ID: 1109292837

View in Genome Browser
Species Human (GRCh38)
Location 13:60497167-60497189
Sequence CGGTGAACAGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 2, 1: 12, 2: 87, 3: 147, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109292826_1109292837 23 Left 1109292826 13:60497121-60497143 CCTGCTGGATCCGGAAGGGTGGA 0: 1
1: 19
2: 65
3: 135
4: 239
Right 1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG 0: 2
1: 12
2: 87
3: 147
4: 253
1109292824_1109292837 24 Left 1109292824 13:60497120-60497142 CCCTGCTGGATCCGGAAGGGTGG 0: 1
1: 20
2: 75
3: 132
4: 240
Right 1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG 0: 2
1: 12
2: 87
3: 147
4: 253
1109292828_1109292837 13 Left 1109292828 13:60497131-60497153 CCGGAAGGGTGGAAGTCAACGGC 0: 2
1: 3
2: 38
3: 95
4: 169
Right 1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG 0: 2
1: 12
2: 87
3: 147
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109292837 Original CRISPR CGGTGAACAGCAGTGGTGGA TGG Intronic
903135835 1:21308702-21308724 CGGTGAACAGCCTTTGTGCATGG + Intronic
904993873 1:34615910-34615932 AGGTGAAGAGCAGAGCTGGATGG + Intergenic
906151640 1:43591194-43591216 CGGTGAACAGCATCGGGCGAGGG + Exonic
906545305 1:46616058-46616080 CGGGGAACGGCAGTGGTTCAGGG - Intronic
907410828 1:54282151-54282173 CGGTGCAGAGCAGGGGTGCATGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907602971 1:55788566-55788588 CGGTGAACAGCCGTGGTGGACGG + Intergenic
908523112 1:64964038-64964060 CATTGAACAGGAGTGTTGGAAGG - Intronic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
909695639 1:78465413-78465435 TGGTGAAGAGCAGTGGGTGAGGG + Intronic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910452464 1:87360945-87360967 CTTTGAACACCAGAGGTGGAGGG + Intergenic
910553862 1:88507801-88507823 AGGTGGAAAGCAGTGGTGCAGGG + Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
911143995 1:94535108-94535130 TGGTGAAAAGAAGGGGTGGACGG - Intronic
913198604 1:116477926-116477948 CGGTGAGCACGGGTGGTGGATGG - Intergenic
915725122 1:158011763-158011785 CGGAGGGCAGCAGTGGGGGAAGG + Intronic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
917944343 1:179954032-179954054 AGGTGGACAGAAGTGGTGGGCGG + Intergenic
918068389 1:181117450-181117472 TGGAGACCAGCAGGGGTGGAGGG + Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919765789 1:201126728-201126750 AGGTGCAGAGCAGTGGTGAAGGG - Intronic
919921000 1:202166329-202166351 CGGGGAAAAGAAGTGGGGGAAGG + Intergenic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921837719 1:219795129-219795151 AGGTGAAAAGCAGGGGTGGGGGG - Intronic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1062927583 10:1328305-1328327 CAGTTAACAGCAGTGGAGGGTGG + Intronic
1063022702 10:2145700-2145722 AGGTGGACAGCAGGGGTTGACGG + Intergenic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1067748791 10:48956538-48956560 GGGTGAGCAGCAGAGGTGGCAGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1076211919 10:128655604-128655626 AGGTGCCCATCAGTGGTGGATGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077047643 11:553466-553488 CCGTGACCTGCAGGGGTGGAGGG + Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081614331 11:44581663-44581685 CGGTGAACTGCAGTGGATGGTGG + Intronic
1082737600 11:56873900-56873922 CGATGATCGGCAGTGGTGGATGG - Intergenic
1082767690 11:57181991-57182013 CAGGCAACAGCAGTGCTGGAGGG - Exonic
1083320758 11:61845083-61845105 CTGTGACCAGCAGTGCTGGGTGG - Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1084908369 11:72366974-72366996 AGGTGCCCATCAGTGGTGGACGG + Intronic
1085571633 11:77563763-77563785 TGTTGAATAGCAGTGGTGAAAGG + Intronic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621391 11:78040576-78040598 CACAGAACAGGAGTGGTGGATGG - Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085900977 11:80699570-80699592 CAGTGCTCAGCAGTGGTGGACGG + Intergenic
1087013473 11:93534674-93534696 CAGAGAGCAGGAGTGGTGGAGGG - Intronic
1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089872203 11:121685601-121685623 CAGAGAACATCAGAGGTGGAAGG + Intergenic
1092293641 12:7181266-7181288 TGGTGATCAGCAATGGTGGACGG - Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1095970808 12:47901020-47901042 TGGTGAATAGCAGGAGTGGAAGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098190064 12:67938511-67938533 TGGTGGACATCAATGGTGGAAGG + Intergenic
1098201076 12:68056160-68056182 AGGTGCCCATCAGTGGTGGACGG - Intergenic
1098544216 12:71693631-71693653 CTGTGAATAGCAGTAGTGGAAGG - Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099292613 12:80790072-80790094 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1103037396 12:117667494-117667516 GTGTGAACAGGAGGGGTGGAAGG + Exonic
1103645585 12:122389851-122389873 CTGTCAACACCAGTGCTGGAGGG + Intronic
1103802552 12:123548793-123548815 TGGTGATCAGCAGTGGTGGATGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104808909 12:131608207-131608229 CGGATTCCAGCAGTGGTGGAGGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1106713440 13:32362808-32362830 AGGAGAACAGCAGTGTGGGATGG - Intronic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107299794 13:38953686-38953708 TGATGAAAAGCAGTGGTGGAGGG + Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109380903 13:61558304-61558326 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110660420 13:78054324-78054346 CAGTGACCAGCAGTGACGGAGGG - Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111686103 13:91502453-91502475 AGGTGAACAGCACTGGAGGGAGG + Intronic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113592280 13:111509370-111509392 CGGCGATCAGCAGTGGTAGACGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118437009 14:65780642-65780664 CAGGGCAAAGCAGTGGTGGAAGG + Intergenic
1118843016 14:69526881-69526903 CGGTAAAGTGCAGGGGTGGAAGG - Intronic
1118990095 14:70790164-70790186 CCCTGAGCAGCAGTGGGGGAAGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120097376 14:80403859-80403881 CAGTGATCAGCAGTGGTGGACGG - Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1120723895 14:87916645-87916667 GGGTGAGCTGCAGTGGAGGAAGG + Intronic
1120845329 14:89120059-89120081 TGGTGCTCAGTAGTGGTGGAGGG + Intergenic
1121546240 14:94765699-94765721 TGGTGAAAAGCTGTGGTGAATGG - Intergenic
1121711157 14:96039829-96039851 AGGGGGACAGCAGTGGGGGATGG - Intronic
1122688180 14:103519779-103519801 CGGCGAACATCAGGGGTGCATGG + Exonic
1123058256 14:105582526-105582548 AAGTGACCTGCAGTGGTGGAGGG - Intergenic
1123082344 14:105701451-105701473 AAGTGACCTGCAGTGGTGGAGGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1125255620 15:37759651-37759673 CAGGGAACAGCAGTGGATGATGG + Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1127145658 15:56020397-56020419 AGGTGCCCATCAGTGGTGGACGG - Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131120929 15:89823053-89823075 TGGTGACCAGCAGTGGGGGAGGG + Intergenic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1131922620 15:97346311-97346333 GGCTGAACTGCAGTGGTGCATGG + Intergenic
1132100808 15:99021672-99021694 AGGAGAAGAGCAGTGGTGGGTGG - Intergenic
1132753513 16:1470595-1470617 CACTGAACAGCAATGCTGGAGGG + Intronic
1135538580 16:23312882-23312904 TGGTGAAGAGCTGTGGTGGAGGG + Intronic
1136670745 16:31854882-31854904 CAGATGACAGCAGTGGTGGATGG - Intergenic
1138087200 16:54143879-54143901 AGGTGAACAGCGGTAGGGGAAGG + Intergenic
1139548598 16:67661242-67661264 TGGAGACCAGCAGTGGAGGAAGG - Intronic
1140562763 16:76002892-76002914 AGGTGCCCATCAGTGGTGGATGG + Intergenic
1140604078 16:76513205-76513227 AGGTGAACAGGTGTGGTGGTGGG + Intronic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141605293 16:85149770-85149792 CGGAGAACAGCAGGCATGGAGGG - Intergenic
1141649238 16:85384366-85384388 CAGTAAACAGCAGAGGTGGGAGG - Intergenic
1141757022 16:85998034-85998056 CTGTGATCAGCAGTGATGGCAGG + Intergenic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142591725 17:1009231-1009253 GGGTGGACAGCAGTGGGGAATGG - Intronic
1142591729 17:1009248-1009270 GGGTGGACAGCAGTGGGGGGTGG - Intronic
1142591735 17:1009265-1009287 GGGTGGACAGCAGTGGGGGGTGG - Intronic
1144669846 17:17126738-17126760 CAGTGCACAGATGTGGTGGATGG + Exonic
1145181299 17:20755077-20755099 GGGTGGGCAGCGGTGGTGGAAGG + Intergenic
1147323316 17:39658750-39658772 CGGAGAACAGCAGGGGTCCACGG - Exonic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148819191 17:50350747-50350769 TGGTGAAAAGCAGAGGAGGAGGG + Intronic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150566764 17:66348761-66348783 GGTTGAACAGCAGAGGGGGAGGG + Intronic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152009143 17:77700226-77700248 GGGAGAAGAGCAGGGGTGGACGG + Intergenic
1152623927 17:81379802-81379824 GGGTGAACAGCAGTGGAGGGTGG + Intergenic
1152706661 17:81847154-81847176 CGCTGGACAGCAGTGGTGACCGG + Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155035463 18:22021628-22021650 AGGTTAACAGAAGTGTTGGAGGG - Intergenic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157738440 18:50071206-50071228 GGGTGAATAACAGTGGAGGAAGG - Intronic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158267427 18:55675850-55675872 CGTTGAATAGCAGTGATGAAAGG + Intergenic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG + Intronic
1159474842 18:68907821-68907843 CGTTAAACAGCAGTAATGGAAGG + Intronic
1159487145 18:69076718-69076740 TGTTGAACAGCAGTGGTGAGAGG - Intergenic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1160564757 18:79780143-79780165 CTGTGAACATCAGTGCTGGCCGG + Intergenic
1160564778 18:79780248-79780270 CTGTGAACATCAGTGCTGGCCGG + Intergenic
1160564799 18:79780353-79780375 CTGTGAACATCAGTGCTGGCCGG + Intergenic
1160564820 18:79780458-79780480 CTGTGAACATCAGTGCTGGCCGG + Intergenic
1161056800 19:2194819-2194841 CGGTGCACAGAGGTGGTGCAGGG + Intronic
1161451617 19:4349404-4349426 CTGTGGAAAGCAGTGGTGGCGGG + Intronic
1162007761 19:7790724-7790746 TGGTTCTCAGCAGTGGTGGATGG - Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1163942460 19:20507897-20507919 GGGTGAGGAGCTGTGGTGGATGG + Intergenic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164451248 19:28367080-28367102 CTGTGAGCAGCATGGGTGGATGG + Intergenic
1165823193 19:38690264-38690286 CGGTGAACAGCAGTGAAGGATGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168465978 19:56601499-56601521 CGGTGACCAACAGTGCTGTAGGG - Exonic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925384973 2:3455494-3455516 CTGGGAACAGTAGTGGGGGATGG - Intronic
925504784 2:4549833-4549855 CCGTGAACATCCGTGGTGGGAGG - Intergenic
925684628 2:6458580-6458602 TGGTGAAGAGCAGGGGTGGAGGG + Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
927826353 2:26312423-26312445 TGGTGACCAGCAGTGGTAGAGGG + Intronic
928347674 2:30516323-30516345 CGACGTTCAGCAGTGGTGGACGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930631150 2:53756757-53756779 CGGTGATCAGCAGTGGTGGACGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932420725 2:71599798-71599820 TGGTGAACAGGGGTGGGGGAAGG + Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
934665032 2:96163950-96163972 CGGGGCCCAGCAGTGTTGGAGGG - Intergenic
934911425 2:98258866-98258888 CATTGAATAGCAGTGGTGAAAGG + Intronic
935605670 2:104970207-104970229 CAGTGAGCAGCAGGGGTTGAAGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936081397 2:109434989-109435011 AGGTGCACAGCAGAGGTAGAGGG - Intronic
936399346 2:112153879-112153901 CGGAGAAGGGCAGGGGTGGATGG + Intronic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
938330915 2:130447604-130447626 CGGGGAAAAGCAGAGGTGGGGGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940784021 2:157962894-157962916 CGGTGAACAGGAGCGGGGGCTGG - Intronic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
941587001 2:167372456-167372478 GGGGGAATAGAAGTGGTGGAAGG - Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942830304 2:180232054-180232076 TGGCGAATGGCAGTGGTGGATGG - Intergenic
942831223 2:180238913-180238935 TGTTGAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
943119975 2:183723710-183723732 GGGTCCACAGGAGTGGTGGATGG + Intergenic
944840011 2:203615742-203615764 GGGTCAACAGCACAGGTGGAGGG + Intergenic
944863827 2:203841032-203841054 GGGTGAGAGGCAGTGGTGGAGGG + Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
948489805 2:238305282-238305304 CAGTGAGTAGCAGTGGTGGCAGG - Intergenic
948762101 2:240198664-240198686 CGGTGATGGGCAGTGATGGACGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1171502337 20:25603537-25603559 TGGTGAGAACCAGTGGTGGAGGG + Intergenic
1172053724 20:32139552-32139574 CGGTGAGCAGTGGTGGTGGTGGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173082097 20:39877964-39877986 GTCTGAACAGCAGTGGGGGAAGG - Intergenic
1174694043 20:52539478-52539500 AGATGAACAGGAGTGATGGATGG - Intergenic
1175080594 20:56417348-56417370 CGGGGAACAGCAGGGGAGAAGGG - Intronic
1175477288 20:59285841-59285863 CCGTGCACAGCAGTGGCAGAGGG + Intergenic
1176300620 21:5097310-5097332 GGGAGACCAGCAGAGGTGGAGGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177738119 21:25118775-25118797 CGGGGAACAGCAGTGGTAGAGGG - Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178744773 21:35238254-35238276 GCATGAACAGCAGGGGTGGAGGG + Intronic
1178788360 21:35675298-35675320 CGGTGGCCAGCAGAGATGGAAGG - Intronic
1178940582 21:36901963-36901985 CTGTGGACAGCAGTGGGGGGCGG + Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179786753 21:43734612-43734634 CTGTTAACAGCAGTGCTGCAGGG + Intronic
1179856423 21:44164671-44164693 GGGAGACCAGCAGAGGTGGAGGG + Intergenic
1181468933 22:23126345-23126367 AGGTGAACTGCAGGGGAGGACGG - Intronic
1181611319 22:24014789-24014811 CGGTGAAAAGAAGGGGTGAATGG - Intronic
1182221360 22:28761554-28761576 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1183168275 22:36164294-36164316 CGGTTAACAGAAGTGGGGGCTGG - Intronic
1183803990 22:40192791-40192813 GGATGAACAGCAGGGGTAGAAGG + Intronic
1184195437 22:42924600-42924622 GGGTGGACAGCAGTGGTGGCGGG - Intronic
1184648241 22:45907786-45907808 AGGTGATCAGCAGTGGCAGACGG + Intergenic
1184745473 22:46453188-46453210 CTGTGCACAGCAGGGCTGGAAGG + Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950812488 3:15662633-15662655 TGTTGAAAAGCAGTGGTGAAGGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953627183 3:44580701-44580723 CAGTGCACAGATGTGGTGGATGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
962843924 3:139259009-139259031 CAGGGAACAGCAGAGCTGGAAGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963255679 3:143142484-143142506 CGGCGTTCAGCAGTGGTGGATGG - Intergenic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966545780 3:181145980-181146002 TGTTGAAAAGCAGTGGTGAAAGG - Intergenic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
968350001 3:198046116-198046138 CGGTGGACAGCTGGGGTGCAGGG + Intergenic
968390877 4:192146-192168 TGGTGATCAGCAGTGGTGGATGG + Intergenic
968901570 4:3434568-3434590 CGGGACACAGCAGTGCTGGAGGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969175981 4:5399416-5399438 CTATGTACAGGAGTGGTGGATGG + Intronic
969332343 4:6482760-6482782 TATTGAACAGCAGTGGTGGTAGG + Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
969957309 4:10904017-10904039 CTGGGAACAGAAGTGGTGGTAGG + Intergenic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
971076770 4:23158374-23158396 CAGCGTACAGCAGGGGTGGATGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
973189644 4:47372564-47372586 AGGTGAGGAGGAGTGGTGGATGG - Intronic
974121105 4:57640209-57640231 CAGTGAGCAGCAGTGCGGGATGG + Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978832242 4:113102170-113102192 TGGTGAGCAGCAGCGGTGGCTGG + Intronic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
980889457 4:138798568-138798590 CTGGGAGCAGCAGTGGAGGAGGG + Intergenic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
985226354 4:187765516-187765538 CAGCTAACAGTAGTGGTGGATGG - Intergenic
985350731 4:189058645-189058667 CAGACAACAGCGGTGGTGGACGG - Intergenic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
987508221 5:18800422-18800444 GGCAAAACAGCAGTGGTGGAGGG - Intergenic
987738468 5:21874686-21874708 CTGTGAACAGCAGTGGTGGATGG - Intronic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990879768 5:60526252-60526274 TGGTGAATACTAGTGGTGGAAGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
991290608 5:65030855-65030877 CCGGAAACGGCAGTGGTGGATGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993203450 5:84847975-84847997 CCCTGAACAACAGTGGTGAAGGG + Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994342154 5:98642941-98642963 GGGTGATCAGCAATGATGGAGGG + Intergenic
994851968 5:105067286-105067308 AGGTGTCCAACAGTGGTGGATGG + Intergenic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
997455573 5:134014960-134014982 AGGTGCCCATCAGTGGTGGATGG + Intergenic
999524935 5:152394482-152394504 CGGTGACCAGGAGAGGTGGGGGG + Intronic
1001401562 5:171449470-171449492 CGGGGAAGAGAAGTGGGGGATGG - Intronic
1003564155 6:7208400-7208422 GGGTGAACTGCAGGGTTGGAGGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004926113 6:20416631-20416653 GGGTGAGCAGCACTGGTGTATGG + Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005689098 6:28284588-28284610 CCTTGAACTGCAATGGTGGAAGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1007011949 6:38426521-38426543 GGCAAAACAGCAGTGGTGGATGG - Intronic
1008132932 6:47739140-47739162 TGGTGAGCAGCAGTGATGGTGGG + Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009229363 6:61043668-61043690 TGGTGAACAGCAGTGGGGGTGGG + Intergenic
1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1009394092 6:63177317-63177339 CAGTGCTCATCAGTGGTGGATGG - Intergenic
1009519551 6:64664074-64664096 CAGGGATCAGTAGTGGTGGACGG + Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1009885202 6:69617025-69617047 GGGTGATCAGCAGTGGTGGACGG - Intergenic
1011189091 6:84712068-84712090 CGGTGAACAGCAGTGGCGGACGG + Intronic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012288734 6:97424454-97424476 CACTGAAGAGCAGTGGTGAAGGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1012853801 6:104477168-104477190 GGGTGAAAAGCAGTTGTGAATGG - Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013410504 6:109879599-109879621 TGGTGATCAGCAGTGGTGGACGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014892119 6:126855509-126855531 CGGTGACCAGAAGGAGTGGAAGG + Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1018042752 6:159939729-159939751 GGGTGAACAGCAGGGCTGGCAGG + Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1024019770 7:45357080-45357102 TATTGAATAGCAGTGGTGGAGGG - Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024776892 7:52798229-52798251 CTGTGAACATCAGAGGTGGGTGG - Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1033174826 7:139114240-139114262 CTTTGAGCAGCAGTGGGGGAGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035256762 7:157634022-157634044 TGGGGAACAGCAGTGGAGGCGGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037743257 8:21623829-21623851 CCTTGAACAGCAGCGCTGGATGG + Intergenic
1037773448 8:21817090-21817112 ACCTGAACAGCAGTGGAGGAGGG - Intergenic
1038181092 8:25228437-25228459 CAGTGTACAGCAGTGGCAGAGGG + Intronic
1038992070 8:32878797-32878819 GGGTGAACTGCAGTGAAGGAGGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040768454 8:50944307-50944329 CGCCCAAAAGCAGTGGTGGACGG + Intergenic
1041160856 8:55042400-55042422 TGTTGAACAGAAGTGGTGAAAGG - Intergenic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1044543517 8:93433902-93433924 TGGAGAGCAGCAGTGGTCGAGGG - Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046099059 8:109593831-109593853 GGGTGAAAGGCAGTGGGGGAAGG - Intronic
1046102945 8:109635481-109635503 TGGTGACCAGCAGAAGTGGAGGG - Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048100260 8:131343232-131343254 TGGTGATCAGCAGCGGTGGACGG + Intergenic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1050929936 9:11310393-11310415 AGGTGCCCATCAGTGGTGGATGG + Intergenic
1051116611 9:13701376-13701398 GGTTGAAAAGCAGTGGTGAAAGG + Intergenic
1051400795 9:16679874-16679896 CAGTGGATACCAGTGGTGGAAGG - Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1057508580 9:95658348-95658370 TGCTGAAAAGCAGTGGTGAAAGG + Intergenic
1058639249 9:107067145-107067167 AGGTGAAAGGCAGTGGTGGTGGG - Intergenic
1060462901 9:123875511-123875533 TGGAGAAAAGCAGTGGTGCAGGG + Intronic
1061245589 9:129399879-129399901 CGGTAGACAGCAGTGGCAGAGGG + Intergenic
1061912728 9:133733641-133733663 CGCTGAAGAGCTGTGGTGGGAGG - Intronic
1062049200 9:134438467-134438489 CGCTGAAAGGCAGGGGTGGAGGG - Intronic
1185560908 X:1060072-1060094 CGGCGTTCAGCAGTGGTGGACGG - Intergenic
1186397624 X:9225666-9225688 TGGTTAACAGCAGTTATGGAGGG - Intergenic
1186410576 X:9342218-9342240 GGGTGAAAAGCAGAGGGGGAGGG - Intergenic
1187770540 X:22690946-22690968 AGGTCAAGAGCAGTGGAGGATGG - Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1188869669 X:35358898-35358920 TGGTGATGAGCAGTGGGGGATGG + Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197641681 X:128974990-128975012 CCATGGACAGCAGTGGGGGAGGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198862326 X:141084345-141084367 CGGCGTTCAGCGGTGGTGGACGG - Intergenic
1198900368 X:141503041-141503063 CGGCGTTCAGCGGTGGTGGACGG + Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199432073 X:147773164-147773186 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200415982 Y:2910352-2910374 CGGCGATCAGCAGTGGTGAACGG + Intronic
1200849217 Y:7865528-7865550 TGGTGACCAGCACTGGTGGATGG + Intergenic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1201798480 Y:17927131-17927153 CCGTGAAGAACAGTGGTGAAGGG + Intergenic
1201803073 Y:17978826-17978848 CCGTGAAGAACAGTGGTGAAGGG - Intergenic
1202040828 Y:20681811-20681833 GGGTGAACAGCAGTGCTCAATGG - Intergenic
1202359800 Y:24095821-24095843 CCGTGAAGAACAGTGGTGAAGGG + Intergenic
1202510978 Y:25574293-25574315 CCGTGAAGAACAGTGGTGAAGGG - Intergenic