ID: 1109292590

View in Genome Browser
Species Human (GRCh38)
Location 13:60495018-60495040
Sequence AGTGGAGTCAAACATATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109292587_1109292590 15 Left 1109292587 13:60494980-60495002 CCCAATTGCAAAATATTCTTGAA 0: 1
1: 0
2: 4
3: 51
4: 604
Right 1109292590 13:60495018-60495040 AGTGGAGTCAAACATATTTCTGG 0: 1
1: 0
2: 0
3: 10
4: 147
1109292588_1109292590 14 Left 1109292588 13:60494981-60495003 CCAATTGCAAAATATTCTTGAAT 0: 1
1: 0
2: 3
3: 48
4: 385
Right 1109292590 13:60495018-60495040 AGTGGAGTCAAACATATTTCTGG 0: 1
1: 0
2: 0
3: 10
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109292590 Original CRISPR AGTGGAGTCAAACATATTTC TGG Intronic
900796701 1:4712443-4712465 CCTGGAGTCCAACACATTTCCGG + Exonic
901139605 1:7019947-7019969 GGTGGAGCCCAACTTATTTCTGG - Intronic
905455881 1:38087570-38087592 AGGGGAGTCACATATATCTCTGG + Intergenic
906490865 1:46267362-46267384 AGAGGAGTCAAAAACATTCCAGG - Intronic
909548283 1:76870556-76870578 ATTGAAATCAAACATATTTGTGG - Intronic
909613903 1:77584774-77584796 AGTTTAGTAAAACATATTACTGG + Intronic
909763124 1:79319285-79319307 ACTGCAGTCAAACATTATTCTGG + Intergenic
910012260 1:82479996-82480018 AGTGGAGTCTGAATTATTTCAGG - Intergenic
911412819 1:97531617-97531639 TGTGGATTCATACATATTTTAGG + Intronic
911476804 1:98383135-98383157 GGAGGAGTAAAACACATTTCTGG - Intergenic
915596041 1:156897071-156897093 ACTGGAGTCAGAAAGATTTCAGG + Intronic
917755845 1:178097104-178097126 AGTGTAGTCTAACATGTTTCAGG + Intronic
918266764 1:182849724-182849746 AGTGAAGTCAAACATCTTTTGGG + Intronic
919207181 1:194432517-194432539 AGTGGTGCCAAAAATATTTCAGG + Intergenic
923004156 1:230031881-230031903 AGAGGAGTGAAACAACTTTCAGG + Intergenic
1063247828 10:4241445-4241467 TCTGAGGTCAAACATATTTCTGG + Intergenic
1063442167 10:6081598-6081620 AGTGGATTCCAACATTTTTACGG - Intergenic
1066175097 10:32895132-32895154 GGTGGAGAGAAACATATATCTGG + Intergenic
1073236063 10:102017386-102017408 ACTGGAGAGAATCATATTTCTGG - Intronic
1074924087 10:118048860-118048882 AGTGGAGTCAAAGATATGGTTGG + Intergenic
1077999845 11:7484955-7484977 AGTTTAGTCCTACATATTTCTGG + Intergenic
1079631386 11:22681217-22681239 AGTTATGGCAAACATATTTCTGG + Intronic
1080596210 11:33776155-33776177 AATGGAGACAAACATAAATCAGG - Intergenic
1084059634 11:66662226-66662248 AGTGGAATAAACCACATTTCAGG + Intronic
1084917518 11:72440247-72440269 ACTGGAGTAATACAAATTTCAGG + Intergenic
1085997617 11:81939173-81939195 AGTGGAGAGAAACATATCTCAGG + Intergenic
1088131276 11:106494870-106494892 AGTGGAGCTAAAAATATTCCAGG - Intergenic
1088481304 11:110298393-110298415 TTTGGAGTCAAACATATATTTGG - Intergenic
1089857144 11:121556038-121556060 AGTGGAGTCAAGCCTACATCTGG - Intronic
1089899590 11:121966810-121966832 GGTGGAGTCACAGCTATTTCAGG - Intergenic
1090852585 11:130583572-130583594 AGGGGAGTCAAAGATAACTCTGG + Intergenic
1091264272 11:134258331-134258353 GGTGGATTAAAACATATTCCTGG - Intronic
1091414080 12:265141-265163 AGTAGAGTCAAACAATTTTTGGG - Intergenic
1094874811 12:34628629-34628651 TGTAGAGTCAAACATAAATCTGG - Intergenic
1097489470 12:60247567-60247589 AGAAAAGTAAAACATATTTCTGG + Intergenic
1097710155 12:62909090-62909112 AGAGGAGTCAAAGATAATTCCGG - Intronic
1099689629 12:85936684-85936706 AGTTAAGTCCAACATATTTAAGG - Intergenic
1109107717 13:58276312-58276334 AATGGAGTAAAATAAATTTCAGG - Intergenic
1109292590 13:60495018-60495040 AGTGGAGTCAAACATATTTCTGG + Intronic
1109495222 13:63161358-63161380 GGTGTAGTCAAACAAATTTTTGG - Intergenic
1109741963 13:66565425-66565447 AGTGCAGTGAAACAAATTCCTGG + Intronic
1110786908 13:79538880-79538902 CGTGGAGTCAAAGATTATTCTGG - Intronic
1111951879 13:94713987-94714009 AGTGGAGTGAAAAATAACTCTGG + Intergenic
1112301472 13:98234644-98234666 AGAGCAAGCAAACATATTTCAGG - Intronic
1112707331 13:102085482-102085504 AGTGATGTCAAACAATTTTCTGG + Intronic
1116791581 14:49345495-49345517 TGTGTGGTCAAACATCTTTCTGG - Intergenic
1117883480 14:60334889-60334911 AGTGGTTTCAAAGAAATTTCAGG - Intergenic
1121981431 14:98457808-98457830 AGTGGTGTCGAACTTTTTTCAGG - Intergenic
1123723705 15:23082046-23082068 TGTAGAGTCAAACATAAATCTGG - Intergenic
1123977876 15:25570042-25570064 CTTGGAGTTAAGCATATTTCAGG + Intergenic
1125562279 15:40644273-40644295 AGTGGAGAGAAACATAAATCTGG - Intronic
1128328505 15:66740766-66740788 AGTTGAGTCAACTATAGTTCTGG - Intronic
1136295596 16:29300158-29300180 AGTGGCATCAAACACGTTTCCGG - Intergenic
1137474507 16:48795647-48795669 GGTGGATTCAAAGATTTTTCTGG + Intergenic
1140982087 16:80120193-80120215 ACTGAAGTCAAATATTTTTCAGG - Intergenic
1142101511 16:88274345-88274367 AGTGGCATCAAACACGTTTCCGG - Intergenic
1143654547 17:8286203-8286225 AGTTGAGTCTGACCTATTTCTGG - Intergenic
1146459044 17:33029487-33029509 AGTGTAGTCATACATAATGCTGG - Intronic
1148419568 17:47533561-47533583 TTTGGAGGCAAACATATTTTGGG + Intronic
1149286324 17:55169086-55169108 AGAGGAATTAAACATATTACAGG - Intergenic
1153674098 18:7440283-7440305 AGTGGAAACAAACACATTTCTGG - Intergenic
1159865496 18:73699804-73699826 AGTGGAGACAAAACTATCTCTGG - Intergenic
928290283 2:30030649-30030671 AGGGGAGTGACACATTTTTCTGG + Intergenic
929887865 2:45894545-45894567 AGTGAAGACAACCACATTTCAGG - Intronic
935434072 2:103009214-103009236 AGTGGCATCAAACACATTTGTGG - Intergenic
935995203 2:108763783-108763805 AGTGGAGCCAAACCAATTCCTGG + Exonic
936470452 2:112793866-112793888 AGTGGAGTCAAGGTTATCTCTGG + Intergenic
936471402 2:112801929-112801951 TCAGGAGTCAATCATATTTCAGG - Intergenic
937263656 2:120602276-120602298 TGTGCAGTCATAGATATTTCTGG - Intergenic
941542412 2:166803338-166803360 AGTAGAGTATAATATATTTCAGG + Intergenic
941568981 2:167145624-167145646 ATTGGAGTCAAACTTTTTACTGG + Intronic
945454305 2:210032467-210032489 AGTGGCGTCACACATCTTTGTGG - Intronic
947171472 2:227316995-227317017 TGTGGAGCCAAACATATTGTAGG - Intergenic
947212702 2:227722539-227722561 TGTAAAGTCAAACATAATTCTGG - Intergenic
1169763658 20:9125066-9125088 GATGGAGTCAAGCGTATTTCAGG - Intronic
1173100111 20:40079628-40079650 AATGAAGTCAAACAAATTTCAGG + Intergenic
1173153979 20:40592407-40592429 AGTAGACTCTAACATGTTTCAGG + Intergenic
1173756827 20:45523844-45523866 ATTGGAGTTAAACATACTTTTGG + Intergenic
949173278 3:1028407-1028429 AGTTTTGTCAAATATATTTCTGG - Intergenic
950753015 3:15145852-15145874 AGTGGAGAGAAACATAAATCTGG - Intergenic
950904315 3:16524040-16524062 AGTGGAGTGCCACATATTCCTGG + Intergenic
956385695 3:68716503-68716525 AGTGAAGTCAAAGATGTCTCAGG + Intergenic
957124527 3:76141774-76141796 AGTTGTGTCTAACATATTTGAGG - Intronic
958958723 3:100488931-100488953 AGGGGATTCAAACTTAATTCTGG - Intergenic
964039264 3:152239110-152239132 AGTGGTGACAGAAATATTTCTGG - Intergenic
964659365 3:159103397-159103419 AGTGGAGTATGACATATCTCAGG - Intronic
965152197 3:164992048-164992070 AGTGGAAAGTAACATATTTCCGG - Intronic
967918045 3:194593557-194593579 ACTTGAGTCAGACATATTTGAGG - Intronic
969974672 4:11086459-11086481 AGGGAAGACAAACATATGTCAGG + Intergenic
970673365 4:18420593-18420615 AGTGTAGCCAAACACATATCAGG + Intergenic
976661358 4:87543686-87543708 AGAGAAGGCAAACATACTTCAGG + Intergenic
976827106 4:89273309-89273331 TCTGGAGTCAAACAGATTTATGG + Intronic
978285331 4:107071656-107071678 AGTGTAGGCAATGATATTTCAGG - Intronic
981821859 4:148896477-148896499 AGTGGGGCCAAAGGTATTTCAGG + Intergenic
983733464 4:171028191-171028213 AATGCAATTAAACATATTTCAGG + Intergenic
984058127 4:174954334-174954356 ATTGGATTCAAACATGTGTCTGG - Intronic
990532249 5:56686088-56686110 AGTGGAGACAAAGTTATTTTGGG + Intergenic
993429041 5:87808412-87808434 AGCTGATTCAAACATTTTTCTGG + Intergenic
993462485 5:88200863-88200885 GATGGACTCAAACACATTTCTGG + Intronic
994283682 5:97938172-97938194 AGTGGACTCAGACATATTTGAGG - Intergenic
994882024 5:105510441-105510463 AGTATAGTGAAAAATATTTCAGG + Intergenic
994893977 5:105677580-105677602 AATGGAGTCACAGATAATTCAGG + Intergenic
995143924 5:108765005-108765027 TGTGAAGACAAGCATATTTCAGG + Intronic
995297256 5:110536586-110536608 AGTGAACTCACACACATTTCAGG + Intronic
995958344 5:117808048-117808070 ATTGAAATCCAACATATTTCTGG - Intergenic
996156454 5:120108610-120108632 ACTGGAGTCAATCATCTGTCTGG + Intergenic
998252019 5:140559767-140559789 AGTGGTGTACAACTTATTTCTGG + Intronic
1000934578 5:167292620-167292642 AATTGATTCAAAAATATTTCAGG + Intronic
1003379490 6:5610411-5610433 ATTGTAGTCAAAAATATTTGGGG + Intronic
1004049502 6:12061978-12062000 AGTAGAGTCAAAAATAGTTTAGG + Intronic
1004082096 6:12404806-12404828 CCTGGAGTCAATCATATTTAAGG - Intergenic
1006267549 6:32937679-32937701 ATTGTAATCAAACATAATTCTGG - Intronic
1009912815 6:69953915-69953937 AGTGGATTTAAACATATAACTGG + Intronic
1009920411 6:70052252-70052274 AGAGGATTCAAACTTAATTCTGG - Intronic
1010292416 6:74153164-74153186 AGTTGATTAAAAAATATTTCTGG + Intergenic
1010672899 6:78707759-78707781 AGTGGAATTCAAAATATTTCAGG - Intergenic
1011323506 6:86123124-86123146 ATTGGAGTCAAACATTTTCTGGG + Intergenic
1017427971 6:154342200-154342222 TGTGGAATCAAACAGACTTCAGG - Intronic
1020985038 7:15122583-15122605 CGTGGAGTAAGACAGATTTCTGG - Intergenic
1024086667 7:45897653-45897675 AATGGGGTCAAACATTATTCTGG - Intergenic
1025190286 7:56891083-56891105 AGGGGAGTCAAGCATAATTAAGG - Intergenic
1025681653 7:63685837-63685859 AGGGGAGTCAAGCATAATTAAGG + Intergenic
1029919118 7:104243459-104243481 AATGGAGTAAAAAATACTTCAGG + Intergenic
1030590642 7:111477269-111477291 AGTGCAGTCACACATAATCCTGG + Intronic
1031903827 7:127439481-127439503 AGTGGAGTCAAAAAGATTAAGGG - Intergenic
1032646284 7:133828209-133828231 AGTAAAGTCAAATATATTTCAGG - Intronic
1032703001 7:134398552-134398574 AGTGGAGTTATACACATTTATGG + Intergenic
1034162836 7:149005500-149005522 ATTGGAGGGAAACATGTTTCTGG + Intronic
1039650551 8:39336516-39336538 AGAGTAGTCACACATATTTGTGG + Intergenic
1040371282 8:46778384-46778406 AGGGGATTGTAACATATTTCTGG + Intergenic
1040377570 8:46841298-46841320 AGGGGACTGTAACATATTTCTGG + Intergenic
1040719746 8:50304542-50304564 AGTGGAGGCAAAGATATGACAGG + Intronic
1043851654 8:85223054-85223076 AGTGGAGTCAAGACTCTTTCAGG - Intronic
1043937494 8:86158269-86158291 AGTGGATACCAATATATTTCAGG + Intergenic
1045111783 8:98943540-98943562 AGTGCAGTGATACATTTTTCAGG - Intergenic
1045779521 8:105847527-105847549 TGTGCAGTCAACCCTATTTCAGG - Intergenic
1046658262 8:116920863-116920885 TGTAGAGTAAAACATGTTTCAGG + Intergenic
1047717720 8:127611048-127611070 AGTGGAGGGAAAGACATTTCAGG - Intergenic
1048143565 8:131819877-131819899 AGTGATGTCAAAGATATTTTTGG + Intergenic
1048488405 8:134869601-134869623 AGTGGAGGCAAACAGATGGCTGG + Intergenic
1049208369 8:141373916-141373938 AGAGGAGTCAAACATTTGGCTGG - Intergenic
1049981776 9:910539-910561 AGTGAACTCAAACATTTTTATGG + Intronic
1051025168 9:12600910-12600932 ATTAGATTCAAACATTTTTCAGG - Intergenic
1051214241 9:14779179-14779201 AGAGGTGTGAAACATATTTCTGG - Intronic
1053194799 9:36108772-36108794 AGTGGAGTCTAAGATTTTTAGGG - Intronic
1053426810 9:38015547-38015569 AGTAGAGACAAAATTATTTCTGG - Intronic
1056572698 9:87829675-87829697 AATGGTGGAAAACATATTTCAGG + Intergenic
1056846987 9:90047165-90047187 AGTGGACTCAGCAATATTTCAGG - Intergenic
1059806397 9:117805705-117805727 AGAGAAGTCAAACACTTTTCAGG - Intergenic
1060294629 9:122334901-122334923 AGTGGAGTCTAACAGACTGCAGG + Intergenic
1185817022 X:3165459-3165481 AGAGGAGTCTACCATATATCAGG + Intergenic
1186799984 X:13083276-13083298 ATTGAAGTGAAACATATTTAAGG - Intergenic
1186943248 X:14536158-14536180 ATTGCAGAAAAACATATTTCAGG - Intronic
1188151587 X:26682527-26682549 AGTTGAGTCAGATATCTTTCTGG - Intergenic
1188820335 X:34767243-34767265 GATGTAATCAAACATATTTCAGG + Intergenic
1188946321 X:36307709-36307731 AGTGGAATCAAATATAATACAGG + Intronic
1193410414 X:81156217-81156239 TTTGGAGGCAAACATATTGCAGG - Intronic
1195717819 X:107834587-107834609 ATAGGAGTCAAATATTTTTCAGG + Intronic