ID: 1109294615

View in Genome Browser
Species Human (GRCh38)
Location 13:60514390-60514412
Sequence TTGGATGAGCACCATGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 2, 2: 1, 3: 25, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109294615 Original CRISPR TTGGATGAGCACCATGACCT TGG Intronic
900903184 1:5530922-5530944 ATGGTTTAGCACCATCACCTTGG + Intergenic
903657930 1:24960226-24960248 TTTGATGAACACCATGAGCATGG - Intronic
905218648 1:36428599-36428621 TAGGACTAGCTCCATGACCTTGG - Intronic
907332949 1:53683237-53683259 TTGGATGAGCACCTGGCCATTGG - Intronic
908088402 1:60661236-60661258 TTGGGTGATCAGCATGATCTGGG - Intergenic
911796561 1:102084197-102084219 TTTGAGGAGAACCATGCCCTAGG + Intergenic
917505043 1:175619741-175619763 TTTCCTGAGCATCATGACCTGGG - Intronic
921470349 1:215540413-215540435 TTGGCTGGGCACCATGGCCTTGG + Intergenic
922560085 1:226563517-226563539 TTGGGTGTGCACAATGACCCCGG - Intronic
923658705 1:235940374-235940396 GTGGATGAGCACCCAGAACTTGG + Intergenic
923794579 1:237141830-237141852 TTGGCTGGGCACTATGGCCTTGG + Intronic
1065564569 10:26995851-26995873 TTGGATGAGCACTGAGTCCTGGG + Intronic
1067209077 10:44243356-44243378 TTGGGAGCCCACCATGACCTGGG - Intergenic
1067512532 10:46907898-46907920 GTTGATGAGGACCATGAGCTTGG - Intergenic
1067649712 10:48143924-48143946 GTTGATGAGGACCATGAGCTTGG + Intergenic
1068444780 10:57107164-57107186 ATGGGTCAGCACCATGCCCTTGG - Intergenic
1068626994 10:59260170-59260192 TTGGATTAGCACGGTGGCCTTGG - Intronic
1070982672 10:80662295-80662317 TTGGACCAGCAGCATCACCTAGG + Intergenic
1071860641 10:89669192-89669214 ATGGTTTAGCACCATCACCTTGG - Intergenic
1075902335 10:126053027-126053049 ATGGTTTAGCACCATCACCTTGG + Intronic
1076634553 10:131873871-131873893 TGGCCTGAGCACCATGTCCTTGG - Intergenic
1079364107 11:19794066-19794088 GTAGATGAGCCCCATGACATAGG + Intronic
1079410683 11:20184578-20184600 ATGGCTTAGCACCATGACCTTGG + Intergenic
1079535235 11:21506349-21506371 ATGAATGAGCACCATGACTTGGG - Intronic
1079788237 11:24702641-24702663 TTGTAGGAGCACCATCCCCTTGG - Intronic
1081582694 11:44363300-44363322 TTTGTTGGGCACCATGAGCTTGG + Intergenic
1082993076 11:59225652-59225674 ATGGAAGAGCACCATCCCCTTGG - Intergenic
1084953435 11:72679063-72679085 CTGAAGGAGCACCATGTCCTTGG + Intergenic
1085241787 11:75062551-75062573 ATGGTTGAGCACCATCCCCTTGG + Intergenic
1086207265 11:84274518-84274540 TTGGAAGAGCAGCATGATTTGGG + Intronic
1086398292 11:86439979-86440001 TTGGCTGAGCACCAGCACCAAGG + Intergenic
1087529753 11:99364772-99364794 TTGGTTGAGCTTCATGACCTTGG + Intronic
1088839736 11:113615205-113615227 TTGGTTGGGCACCATAACCTTGG - Intergenic
1091746156 12:2994521-2994543 TCGAATGAGCACAATGACCTAGG - Intronic
1093146397 12:15571730-15571752 TTGAATGGGCACCATGACACAGG - Intronic
1097881714 12:64692338-64692360 TTAGATTAGTAGCATGACCTTGG + Intronic
1099138828 12:78943498-78943520 ATGGTTTAGCACCATGTCCTTGG - Intronic
1099895002 12:88634218-88634240 TTGGCTGGGCACCGTGGCCTTGG + Intergenic
1100176104 12:92032825-92032847 TCGGGTGAGCATCAAGACCTGGG - Intronic
1102415984 12:112763212-112763234 TTGAATGCACACCATGTCCTAGG - Intronic
1103413334 12:120727896-120727918 GCTGATGAGCTCCATGACCTTGG - Intronic
1106186790 13:27416603-27416625 GTGGATGAGCACCATTATGTTGG - Intergenic
1109294615 13:60514390-60514412 TTGGATGAGCACCATGACCTTGG + Intronic
1109954857 13:69552370-69552392 TTGGATTAGCACCAATCCCTTGG + Intergenic
1110375448 13:74788414-74788436 TTGGCTGGGAACCATGGCCTTGG + Intergenic
1111427685 13:88109520-88109542 TTGGCTGGGCATCATGGCCTTGG + Intergenic
1111682899 13:91466091-91466113 TTGACTGGGCACCATGGCCTTGG - Intronic
1113013167 13:105793890-105793912 ATGGTTTAGCACCATCACCTTGG - Intergenic
1113711954 13:112471278-112471300 GTGGATTAGCACCATCCCCTTGG - Intergenic
1114355434 14:21903075-21903097 TGGGATGAGCACCAGGAGCATGG - Intergenic
1114917232 14:27284268-27284290 TTGGCTTAGCACCATCTCCTTGG + Intergenic
1115698825 14:35928273-35928295 TTGGCTGGGCACCATGGCCTTGG + Intronic
1116479526 14:45381964-45381986 TTGGGTGAGAACTATGTCCTGGG - Intergenic
1117804263 14:59474201-59474223 TTGGCTGGGCACCATGCCCTTGG - Intronic
1119052480 14:71383769-71383791 ATGGATTAGCACCATCCCCTTGG - Intronic
1119879620 14:78090195-78090217 TGGGATGAGCACCCAGACCAGGG - Intergenic
1121395839 14:93622514-93622536 CTGGATGATCACCCTGACCCGGG + Exonic
1122823472 14:104358682-104358704 TGGGATGAGCACCCTGCTCTGGG + Intergenic
1124202035 15:27686882-27686904 CTGGAAGAGCACGAGGACCTGGG + Intergenic
1125798598 15:42424160-42424182 TGAGATGAGCACGATGAACTAGG + Intronic
1126039267 15:44574791-44574813 TTAGATGATAATCATGACCTGGG - Intronic
1126300079 15:47184935-47184957 TTGGGTGAGCACGAGTACCTGGG + Intronic
1129061612 15:72864787-72864809 GTGGATGAGCTGCAGGACCTGGG + Intergenic
1130356124 15:83132036-83132058 GCTGATGAGCACAATGACCTTGG + Exonic
1132630681 16:915802-915824 TGAGATGAGCACCATCACCGGGG + Intronic
1132830965 16:1928132-1928154 TTTGAGGAGCTCCTTGACCTAGG + Intergenic
1133741434 16:8654728-8654750 TTGGAGGAGCACCAAGCCCAGGG - Intergenic
1134672304 16:16064748-16064770 TTCACTGAGCACCATGATCTGGG + Intronic
1136585523 16:31181822-31181844 GTGGATGTCCACCAAGACCTTGG + Intronic
1137592668 16:49703401-49703423 GTGGATGGGCACCCTGCCCTGGG - Intronic
1138019578 16:53466069-53466091 TTGGCTGGGCACCATGGCCTTGG + Intronic
1138681666 16:58688064-58688086 TAGGCTGGGCACCATGGCCTTGG - Intergenic
1139821350 16:69723890-69723912 CTAGCTGAGCAACATGACCTGGG + Intronic
1145388743 17:22438314-22438336 TTGGATTTGCACCCTGACATAGG - Intergenic
1147931356 17:43983558-43983580 AGGGATGAGGACCATGCCCTGGG + Intronic
1149243633 17:54679920-54679942 TTGGATGAGAAAAATGTCCTAGG + Intergenic
1149398449 17:56269476-56269498 TTACATGAGCTCCATGACCTTGG - Intronic
1150573325 17:66407290-66407312 ATGGTTTAGCACCATCACCTTGG + Intronic
1151027842 17:70699995-70700017 TATGATGAGCAGCATGGCCTTGG - Intergenic
1157070655 18:44404071-44404093 TTGGATGGGCACTATGCCTTTGG + Intergenic
1157891999 18:51426687-51426709 ATGGATTAGCACCATCCCCTTGG + Intergenic
1159075878 18:63681485-63681507 GTGGCTGAGCACCATGAGCATGG - Intronic
1159218640 18:65429570-65429592 ATGGTTTAGCACCATGTCCTCGG + Intergenic
1160420743 18:78742275-78742297 GTGGCTGAGAACCATGAGCTGGG - Intergenic
1164686314 19:30168847-30168869 TGGGATGAGAACTGTGACCTGGG + Intergenic
1165884358 19:39067094-39067116 ATGGGTGAGCACCATCCCCTTGG - Intergenic
1167346414 19:48948243-48948265 ATGGTTTAGCACCATCACCTTGG + Intergenic
926096853 2:10086925-10086947 CTGGTTGACCACCATGACCTGGG - Intergenic
927081048 2:19630958-19630980 TTAAAGGAGCACCATGAACTTGG - Intergenic
927919560 2:26961575-26961597 TAGGAGAAGCACCATAACCTGGG - Intergenic
928342156 2:30453582-30453604 TTGGATGTACACCATGAACTTGG + Intronic
929333928 2:40717094-40717116 CTGGATGAGCACCATCCCCTGGG + Intergenic
929747142 2:44670780-44670802 CTGGATCAGCAGCATAACCTAGG - Intronic
929938085 2:46309565-46309587 TTGGAGGAGCATGAAGACCTAGG + Intronic
930841819 2:55855715-55855737 TGGGATGAGCACAGTGACCTTGG + Intergenic
930952035 2:57155266-57155288 ATGGTTTAGCACCATCACCTTGG - Intergenic
933006930 2:77006395-77006417 TTGGTTGAGAAATATGACCTAGG + Intronic
933484967 2:82909595-82909617 ATGGTTTAGCACCATCACCTGGG + Intergenic
936927183 2:117749251-117749273 TCGGCTGGGCACCATGGCCTTGG + Intergenic
937819150 2:126288251-126288273 TTGGCTGAGCAACATAGCCTTGG + Intergenic
938141887 2:128801096-128801118 ATGGTTTAGCACCATGGCCTTGG - Intergenic
939981037 2:148782148-148782170 GTGGATGTGCTCCATGAGCTGGG + Intronic
939997894 2:148937300-148937322 TGGGATGATCCCCATGAGCTGGG - Exonic
943409504 2:187529384-187529406 TTGGACCAGCACCTTGATCTTGG - Intronic
944338446 2:198565857-198565879 ATGGTTTAGCACCATCACCTTGG + Intronic
945471581 2:210233725-210233747 TTGGCTGAGCACCATGACCTTGG - Intergenic
945890153 2:215422165-215422187 TGGGATAAGCAGCATGACATGGG - Exonic
946235511 2:218322506-218322528 CTGGAGGAGCAACATGACCTAGG - Intronic
946336237 2:219038522-219038544 CTGGGTGAGCATCATGTCCTTGG + Exonic
946444772 2:219728789-219728811 TTGATAGAGCACCTTGACCTGGG + Intergenic
946658297 2:221972738-221972760 TACAATGAGCTCCATGACCTTGG + Intergenic
1168862062 20:1052669-1052691 GTGGAGGAGCACCCTGACCCAGG + Intergenic
1169412238 20:5381613-5381635 ATGGCTTAGCACCATCACCTTGG - Intergenic
1169471366 20:5888396-5888418 TTGGTAGAGAACCATGACCTTGG + Intergenic
1169511590 20:6269634-6269656 ATGGTTTAGCACCATCACCTTGG + Intergenic
1172816366 20:37690278-37690300 TTTGGTGAGCACCCTGAACTGGG - Intergenic
1173887149 20:46469792-46469814 TTGGCTGGGCACCATGACCTTGG + Intergenic
1175537916 20:59728236-59728258 TTCGTTTAGCACCATGATCTTGG + Intronic
1178402792 21:32301313-32301335 GTGGGTTAGCACCATGCCCTTGG + Intronic
1180093810 21:45545288-45545310 ATGGCTTAGCACCATCACCTTGG + Intergenic
1182086724 22:27566004-27566026 ATGGATGAGCATCATCAGCTGGG - Intergenic
1182844958 22:33422824-33422846 ATGGTTTAGCACCATCACCTTGG - Intronic
1185330392 22:50249665-50249687 TGGGATGTGCACCATGGCCAGGG - Exonic
950317614 3:12018372-12018394 TTGGATAAGCAGCGTGACTTTGG + Intronic
950799815 3:15541286-15541308 ATGGATTAGCACCATCCCCTTGG - Intergenic
951237109 3:20249557-20249579 TTGGCTTAGCACCATCCCCTTGG - Intergenic
953565414 3:44027931-44027953 TTGGATGAGCACCATTGCAGAGG + Intergenic
954698157 3:52438396-52438418 ATGGAGGAGAACCAAGACCTGGG + Intronic
956111597 3:65875586-65875608 ATCGATCAGCCCCATGACCTTGG + Intronic
957694220 3:83613261-83613283 CTGGCTGAGCACCATCCCCTTGG - Intergenic
958709772 3:97703741-97703763 TTGGTTCAGCAACTTGACCTTGG + Intronic
961188773 3:124939809-124939831 TTTGAAGAGCACCATGATTTAGG + Intronic
963423294 3:145089692-145089714 TGGGATGAGCAACCAGACCTAGG + Intergenic
964718952 3:159752699-159752721 ATGGATTAGCACCATCCCCTTGG - Intronic
964858374 3:161172158-161172180 TCTGCTGAGCACCAAGACCTTGG - Intronic
966668910 3:182505443-182505465 TAGGCTGAGCACCATGATATTGG - Intergenic
968803062 4:2755842-2755864 TTGGGGGAGCACCAGGTCCTGGG - Intronic
969082412 4:4629062-4629084 ATGGCTTAGCACCATCACCTTGG + Intergenic
969180502 4:5437017-5437039 TGGGCTGAGCACCAGGTCCTGGG + Intronic
969726167 4:8919746-8919768 CTGTGTGAGCACCTTGACCTGGG + Intergenic
971562275 4:28095276-28095298 TTGGTTTAGCACCATCTCCTTGG - Intergenic
974106742 4:57478131-57478153 TTGGGTGGGAACCTTGACCTGGG + Intergenic
975636682 4:76457237-76457259 ATGGTTTAGCACCATTACCTTGG + Intronic
975915576 4:79321534-79321556 ATGTAGGAGAACCATGACCTTGG + Intronic
976756398 4:88502462-88502484 TTGCATGAGAACCCTGACCCTGG - Intronic
977769578 4:100841674-100841696 TTGCAGGAGCAGCCTGACCTTGG - Intronic
982328213 4:154151835-154151857 TTGGAAGGACACCATGAACTTGG - Intergenic
982894295 4:160897498-160897520 TTGGCTGGGCACCATGGCCTTGG + Intergenic
983630242 4:169842505-169842527 TTGGCTGGGCACCATGGCCTTGG + Intergenic
983871814 4:172832587-172832609 TTTGAAGAGCAGAATGACCTTGG + Intronic
987816846 5:22913220-22913242 CCAGATGAGCACCTTGACCTTGG - Intergenic
988850955 5:35180324-35180346 TTGGTTTAGCACCATTCCCTTGG + Intronic
988855704 5:35226335-35226357 TTGGACTAGCTCCATAACCTTGG + Intronic
990569548 5:57064414-57064436 ATGGATTAGCACCATCCCCTCGG + Intergenic
992896888 5:81253401-81253423 TTGGATAAATCCCATGACCTCGG + Intronic
993915973 5:93742574-93742596 GAGGAAGAGCACAATGACCTTGG + Intronic
995414323 5:111891815-111891837 ATGGTTCAGCACCATGCCCTTGG - Intronic
995561660 5:113388488-113388510 ATGGTTGAGCACCATCCCCTTGG + Intronic
997124258 5:131209952-131209974 ATGGCTTAGCACCATCACCTTGG + Intergenic
997237460 5:132281550-132281572 TTGGCTGGGTACCATGGCCTTGG + Intronic
997273231 5:132559363-132559385 TTGTACTAGCACCATTACCTTGG - Exonic
997484715 5:134220500-134220522 TTGGATGAGAACCATGAAGGAGG - Intronic
1000646834 5:163769646-163769668 ATGGTTCAGCACCATGCCCTTGG - Intergenic
1001258126 5:170200875-170200897 ATTGATGACCACCATGACCTAGG + Intergenic
1001701541 5:173710135-173710157 AGGAATGAGGACCATGACCTTGG - Intergenic
1002018374 5:176344735-176344757 ATGGTTGAGCACCATCCCCTTGG - Intronic
1002320297 5:178371503-178371525 TTGGCTGAGCTACCTGACCTTGG + Intronic
1003151608 6:3556426-3556448 TTGGATTGGCACCATGTCCAGGG + Intergenic
1003315434 6:5007459-5007481 TTGGATTTGCACCCTGACCCAGG - Intergenic
1003347068 6:5279829-5279851 TTGGATGAGGACCACCACATTGG + Intronic
1004046333 6:12027445-12027467 TGGGTTGAGACCCATGACCTTGG - Intronic
1004901769 6:20200882-20200904 TTGGCTGAGCACCATGACCTTGG - Intronic
1005750359 6:28876292-28876314 TTGGCTGGGCACCATGGCCTTGG + Intergenic
1010988158 6:82449869-82449891 TTGGTTTAGCACCATCCCCTTGG - Intergenic
1012296782 6:97533901-97533923 TTGGCTGGGCACCATGGCCTTGG + Intergenic
1015556537 6:134467809-134467831 TTTTCTGAGCACCATTACCTAGG - Intergenic
1016232808 6:141827128-141827150 TTGTTGGAGCACCATGACTTGGG + Intergenic
1017047115 6:150357027-150357049 ATGGCTTAGCACCATCACCTTGG + Intergenic
1017837485 6:158192008-158192030 TTGGATGAGTCCAATGCCCTGGG + Exonic
1018264148 6:162003457-162003479 TTGGCTGAGCCCCATAGCCTTGG + Intronic
1020436044 7:8163629-8163651 GAGGTTGAGCACCATGTCCTCGG - Intronic
1020683155 7:11261572-11261594 TTGACTGGGCACCATGGCCTTGG - Intergenic
1021345411 7:19521310-19521332 TTGGATGAGAATCCTGATCTGGG + Intergenic
1023969886 7:44983087-44983109 TTTGCTGTGCACCAGGACCTGGG - Intergenic
1027161812 7:75808221-75808243 TTGGCTCAGCACCATGGCCTGGG - Intergenic
1032891251 7:136197957-136197979 ATGGATTAGCACCATCCCCTTGG - Intergenic
1033931338 7:146526543-146526565 ATGGTTGAGCACCATCCCCTTGG - Intronic
1036615822 8:10386677-10386699 TGGGATCAGCAGCATCACCTGGG - Intronic
1036637034 8:10558278-10558300 ATGGTTAAGCACCATCACCTTGG - Intergenic
1036812899 8:11879961-11879983 TGGGATCAACACTATGACCTTGG - Intergenic
1036914547 8:12792841-12792863 ATGGATTAGCACCATCCCCTCGG - Intergenic
1041754543 8:61299706-61299728 TTGGATGAACACCACCACATAGG + Exonic
1041936437 8:63337230-63337252 TTCCAGGAGCACCATGACCCTGG - Intergenic
1044018541 8:87075713-87075735 TGAGATGAGCAGCAGGACCTAGG + Intronic
1044264001 8:90161501-90161523 TTGGATCTGCACCCTGACCCAGG + Intergenic
1044619314 8:94173298-94173320 ATGGCTGAGCACCACGCCCTTGG + Intronic
1049032048 8:140045302-140045324 TTAAATGAGCACAAGGACCTTGG + Intronic
1049101910 8:140586165-140586187 TGGGCTGGGCACCATGCCCTGGG + Intronic
1049850833 8:144829285-144829307 TTGTATGACCACCATGGACTGGG + Intronic
1052606813 9:30714626-30714648 TAGTATGAGCACCTTGATCTGGG + Intergenic
1052986030 9:34488754-34488776 ATGGATGAACAAAATGACCTGGG + Intronic
1055451226 9:76433150-76433172 TTGGATGCGGACCAAGAACTTGG + Intronic
1055879851 9:80987661-80987683 ATGGATTAGCACCATTCCCTTGG + Intergenic
1061516345 9:131092657-131092679 TAGCCTGAGCACCCTGACCTAGG - Exonic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1187782464 X:22843319-22843341 TTGGAGGAGACCCATGACCTTGG - Intergenic
1188590933 X:31834342-31834364 TTTGCTGTGGACCATGACCTTGG - Intronic
1191101845 X:56738108-56738130 TTGGATTAGCACTTTGACCAAGG - Intergenic
1192912898 X:75624083-75624105 GTGGTTTAGCACCATCACCTTGG - Intergenic
1193802025 X:85947342-85947364 ATGGTTTAGCACCATCACCTTGG + Intronic
1195373071 X:104199244-104199266 CTGGATGAGCAGCATCACATAGG - Intergenic
1195717180 X:107828025-107828047 ATGGTTTAGCACCATCACCTTGG + Intronic
1197588632 X:128381843-128381865 GTGGAAAAGCTCCATGACCTTGG + Intergenic
1199188693 X:144945436-144945458 ATGGTTTAGCACCATCACCTCGG - Intergenic
1199944263 X:152652898-152652920 TCGGATGAGCGCCATGGCCATGG + Exonic
1200316062 X:155134454-155134476 TAGGCTGGGCACCATGGCCTTGG - Intronic
1201178782 Y:11326478-11326500 TTAGATGAGCTACATCACCTGGG + Intergenic
1201788360 Y:17809367-17809389 ATGGACGAGGACCGTGACCTAGG - Intergenic
1201813193 Y:18096621-18096643 ATGGACGAGGACCGTGACCTAGG + Intergenic
1202332673 Y:23770991-23771013 ATGGATGAGGACCGTGACCTAGG - Intergenic
1202538096 Y:25899072-25899094 ATGGATGAGGACCGTGACCTAGG + Intergenic