic
1183173378 22:36204286-36204308 TTCAAATTTCCCAAAGAGATGGG + Intronic
1183178118 22:36239097-36239119 TTCAAATTTCCCAAAGAGATGGG + Intronic
1183179980 22:36253505-36253527 TTCAAATTTCCCAAAGAGATGGG - Intronic
1183601219 22:38841746-38841768 TCCTAATATCCCAGTGAGGTAGG + Intronic
949416773 3:3823619-3823641 TCAGAACATCCAAATGAGGTAGG + Intronic
950220523 3:11191889-11191911 TCCAAACATCCCTATGGGGCTGG + Intronic
950402780 3:12782848-12782870 TCCAAATTTACTTATGAGGTAGG - Intergenic
950887511 3:16374422-16374444 TCCAACTATCCCAAGGGAGTTGG + Intronic
950906898 3:16546589-16546611 TCAAAACAACCCTATGAGGTAGG - Intergenic
950928798 3:16768994-16769016 TCCAAATGTCCCCATGAGCATGG - Intergenic
950936192 3:16842078-16842100 AAAAAATATCACAATGAGGTTGG + Intronic
952171614 3:30813253-30813275 TCCAAATATCTCCAGGAGGTGGG - Intronic
952519531 3:34142761-34142783 TCTAAACATCCCTATAAGGTAGG - Intergenic
952960532 3:38586549-38586571 TCCCAATAACCACATGAGGTTGG + Intronic
955990198 3:64618614-64618636 CCCAAATATCCCAGTGAAATAGG - Intronic
956004802 3:64767200-64767222 TCACAACATCTCAATGAGGTTGG - Intergenic
956467604 3:69535058-69535080 TCCAAATAACCTGATGAGGTAGG + Intronic
956519636 3:70089654-70089676 TCAAAATAACCCAAAGAGGTAGG - Intergenic
957827191 3:85463026-85463048 TCCAAACAGCCCTATGATGTGGG - Intronic
957928722 3:86849535-86849557 TCCAAATCTCCCATTGAACTTGG + Intergenic
958732881 3:97977560-97977582 CCCAAAGATCCCACTGGGGTTGG + Intergenic
959937383 3:112043397-112043419 TAAAATTATCCCAAGGAGGTGGG + Intronic
959975675 3:112455939-112455961 TCACAACATCCCTATGAGGTAGG - Intergenic
960464611 3:117981619-117981641 TCAAAATGACCCTATGAGGTAGG + Intergenic
960591696 3:119372748-119372770 TCAAAATAACCCTATGAGGTAGG + Intronic
961188278 3:124934953-124934975 TCCAAATATCCTTGTGAGGTTGG + Intronic
961310100 3:125991297-125991319 TCGCAATATCCTTATGAGGTAGG + Intergenic
961586571 3:127932743-127932765 TCTTAATATCTCAAAGAGGTAGG - Intronic
961741387 3:129035300-129035322 TTCAAAGGGCCCAATGAGGTAGG + Intronic
961820837 3:129574944-129574966 TCCAAGTAGCCCAAAGAGGAGGG + Intronic
963487518 3:145954184-145954206 TTCAAACAACCCTATGAGGTAGG - Intergenic
964487681 3:157202756-157202778 TCACAATAACCTAATGAGGTAGG + Intergenic
964570523 3:158104566-158104588 TCAAATTCTGCCAATGAGGTGGG + Intronic
964922444 3:161913893-161913915 TCCAAAAAGCCCTATGAAGTAGG + Intergenic
965242241 3:166216817-166216839 TCTATATATCCCAAGGATGTTGG - Intergenic
967259047 3:187623832-187623854 TCTAATTATCCCATTAAGGTAGG + Intergenic
968563876 4:1299172-1299194 TCTAAATATGCCAAGGAGCTGGG - Intronic
969061660 4:4440324-4440346 TTCGAATATCCCCATCAGGTAGG + Intronic
969339142 4:6529471-6529493 TCCAGACAACCCAGTGAGGTGGG + Intronic
970244903 4:14050681-14050703 ACTAAACATCCCAAGGAGGTGGG - Intergenic
970958416 4:21842892-21842914 TCACAACATCCCAGTGAGGTTGG - Intronic
971178132 4:24301402-24301424 TGCAAATAGCCCTATGGGGTAGG + Intergenic
972146059 4:36027195-36027217 TCAAAATAACTCTATGAGGTAGG + Intronic
972162193 4:36240590-36240612 TCAAAATATCCCCGTGAGGTAGG - Intronic
973566412 4:52193300-52193322 TCACAATGACCCAATGAGGTGGG + Intergenic
973571088 4:52240437-52240459 TCACAATATCCCTAGGAGGTAGG + Intergenic
973792290 4:54389562-54389584 TTCAAATAGCCCTATGAAGTAGG - Intergenic
976816545 4:89154767-89154789 TCTAAAGAGCCTAATGAGGTTGG - Intergenic
978096096 4:104780318-104780340 TACAAAAATGCCAATGGGGTGGG + Intergenic
979318097 4:119290674-119290696 TCCTAATATTCCCATGAGGTAGG + Intronic
980098424 4:128517364-128517386 TCACAATAGCCCCATGAGGTGGG + Intergenic
980322153 4:131292514-131292536 TTCAAAGATGCCAATGAGGCTGG + Intergenic
981246427 4:142545331-142545353 TGCAATTAACCCTATGAGGTAGG + Intronic
981644304 4:146981129-146981151 TCCAAATGTTCCAATTAGTTTGG + Intergenic
981800862 4:148653920-148653942 TCCTAACATCCCCATGAGATAGG - Intergenic
984228210 4:177061850-177061872 TCAAAATGACACAATGAGGTAGG - Intergenic
986085028 5:4436543-4436565 TCCAAGTATTCAAAGGAGGTTGG + Intergenic
988923553 5:35965708-35965730 TCCAAAGAGCCGAATGTGGTGGG + Exonic
990388254 5:55290349-55290371 TCCAAATAAAACAATGAGGAGGG + Intronic
990463987 5:56055013-56055035 TCCAAATATCAGAATGACCTGGG - Intergenic
991137669 5:63201546-63201568 TCCTAATAGCCCTATGAGATGGG - Intergenic
992494039 5:77274223-77274245 TCAAAAAATCCCTATGAGGTAGG + Intronic
993241153 5:85387050-85387072 TACAAATATCCCAATTACTTAGG - Intergenic
994047301 5:95324630-95324652 TCATAAAAACCCAATGAGGTTGG + Intergenic
995413073 5:111880208-111880230 TTCTCATAACCCAATGAGGTAGG - Intronic
996981892 5:129506924-129506946 TCCAAATAACCCTATGAAGTTGG + Intronic
997058358 5:130471253-130471275 TACAAATATACCACTCAGGTGGG - Intergenic
998329784 5:141314904-141314926 GCCCAATAACCCTATGAGGTAGG + Intergenic
998511199 5:142715507-142715529 TCCTAATAGGCCTATGAGGTAGG - Intergenic
998655590 5:144175188-144175210 TCCTGACAACCCAATGAGGTAGG + Intronic
998822090 5:146066394-146066416 TCATAATAGCCCATTGAGGTTGG - Intronic
998896355 5:146804277-146804299 TCACAATAACCCAATGAAGTAGG + Intronic
999119609 5:149198910-149198932 TCGAGAAAACCCAATGAGGTTGG - Intronic
999188129 5:149728122-149728144 TCAAAACATCCCTATGAAGTTGG + Intergenic
999480891 5:151947321-151947343 TCTCAATAACCCAAAGAGGTAGG + Intergenic
1000385066 5:160667384-160667406 TCAAAACAACCCAATGAGATGGG - Intronic
1001924899 5:175628919-175628941 TCCCAACATCCCAGTGAGGTAGG + Intergenic
1003609044 6:7591722-7591744 TCAAAATAACCCTATGAGGTAGG + Intronic
1004695490 6:18029132-18029154 TCCAGAGATCCCCATGAGGTTGG - Intergenic
1004940168 6:20548232-20548254 TAAAAATAACTCAATGAGGTTGG + Intronic
1005003440 6:21265190-21265212 CCCCAGTAACCCAATGAGGTGGG - Intergenic
1005241528 6:23835337-23835359 TCCCAATATCCCAATTAGCTGGG + Intergenic
1005339817 6:24832935-24832957 TCAAAACAACCCAATGAGGCGGG + Intronic
1005599822 6:27415020-27415042 TCAAAATATCCCTGTGAGGTAGG - Intergenic
1005637272 6:27764469-27764491 GCCTAATCTCCCAGTGAGGTTGG + Intergenic
1006991890 6:38222041-38222063 TCCAAATATCCCTACAGGGTAGG + Intronic
1007470113 6:42084373-42084395 TCATGATATCCTAATGAGGTTGG + Intronic
1007922654 6:45624794-45624816 TCCAAGTAACCCACTGAGGTAGG + Intronic
1009383898 6:63066452-63066474 TCCAGATGTCCCTATGTGGTTGG - Intergenic
1010483434 6:76381737-76381759 TCCAAATATCCCAAGAAGGATGG - Intergenic
1011650128 6:89498202-89498224 TCAAAATAACCCAAAGAAGTAGG - Intronic
1012308058 6:97684192-97684214 TCACAATAACCCAATGAAGTAGG + Intergenic
1012358059 6:98340818-98340840 GCCAAATATCCCCAGGAGCTGGG - Intergenic
1013189666 6:107791515-107791537 TCCCAATTTCCAAAAGAGGTTGG + Intronic
1013346190 6:109262867-109262889 TCAGAATATCCTTATGAGGTAGG + Intergenic
1013622163 6:111900337-111900359 TCACAACAACCCAATGAGGTAGG + Intergenic
1013880118 6:114888094-114888116 TCCAAGTATACCAAGGAAGTAGG - Intergenic
1014021253 6:116592864-116592886 TCCAAATCTGCATATGAGGTAGG - Intronic
1014807537 6:125846857-125846879 TCACAAAAGCCCAATGAGGTAGG - Intronic
1015425304 6:133058761-133058783 TCCCCATAACCCTATGAGGTAGG + Intergenic
1015576819 6:134680559-134680581 TCACAACAACCCAATGAGGTAGG + Intergenic
1015992909 6:138966504-138966526 TCCTAACAACCCTATGAGGTAGG + Intronic
1017724638 6:157268437-157268459 TCCAAGTAGCCCAGTGAGGTAGG + Intergenic
1017778683 6:157699645-157699667 TCAAAATATATCAAAGAGGTCGG + Intergenic
1019200431 6:170309803-170309825 CCAAAATATCCCATTTAGGTTGG + Intronic
1021609560 7:22444234-22444256 TCACAATAGCCCAATGAGGGAGG - Intronic
1021951268 7:25777266-25777288 TCACAATAAACCAATGAGGTAGG - Intergenic
1022029968 7:26483635-26483657 CCCAAATATCCCCTTGGGGTAGG - Intergenic
1022109553 7:27220091-27220113 TCACAATATCCCCATGTGGTAGG + Intergenic
1022326659 7:29338313-29338335 TCCAAACAGCACTATGAGGTGGG - Intronic
1024867674 7:53922109-53922131 TCAAAATTTCCTAATGATGTTGG - Intergenic
1025952582 7:66157205-66157227 TCTAAATATCAGAGTGAGGTTGG + Intergenic
1026383638 7:69824022-69824044 TCACAATATCTCAGTGAGGTTGG - Intronic
1026458441 7:70593222-70593244 TCAAAACAGCCCCATGAGGTAGG - Intronic
1028656987 7:93219948-93219970 TGCAAATATCCCAAGGAGAGTGG + Intronic
1029350245 7:100008305-100008327 TCATGACATCCCAATGAGGTAGG + Intergenic
1031108725 7:117579314-117579336 TAAATACATCCCAATGAGGTTGG + Intronic
1031148844 7:118029078-118029100 TGAAAACATCCCCATGAGGTAGG - Intergenic
1032865788 7:135922908-135922930 TCCTAATAATCCTATGAGGTGGG - Intergenic
1033291119 7:140083538-140083560 TCAAAATAACCCAGCGAGGTAGG - Intergenic
1035096016 7:156356139-156356161 TCCAAATAGACCAATGAGAGAGG - Intergenic
1036420190 8:8588403-8588425 CCTAAAGATCCCAGTGAGGTTGG + Intergenic
1036511924 8:9408276-9408298 TCCTAATAGTCCTATGAGGTAGG - Intergenic
1037394201 8:18424775-18424797 TGCATATATCACCATGAGGTCGG - Intergenic
1037394319 8:18426115-18426137 TGCATATATCACCATGAGGTCGG - Intergenic
1038294088 8:26275037-26275059 TCAAAACAGCCCTATGAGGTAGG - Intergenic
1039156262 8:34561963-34561985 CTCAAAGAGCCCAATGAGGTAGG + Intergenic
1039531450 8:38266904-38266926 TCACAATAATCCAATGAGGTGGG - Intronic
1040346398 8:46502875-46502897 TCCACATATCACAAGGTGGTTGG + Intergenic
1041115697 8:54534087-54534109 TCAAAATAGCCCTATGAAGTAGG - Intergenic
1041708772 8:60874415-60874437 TCCAAATTTACAAATGAGGAAGG - Intergenic
1042965037 8:74341990-74342012 TCAAAATATCCCAATAAAGGTGG + Intronic
1044900268 8:96936639-96936661 TCTAAATATCCCAAAGATATTGG + Intronic
1045142361 8:99300835-99300857 TCCCAATAACACTATGAGGTAGG - Intronic
1046029935 8:108771287-108771309 TCCTAAGTTCCCTATGAGGTAGG - Intronic
1046425876 8:114047982-114048004 TACCAATAACCCTATGAGGTAGG - Intergenic
1046527740 8:115403274-115403296 TCCAAATATTCAAATGCCGTTGG + Intergenic
1046886453 8:119372581-119372603 TCCCAATACTCCTATGAGGTAGG + Intergenic
1046934220 8:119870936-119870958 TCCCAATAACCCAATGAGATTGG + Intergenic
1047233338 8:123016582-123016604 TCACAATAACCCCATGAGGTAGG + Intronic
1047989146 8:130267447-130267469 TCCCAAAAACCCAATGAGATGGG + Intronic
1048140787 8:131792181-131792203 TCAAAGCAACCCAATGAGGTGGG + Intergenic
1048505179 8:135014499-135014521 TAACAATAACCCAATGAGGTAGG - Intergenic
1049429679 8:142554841-142554863 TCACAATATCACAATGAGGTAGG - Intergenic
1050122273 9:2319773-2319795 TCCCAATATCCCAATCAAATTGG - Intergenic
1052330948 9:27267398-27267420 TCCAAATATCCAAATGTGTTTGG + Intergenic
1055445339 9:76376785-76376807 TCCTAACAACCCTATGAGGTAGG + Intergenic
1056410949 9:86326366-86326388 TCCCAACAACCCTATGAGGTGGG - Intronic
1057834373 9:98432437-98432459 TCTAAAAATCCCACTGAGGTGGG + Intronic
1057908489 9:99000558-99000580 TCAAAACAACCCTATGAGGTAGG + Intronic
1057952775 9:99383187-99383209 TCCATATGACCTAATGAGGTGGG - Intergenic
1058145180 9:101402368-101402390 TCACAATAACCCTATGAGGTAGG - Intronic
1058455073 9:105131171-105131193 TCCTAATAGCCCTATGAAGTTGG + Intergenic
1058848847 9:108990222-108990244 TCAAAACATCCCTATGAGGTAGG - Intronic
1058894165 9:109385462-109385484 TCAAAACAACCCTATGAGGTAGG + Intronic
1059350518 9:113661217-113661239 TCCACATAACCCTATGAGATAGG + Intergenic
1059456878 9:114405436-114405458 TCCCAGTAGCCCTATGAGGTTGG - Intronic
1059630142 9:116113079-116113101 TCCAAACACCCCTAGGAGGTGGG + Intergenic
1059943981 9:119387274-119387296 TGCAAAAATGCCACTGAGGTTGG - Intergenic
1060775712 9:126372642-126372664 TACAAATAATCCTATGAGGTAGG + Intronic
1186680412 X:11867872-11867894 TTCCAAGATCCCCATGAGGTCGG + Intergenic
1187021630 X:15388494-15388516 TCAAAACAACCCTATGAGGTTGG - Intronic
1188306711 X:28568079-28568101 TCCTAACAACTCAATGAGGTAGG + Intergenic
1189053236 X:37668943-37668965 ACCAAACATCCCTATGAGGTAGG - Intronic
1189784191 X:44544430-44544452 TCCCAACATCCCAAGGAGCTGGG + Intergenic
1190373810 X:49768697-49768719 TCCTCATAACCCTATGAGGTAGG - Intergenic
1192080186 X:68040268-68040290 TCATAATATCCCCCTGAGGTAGG - Intergenic
1193329816 X:80223463-80223485 TCCAAATATTCAAATGGGATTGG + Intergenic
1194317935 X:92405143-92405165 TCAAAATAATCCAAAGAGGTAGG - Intronic
1195432567 X:104805783-104805805 TCAAAATAACCCTATGTGGTAGG + Intronic
1195695592 X:107664742-107664764 TCACAACATCCCAGTGAGGTTGG + Intergenic
1195960804 X:110384409-110384431 TTAAAATATCCCTGTGAGGTAGG - Intronic
1197164661 X:123363492-123363514 TCCAAAGATCCAAATGACTTTGG - Intronic
1197354242 X:125416514-125416536 TCCAAATATCCTAATGAATATGG - Intergenic
1198033606 X:132779784-132779806 TCCCAATAACCCTATAAGGTTGG + Intronic
1198340180 X:135706333-135706355 GCCAAATATCCAAATGAATTTGG + Intergenic
1198762617 X:140048936-140048958 TGCCAAACTCCCAATGAGGTAGG - Intergenic
1199017397 X:142834334-142834356 TCCAAATAGCTCTATGAAGTAGG + Intergenic
1199579371 X:149345901-149345923 TCTAAATAACCCTGTGAGGTAGG + Intergenic
1200626110 Y:5518439-5518461 TCAAAATAATCCAAAGAGGTAGG - Intronic
1200688851 Y:6284952-6284974 TAAAAATATCCAAATGAGGCAGG - Intergenic
1200863876 Y:8021913-8021935 GCCAAATATCCCAAGTAGGCAGG + Intergenic
1200903023 Y:8452140-8452162 GCCAAATATCCCAAGTAGGCAGG - Intergenic
1201046421 Y:9889769-9889791 TAAAAATATCCAAATGAGGCAGG + Intergenic
1201783896 Y:17752464-17752486 TGCAAATATCTCCATGAGTTAGG + Intergenic
1201817657 Y:18153523-18153545 TGCAAATATCTCCATGAGTTAGG - Intergenic
1202273212 Y:23089889-23089911 TCAAAACAACCCTATGAGGTAGG - Intergenic
1202292814 Y:23330793-23330815 TCAAAACAACCCTATGAGGTAGG + Intergenic
1202426209 Y:24723633-24723655 TCAAAACAACCCTATGAGGTAGG - Intergenic
1202444580 Y:24946453-24946475 TCAAAACAACCCTATGAGGTAGG + Intergenic